CN104059148A - Humanized anti human epidermal growth factor receptor antibody and application thereof - Google Patents
Humanized anti human epidermal growth factor receptor antibody and application thereof Download PDFInfo
- Publication number
- CN104059148A CN104059148A CN201410083224.3A CN201410083224A CN104059148A CN 104059148 A CN104059148 A CN 104059148A CN 201410083224 A CN201410083224 A CN 201410083224A CN 104059148 A CN104059148 A CN 104059148A
- Authority
- CN
- China
- Prior art keywords
- antibody
- variable region
- light chain
- seq
- egfr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/39558—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against tumor tissues, cells, antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Abstract
The invention provides a humanized anti-human epidermal growth factor receptor (EGFR) antibody and an application thereof. Through humanization on an EGFR mouse monoclonal antibody LA22, humanized amino acid sequences accounts for more than 90% in the antibody LA22 and then an anti-human EGFR monoclonal antibody is screened. An affinity between the antibody in the invention and human EGFR is 2.3 nM and is similar to that between a mouse antibody and the human EGFR. When combined with EGFRs on surfaces of tumor cells, the antibody can induce the EGFRs on the surfaces of the tumor cells to be endocytosed and becomes a very ideal biological targeted therapy antibody. The invention aims at prevention and treatment of tumors targeted by EGFR and other diseases, such as inflammation and autoimmune diseases, and provides a specific antibody medicine. A risk that the antibody medicine will generate human anti-mouse antibody (HAMA) in a patient body in future can be significantly reduced. The antibody medicine is prolonged in a half-life period and is improved in curative effects.
Description
Technical field
The present invention relates to preparation and the application for the treatment of human genetically engineered antibody, mainly relate to antibody and the application thereof of specificity for Human epidermal growth factor receptor (epidemic growth factor receptor, EGFR).
Background technology
EGF-R ELISA (EGFR) is a member of epidermal growth factor gene (erbB) family, in kinds of tumors as mammary cancer, colorectal carcinoma, neck tumour, kidney, lung cancer, carcinoma of the pancreas, all has material impact in the development of prostate cancer.Domestic and international much research shows, can effectively outside born of the same parents, realize the inhibition to EGFR signal transduction pathway by the combination of block ligand for the antibody of EGFR, to multiple by EGFR overexpression or/and the caused human tumor that suddenlys change has good curative effect.EGF-R ELISA is to study at present deeply and one of the oncotherapy target spot receiving much attention, and using gene engineering means are developed the monoclonal antibody of anti-EGFR, are the study hotspots of current oncotherapy.
EGFR molecule is the membrane antigen that is distributed widely in human tumor cells surface, in cell internal information transmittance process, plays an important role.Using human antibody or humanized antibody is to overcome the anti-mouse of people source antibody response (two kinds of possible methods of (HAMA reaction).Because high specificity, human antibody that avidity is high are difficult to obtain, mainly take at present the humanized method of mouse resource monoclonal antibody.The EGFR monoclonal antibody Erbitux of American I mClone production in 2005 goes on the market in the U.S., can extend the life of Patients With Rectal Carcinoma in reinstating with chemotherapy one.Tai Xinsheng monoclonal antibody by Cuba and China's hundred safe treatment nasopharyngeal carcinoma of cooperating was also for the same target spot of EGFR, in listing in 2009.
The Erbitux monoclonal antibody medicine having gone on the market is at present exactly humanized mouse-anti EGFR monoclonal antibody, but monoclonal antibody LA22 of the present invention for be the complete different loci of EGFR, tumor suppression mechanism is different from Erbitux, uses simultaneously and can improve curative effect with Erbitux.Main is that it is attached to after the EGFR of tumor cell surface, and the promptly EGFR endