WO2015131855A1

WO2015131855A1 - Humanised anti-human epidermal growth factor receptor antibody and application thereof

Info

Publication number: WO2015131855A1
Application number: PCT/CN2015/073801
Authority: WO
Inventors: 孙乐
Original assignee: 回而生医药科技（北京）有限公司
Priority date: 2013-03-18
Filing date: 2015-03-06
Publication date: 2015-09-11
Also published as: CN104059148B; CN104059148A

Abstract

Provided is a humanised anti-human epidermal growth factor receptor (EGFR) antibody and an application thereof. A strain of EGFR mouse monoclonal antibody LA22 is humanised, so that human origin amino acid sequences within the antibody reach more than 90%, and an anti-human EGFR monoclonal antibody is filtered out. The affinity of the binding between the present antibody and a human EGFR is 2.3 nM, equal to a mouse origin antibody. After binding to an EGFR of a tumour cell surface, the present antibody rapidly induces endocytosis of the EGFR of the tumour cell surface, and becomes an ideal biological targeted therapy antibody. The present invention provides a specific antibody drug for EGFR-targeted prevention and treatment of tumours and other diseases such as inflammatory and autoimmune diseases. The risk of the present antibody drug producing human anti-mouse antibodies (HAMA) in a patient can be significantly reduced, the half-life of the antibody drug is extended, and efficacy is improved.

Description

Humanized anti-human epidermal growth factor receptor antibody and application thereof

Technical field

The invention relates to the preparation and application of a human genetically engineered antibody for treatment, and mainly relates to an antibody specific for human epidermal growth factor receptor (EGFR) and application thereof.

Background technique

Epidermal growth factor receptor (EGFR) is a member of the epidermal growth factor gene (erbB) family and has been found in the development of various tumors such as breast cancer, colon cancer, head and neck cancer, kidney cancer, lung cancer, pancreatic cancer, and prostate cancer. Significant influence. Many studies at home and abroad have shown that antibodies against EGFR can effectively inhibit the EGFR signal transduction pathway by blocking the binding of ligands, and a variety of human tumors caused by EGFR overexpression or/and mutation. Have a good effect. Epidermal growth factor receptor (CSF) is one of the most intensive and well-received cancer therapeutic targets. The use of genetic engineering to develop monoclonal antibodies against EGFR is a hot research topic in cancer therapy.

EGFR molecules are membrane antigens that are widely distributed on the surface of human tumor cells and play an important role in intracellular information transmission. The use of human or humanized antibodies is one of two possible methods to overcome the human anti-mouse antibody response (HAMA response). Due to the high specificity and high affinity of human antibodies, it is mainly used as a mouse monoclonal. The method of humanization of antibodies. In 2005, the EGFR monoclonal antibody Erbitux produced by ImClone in the United States was marketed in the United States, which can prolong the life of patients with rectal cancer when used together with chemotherapy. The treatment of nasopharyngeal carcinoma by Cuba and China Baitai. Taixinshengbizumab is also targeting the same target of EGFR and was launched in 2009.

The currently marketed Erbitux monoclonal antibody is a humanized mouse anti-EGFR monoclonal antibody, but the monoclonal antibody LA22 of the present invention targets completely different sites of EGFR, and the tumor suppressing mechanism is different from that of Erbitux, and the simultaneous use with Erbitux can improve the therapeutic effect. More importantly, it binds to EGFR on the surface of tumor cells and can rapidly induce EGFR endocytosis on the surface of tumor cells, making it an ideal biotargeting antibody.

Summary of the invention

A first object of the present invention is to provide a humanized anti-EGFR antibody.

A second object of the present invention is to provide a gene encoding the above antibody.

A third object of the present invention is to provide the use of the above antibody for the preparation of a medicament for treating a malignant tumor and an autoimmune disease which highly expresses/overexpresses EGFR.

The humanized anti-human EGFR monoclonal antibody provided by the invention has a light chain constant region and a heavy chain constant region which are a light chain constant region and a heavy chain constant region of a human whole antibody immunoglobulin IgG1, respectively; The heavy chain variable region is the light chain variable region and the heavy chain variable region of the humanized EGFR murine monoclonal antibody LA22, respectively, and the light chain variable region amino acid sequence of the EGFR murine monoclonal antibody LA22 is SEQ ID NO As shown in .2, the heavy chain variable region amino acid sequence is set forth in SEQ ID NO. 1, and the humanization is carried out in the FR region of the variable region.

In one embodiment of the invention, the EGFR murine monoclonal antibody LA22 heavy chain constant region and the light chain constant region are replaced with the heavy chain constant region and the light chain constant region of human IgG1, respectively, by EGFR mouse monoclonal antibody LA22 heavy chain Humanization of the framework region FR of the light chain variable region, obtaining a humanized anti-human EGFR monoclonal antibody with good biological activity and antigen affinity.

The humanized anti-human EGFR monoclonal antibody provided by the present invention, wherein the humanized modified light chain variable region comprises any one of the amino acid sequences shown in SEQ ID NO. 12 to 14, and the heavy chain variable region contains SEQ. Any one of the amino acid sequences shown in ID Nos. 7 to 11.

Further, the humanized light chain variable region thereof contains the amino acid sequence shown in SEQ ID NO. 14, and the heavy chain variable region contains any one of the amino acid sequences shown in SEQ ID NOS. 7 to 11.

Further, the humanized light chain variable region thereof contains any one of the amino acid sequences shown in SEQ ID NO. 12 to 14, and the heavy chain variable region contains the amino acid sequence shown as SEQ ID NO.

Further, the humanized light chain variable region thereof comprises the amino acid sequence shown in SEQ ID NO. 14 (ie, light chain h2), and the heavy chain variable region contains the amino acid set forth in SEQ ID NO. Sequence (ie heavy chain H3).

The invention provides a gene encoding the above antibody. In the gene encoding the above antibody, the gene encoding the light chain variable region has a nucleotide sequence which is a DNA sequence as shown in any one of SEQ ID NOS. 20 to 22; and a nucleotide sequence of a gene encoding a heavy chain variable region; The DNA sequence shown in any one of SEQ ID NOS. 15 to 19.

Preferably, the gene encoding the light chain variable region has a nucleotide sequence as set forth in SEQ ID NO. The DNA sequence; the gene encoding the heavy chain variable region has a nucleotide sequence of the DNA sequence shown in SEQ ID NO.

The present invention provides an expression vector comprising the above gene.

Host bacteria, host cells or expression cassettes containing the expression vector are within the scope of the invention.

The present invention provides the use of the above humanized anti-EGFR monoclonal antibody for the preparation of a medicament for treating diseases targeting EGFR.

The drug is an antitumor drug, an anti-inflammatory drug or a drug for treating an autoimmune disease.

The present invention provides a medicament or a detection reagent comprising the above humanized anti-EGFR monoclonal antibody.

The present invention provides primers for cloning the murine monoclonal antibody LA22 heavy chain and light chain variable regions, respectively VH1FOR:TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG

VH1BACK: AGGTSMARCTGCAGSAGTCWGG

VK1FOR: GTTAGATCTCCAGCTTGGTCCC

V K1BACK: GACATTCAGCTGACCCAGTCTCCA

The present invention provides a method of preparing the above humanized anti-EGFR monoclonal antibody, comprising:

(1) Extracting total RNA from hybridoma cell line LA22 tumor cells, VH1FOR and VK1FOR as primers, respectively, reverse transcription of total RNA into heavy chain variable region and light chain variable region cDNA; then heavy chain variable region and light The cDNA of the variable region of the chain was used as a template, and the heavy chain variable region of the murine monoclonal antibody LA22 antibody was synthesized by VH1FOR+VH1BACK, and the mouse monoclonal antibody LA22 antibody light chain was synthesized by PCR amplification with VK1FOR+VK1BACK. Region; recover the target fragment, clone and transform competent cells, and screen positive clones;

(2) The light chain variable region of the correct positive clone was designed to be Kpn I+Xho I, the heavy chain variable region cleavage site KpnI+AgeI, and the expression vectors pJH16-H39E3.L1kappa and pJH16, respectively. Ligation, transformation, and obtaining a heavy chain and light chain chimeric antibody expression vector;

(3) Humanized design of the light chain variable region and heavy chain variable region of mouse LA22, and obtained the amino acid sequence of five humanized heavy chain variable regions, and the amino acid sequences are respectively SEQ ID NO. 7-11. The nucleotide sequence is shown in SEQ ID NO. 15 to 19; and the amino acid sequence of the 3 humanized light chain variable region, the amino acid sequence is shown in SEQ ID NO. 12 to 14, respectively, and the nucleoside thereof The acid sequence is shown in SEQ ID NO. 20-22;

(4) The humanized light chain variable region coding sequence was designed to be Kpn I+Xho I, and the heavy chain variable region coding sequence was designed to be KpnI+AgeI, which was ligated to the expression vector pUC57. The heavy chain variable region coding sequence was cleaved from the pUC57 vector into the corresponding site of the expression vector pJH16 using Kpn I+Age I; the light chain variable region was excised from the pUC57 vector by Kpn I+Xho I To the corresponding position in the expression vector pJH16-H39E3.L1kappa, to obtain a humanized recombinant monoclonal antibody heavy and light chain expression vector;

(5) co-transfecting the competent cells with the heavy chain and light chain chimeric antibody expression vectors obtained in the step (2) and the humanized recombinant monoclonal antibody heavy chain and light chain expression vectors obtained in the step (4). A panel of chimeric anti-EGFR monoclonal antibodies and 30 sets of humanized anti-EGFR monoclonal antibodies were obtained.

The humanized anti-EGFR antibody provided by the invention is directed to a completely different site of EGFR, and the tumor inhibition mechanism is different from that of Erbitux. The monoclonal antibody of the present invention can be used simultaneously with Erbitux to improve the therapeutic effect. More importantly, it binds to EGFR on the surface of tumor cells and can rapidly induce EGFR endocytosis on the surface of tumor cells, making it an ideal biotargeting antibody. By humanizing the anti-EGFR monoclonal antibody, the human amino acid sequence of the antibody drug can reach more than 90%, which will significantly reduce the risk of the human antibody producing a human anti-mouse antibody reaction (HAMA) in the patient, the present invention The examples show that the EGFR antibody of the present invention binds to human EGFR with an affinity of 2.3 nM, which is comparable to the murine antibody, overcomes the HAMA effect, prolongs the half-life of the antibody, and improves the therapeutic effect.

DRAWINGS

Figure 1 is a schematic representation of the regular-PCR of synthetic VH and VL coding sequences for chimeric antibodies.

Figure 2 is a map showing the expression vector pJH16-H39E3.L1kappa expression light chain used in the present invention. Wherein Ck represents the constant region coding sequence of the human antibody kappa light chain.

Figure 3 is an expression vector pJH16 vector used in the present invention for expression of a humanized LA22 heavy chain, wherein the Exon by j00228 partial sequence represents the heavy chain constant region coding sequence of human antibody IgG1.

Figure 4 is an electropherogram of chimeric antibody synthesis gene and vector digestion; in Figure 4a, 1:2: ppn57-LA22 light chain KpnI-XhoI digestion, the cut band size is about 450bp, the upper band is the vector Fragment; 3,4: ppn57-LA22 heavy chain KpnI-AgeI digestion, the cut band size is about 550bp, the upper band is the carrier fragment; Figure 4b, 9, 10: pJH16-H39E3L1, KpnI-XhoI was digested, the cut band was about 450 bp; 11: pJH16 plasmid, KpnI-AgeI was digested, the cut band size was about 550 bp, and MARKER was Trans2K Plus II DNA Marker.

Figure 5 is a light chain humanized synthetic gene digestion; wherein 1,2: pUC57-h0-LA22 light chain Kpn I-Xho I digestion; 3: pUC57-h1-LA22 light chain Kpn I-Xho I enzyme Cut; 4: Kpn I-Xho I digestion of pUC57-h2-LA22 light chain; M: Trans2K Plus II DNA Marker

Figure 6 is an electropherogram of the vector digestion. 1: pJH16-H39E3L1, KpnI-XhoI was digested, the cut band was around 8.5 kbp; 2: pJH16 plasmid, KpnI-AgeI was digested, and the cut band size was about 7 kbp.

Figure 7 is a restriction of humanized heavy chain gene; 1: digestion of Kpn I+Age I of pJH16 vector; the size of the cut band is about 7 kbp; 2: Kpn I+Age I of pUC57-h0-LA22 heavy chain Digestion; 3: Kpn I+Age I digestion of pUC57-h1-LA22 heavy chain; 4: Kpn I+Age I digestion of pUC57-h2-LA22 heavy chain; 5: Kpn of pUC57-h3-LA22 heavy chain I+Age I digestion; 6: ppn57-h4-LA22 heavy chain Kpn I+Age I digestion.

Figure 8 shows the results of sequencing. The BLAST alignment was 100%, and the results of the successful construction of the plasmid were confirmed. Wherein H2-1CMV represents the sequenced humanized antibody heavy chain variable region gene sequencing sequence; the h2-LA22 heavy chain is the h2-LA22 heavy chain antibody variable region gene sequence designed and synthesized by the present invention.

Figure 9 is a humanized mutation site of three light chain variable regions, wherein the gray portion is a mutation site.

Figure 10 is a five heavy chain variable region humanized mutation site in which the gray portion is the mutation site.

Figure 11 is a SDS-PAGE electrophoresis map of humanized monoclonal antibody obtained by purification of cell supernatant, wherein M is protein ruler II 10ul, 1 is BSA, 5μg, 2 is purified antibody 2ug non-reducing 20ul, 3 is purified antibody 2ug reduction 20ul.

Figure 12 shows the results of flow cytometry analysis. NC is a negative control A431 cell, mLA22 indicates that the murine LA22 antibody recognizes EGFR on the surface of A431 cells, and hLA22 indicates that the humanized LA22 antibody recognizes EGFR on the surface of A431 cells.

Figure 13 is a cellular ELISA assay to detect the binding of LA22 to EGFR on the surface of A431 cells. mLA22 is mouse-derived LA22 and hLA22 is humanized LA22.

Figure 14 is a cellular ELISA competition experiment of murine LA22 and humanized LA22. Mouse source The ratio of LA22 to humanized LA22 is 1:0, 2:1, 1:1, 1:2, 0:1, respectively.

Figure 15 shows the results of inhibition of tumor cell proliferation by mLA22 and hLA22 at different antibody concentrations.

detailed description

The following examples of the invention further illustrate the invention, but are not to be construed as limiting the invention. Modifications or substitutions of the methods, steps or conditions of the invention are intended to be included within the scope of the invention.

The technical means used in the examples are conventional means well known to those skilled in the art unless otherwise specified. The materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 Cloning of heavy chain and light chain variable regions of anti-EGFR murine monoclonal antibody mLA22

The variable region coding sequence of anti-EGFR murine monoclonal antibody m LA22 was obtained by the method of 5' RACE (Rapid amplification of cDNA ends). Design and synthesize the following primers:

VH1FOR: TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG

VH1BACK: AGGTSMARCTGCAGSAGTCWGG

VK1FOR: GTTAGATCTCCAGCTTGGTCCC

V K1BACK: GACATTCAGCTGACCCAGTCTCCA

Among them, VH1FOR and VK1FOR were used to synthesize cDNA, then VH1FOR+VH1BACK was used for PCR amplification of synthetic antibody heavy chain, and VK1FOR+VK1BACK was used for PCR amplification of synthetic antibody light chain, and then sequenced.

1 × 10 ⁷ murine hybridoma cells total RNA LA22 tumor cells (provided by Dr. U.S. patent owner Denry Sato) were extracted with a Qiagen the RNeasy Qiagen kit. Reverse transcription of total RNA into heavy and light chain cDNAs using VH1FOR and VK1FOR as primers according to the 5'-RACE kit (Transgen product). The first strand reaction conditions were: 42 ° C, 30 min; 85 °C, 5min. Then, VH1FOR+VH1BACK was used for PCR amplification of the antibody heavy chain variable region, and VK1FOR+VK1BACK was used for PCR amplification to synthesize the antibody light chain variable region. Both reactions were performed by hot start, and the PCR reaction conditions were 94 ° C for 5 minutes. 94 ° C for 30 seconds, 58 ° C for 45 seconds, 72 ° C for 2 minutes and 10 seconds, 37 cycles: 72 ° C for 7 minutes. The PCR product was separated by 1% agarose gel electrophoresis and the purified fragment was recovered (light chain length about 320 bp, heavy chain length about 360 bp). The cells were cloned into pEASY-T1 (Transgen) vector, transformed into E. coli DH5ɑ cells, and screened on IPTGIX-gal plates. Eight white plaques were inoculated into LB liquid medium containing ampicillin. The plasmid was extracted and sequenced using QIAGEN's plasmid extraction kit to determine the DNA sequences of the heavy and light chain variable regions of murine LA22.

The DNA sequence of the mouse LA22 heavy chain variable region (VH) obtained by sequencing is shown in SEQ ID NO. 3, and the DNA sequence of the light chain variable region (VL) is shown in SEQ ID NO. 4, and it is inferred therefrom. The amino acid sequence of the murine LA22 heavy chain variable region was obtained as shown in SEQ ID NO. 1, and the amino acid sequence of the light chain variable region is shown in SEQ ID NO.

Example 2 Construction of a chimeric monoclonal antibody expression vector

According to the base sequence of the murine LA22 heavy chain and light chain variable region obtained by sequencing in Example 1, the light chain cleavage site was designed as Kpn I+Xho I, and the whole gene sequence was synthesized by Jinweizhi Company. The vector linked during synthesis was pUC57. . pJH16-H39E3.L1kappa [purchased from Huishangsheng Pharmaceutical Technology (Beijing) Co., Ltd., containing human IgG1 as an expression vector; design of heavy chain cleavage site Kpn I+Age I, pJH16 [purchased from recycled medicine] Science and Technology (Beijing) Co., Ltd., containing human IgG1, is an expression vector, and they are digested with the murine LA22 heavy chain and light chain variable region coding genes synthesized by Jinweizhi Co., respectively, and then ligated overnight at 16 °C. The results of digestion of pUC57-LA22 light and heavy chains are shown in Figures 4a and 4b. The target gene and the expression vector (pJH16-H39E3.L1kappa and pJH16) obtained by digestion were recovered by Qiagen Gel Extraction Kit, ligated overnight by T4 DNA ligation system, and then transformed into E. coli DH5α, and the BLAST alignment was verified by sequencing. The chimeric antibody expression vector was constructed successfully. The chimeric antibody heavy chain sequence obtained is shown in SEQ ID NO. 5, and the chimeric antibody light chain sequence is shown in SEQ ID NO.

Example 3 Design of humanized recombinant monoclonal antibodies VL and VH

Humanized design of VL and VH against EGFR monoclonal antibody m LA22, humanized transformation should follow the following method, transplant the CDR of murine monoclonal antibody to human antibody variable region, replace human antibody CDR, so that The human antibody acquires the antigen binding specificity of the murine monoclonal antibody while reducing its heterogeneity. The principle of this method is to replace only the regions that are significantly different from human antibody FR, while maintaining antibodies The amino acid substitution is similar to the surface residue of the human antibody on the basis of reducing the heterogeneity; in addition, the segment to be replaced should not be excessive, affecting the side chain size, charge, hydrophobicity, or possibly forming a hydrogen bond. Residues that affect the conformation of the antibody complementarity determining region (CDR) are not replaced as much as possible.

After humanization, the present invention provides that the heavy chain variable regions of the five humanized modified antibodies LA22 are: H0-LA22 heavy chain, H1-LA22 heavy chain, H2-LA22 heavy chain, H3-LA22 heavy chain, H4-LA22 heavy chain, the amino acid sequence and the signal peptide sequence are shown in SEQ ID NO. 7 to 11, respectively, and the nucleotide sequences thereof are shown in SEQ ID NO. 15-19, respectively; three humanized transformations are provided. The light chain variable regions are: h0-LA22 light chain, h1-LA22 light chain, h2-LA22 light chain, and the amino acid sequence and signal peptide sequence thereof are shown in SEQ ID NO. 12-14, respectively, and the nucleotide sequence thereof is shown. They are shown in SEQ ID NO. 20 to 22, respectively.

Example 4 Construction of Humanized Recombinant Monoclonal Antibody Expression Vector

The three humanized light chain variable region coding sequences obtained in Example 3 were designed to be Kpn I+Xho I, and the five heavy chain variable region coding sequences were designed to be KpnI+AgeI, respectively. The expression vector pUC57 was ligated, and the heavy chain variable region coding sequence was cleaved from the pUC57 vector into the corresponding site of the expression vector pJH16 with Kpn I+Age I; the light chain variable region was further extracted from pUC57 by Kpn I+Xho I The vector was excised and inserted into the corresponding site in the expression vector pJH16-H39E3.L1kappa to obtain a humanized recombinant monoclonal antibody heavy and light chain expression vector. The results of the enzyme digestion of the light chain and the heavy chain are shown in Fig. 5, Fig. 6, and Fig. 7.

The results showed that the enzyme digestion was correct, and the ho/h1/h2-LA22 gene sequence of 1-4 shown in Figure 5 was expected to be recovered by 430 bp; the vector sequence pJH16 of lane 1 shown in Figure 6 was obtained. -H39E3.L1kappa predicts that the vector gene sequence pJH16 of size 8.5 kb and lane 2 is expected to be 7 kb, and the gelatin is recovered; the gene sequence of 2, 3, 4, 5, and 6 shown in Figure 7 is H0/H1/H2/ The heavy chain of H3/H4-LA22 is expected to be about 550 bp in size, and the pJH16 vector of the first lane is about 7 kb fragment. The vector and the DNA fragment of the gene which were cleaved in the gel were recovered by a Qiagen Gel Extraction Kit to obtain a band. DH5a was transformed by ligation overnight according to the T4 DNA ligation system. Sequencing, BLAST alignment was 100%, and the construction of the plasmid was verified to be successful. See Figure 8.

Example 5 Expression and Purification of Humanized Anti-EGFR Antibody

The pJH16-LA22 heavy chain and light chain chimeric antibody expression vector constructed in Example 2 and the pJH16-LA22 heavy chain and light chain humanized antibody expression vector constructed in Example 4 were transfected into Escherichia coli DH5a, respectively. The cells were inoculated in 100 ml of LB medium and cultured according to a conventional method. The culture was harvested and the plasmid DNA was purified using Qiagen's UltraPure Plasmid DNA homozygous kit. The purified plasmid DNA was transfected into 293F or CHO cells (manually American company) using the liposome kit of Invitrogen, and the procedure was carried out according to the manufacturer's instructions.

First, 293F cells were transfected with different light and heavy chain plasmid combinations, and a total of 20 groups of 293F were transiently expressed. After culturing for 3 days, the culture supernatant was taken and added to a 96-well plate pre-coated with EGFR, and the activity of secreting antibody binding to EGFR was preliminarily evaluated by an ELISA indirect method. The partial detection results of the above 20 groups are shown in Table 1 below. The NC was an antibody dilution as a negative control.

Table 1 Evaluation results of antibody activity of different heavy chain and light chain combinations screened

Stable expression evaluation was performed by electroporation transfection of CHO cells, and MTX pressure screening (MTX was purchased from sigma) on selective medium Opti-CHO (MTX-opi-cho medium), respectively, at 50 nM, 100 nM The three gradients of 250 nM were pressurized, and the cells after each round of compression were subjected to 7d titer measurement. The ELISA-double-anti-sandwich method was used to determine the antibody yield of the engineered cell strain after each step of pressurization. After the completion of the process, the monoclonal screening was performed by limiting dilution method, which was mainly carried out by diluting the cells (96-well plate), and culturing at 37 ° C under 5% CO ₂ for about 14 days, and taking 50 μl for antibody production. The primary screening (using ELISA-double-antibody sandwich assay) is better for cloning and enrichment of the screening results. Some of the results are shown in Table 2: The results showed that the combination of different heavy chains and light chain h2 was expressed, and the corresponding antibody was produced in the engineered cell line (ELISA evaluation result data).

Table 2 Results of antibody ELISA evaluation of different heavy chain and light chain h2 screens

Antibody purification: The culture supernatant of the above five stable cell lines was directly isolated and purified by a protein A affinity chromatography column to obtain a humanized monoclonal antibody of the present invention. The results are as follows:

SDS-PAGE electrophoresis showed that the purity of the obtained product was greater than 90%. The results are shown in Figure 11.

Example 6 Determination of Biological Activity of Humanized Anti-EGFR Antibody

1. Biacore assay to determine the affinity of the humanized anti-human epidermal growth factor receptor antibody and EGFR of the present invention, and the BIAcore system based on surface plasmon resonance technique was used to detect mLA22 and hLA22 (containing heavy chain H3+ light chain h2). The binding ability of the recombinant human epidermal growth factor receptor (EGFR) was shown in Table 3. The binding force of mLA22 was 2 nM, and the binding force of hLA22 (heavy chain H3 + light chain h2) was 2.3 nM, both of which reached ^10-9 , indicating that the humanized anti-EGFR antibody of the present invention has comparable binding ability to the murine anti-EGFR antibody.

Table 3 Humanized anti-EGFR antibody affinity

2. Flow cytometry analysis was performed to collect A431 cells (from ATCC) with high expression of EGFR, and after incubation with 20ug/mL A22 or hLA22 at 4 °C for 60 min, respectively, FITC-labeled anti-mouse or anti-human secondary antibody (Jackson Lab) was added. Flow cytometry was performed after incubation at 4 ° C for 60 min. The results showed that both mLA22 and hLA22 (containing a combination of heavy chain H3+ light chain h2) recognized EGFR on the surface of A431 cells. The results are shown in Figure 12.

3. Cell ELISA experiment 2×10 ⁴ cells/well A431 cells were cultured in 96-well plates at 37° C., 5% CO ₂ , and DMEM containing 10% fetal bovine serum for 24 hours. The medium was discarded and used with PBS. After 5% milk powder was blocked for 1 hour, different concentrations of mLA22 and hLA22 were added to continue incubation for 1 hour, then anti-mouse and anti-human secondary antibody were added, and after incubation for 1 hour at room temperature, the cells were washed with PBS and developed with OD ₄₅₀ reading. The result is shown in Figure 13. The results showed that both mLA22 and hLA22 could recognize the EGFR expressed by A431 cells, and all reached saturation value at about 4 ug/ml, indicating that the humanized antibody hLA22 developed by the present invention is similar in affinity to the mouse-derived LA22.

2×10 ⁴ cells/well A431 cells were cultured in 96-well plates at 37° C., 5% CO ₂ , and cultured in DMEM containing 10% fetal bovine serum for 24 hours. The medium was discarded, and PBS was used to seal with 5% milk powder. After an hour, 3 ug/ml of mLA22-HRP and different ratios of hLA22 were added for further 1 hour incubation, 1 hour incubation at room temperature, and washed with PBS to develop color, OD ₄₅₀ reading. The result is shown in Figure 14. The results showed that hLA22 was able to compete to inhibit the binding of EGFR on the surface of mLA22 and A431 cells, and the binding of the two was comparable.

4. Tumor cell proliferation inhibition experiment Inoculate 2×10 ³ cells/well A431 cells in 96-well plates, culture at 37°C, 5% CO ₂ , DMEM containing 10% fetal bovine serum for 4 hours, and then replace them with different ones. The concentration of mLA22 and hLA22 in serum-free DMEM (100 ul / well), 37 ° C, 5% CO ₂ , cultured for 4 days, MTT assay for the number of viable cells, calculate the tumor cell growth inhibition rate.

Tumor cell growth inhibition rate (%) = (number of cells treated with DMEM without antibody - number of antibody-treated cells) 数 number of cells treated with DMEM without antibody × 100%

The results are shown in Figure 15. The results showed that both mLA22 and hLA22 could inhibit the proliferation of A431 cells, while humanized hLA22 almost maintained the ability of mLA22 to inhibit tumor growth.

Industrial applicability

The humanized anti-human epidermal growth factor receptor (EGFR) antibody provided by the invention has a human amino acid sequence of more than 90% and an affinity for binding to human EGFR of 2.3 nM, which is equivalent to a murine antibody and binds to the surface of a tumor cell. After EGFR, it can rapidly induce EGFR endocytosis on the surface of tumor cells, making it an ideal biotargeting therapeutic antibody. The present invention provides specific antibody drugs for the prevention and treatment of anti-tumor and other diseases such as inflammation and autoimmune diseases against EGFR targets. It can significantly reduce the risk of producing anti-mouse antibody (HAMA) in the patient's body, prolong the half-life of the antibody, and improve the therapeutic effect.

Claims

A humanized anti-human EGFR monoclonal antibody, characterized in that the light chain constant region and the heavy chain constant region are a light chain constant region and a heavy chain constant region of a human whole antibody immunoglobulin, respectively; The heavy chain variable region is the light chain variable region and the heavy chain variable region of the humanized EGFR murine monoclonal antibody LA22, respectively, and the light chain variable region amino acid sequence of the EGFR murine monoclonal antibody LA22 is SEQ ID. As shown in NO. 2, the heavy chain variable region amino acid sequence is shown in SEQ ID NO. 1, and the humanization is carried out in the FR region of the variable region.
The humanized anti-human EGFR monoclonal antibody according to claim 1, wherein the humanized light chain variable region comprises any one of the amino acid sequences shown in SEQ ID NO. 12 to 14, and The chain variable region contains any one of the amino acid sequences shown in SEQ ID NOS. 7 to 11.
The humanized anti-human EGFR monoclonal antibody according to claim 1, wherein the humanized modified light chain variable region comprises the amino acid sequence shown in SEQ ID NO. 14, and the heavy chain variable region Any one of the amino acid sequences shown in SEQ ID NOS. 7 to 11 is contained.
The humanized anti-human EGFR monoclonal antibody according to claim 1, wherein the humanized light chain variable region comprises any one of the amino acid sequences shown in SEQ ID NO. 12 to 14, The heavy chain variable region contains the amino acid sequence set forth in SEQ ID NO.
The humanized anti-human EGFR monoclonal antibody according to claim 1, wherein the humanized modified light chain variable region comprises the amino acid sequence shown in SEQ ID NO. 14, and the heavy chain variable region Contains the amino acid sequence set forth in SEQ ID NO.
A gene encoding the antibody of any one of claims 1 to 5.
The gene according to claim 6, wherein the gene encoding the light chain variable region has a nucleotide sequence of the DNA sequence shown in SEQ ID NO: 22; and a nucleotide encoding a heavy chain variable region. The sequence is the DNA sequence as shown in SEQ ID NO 18.
An expression vector comprising the gene of claim 7.
Use of the antibody according to any one of claims 1 to 5 for the preparation of a medicament for treating diseases in which EGFR is targeted.
A drug or detection reagent comprising the antibody of any one of claims 1 to 5.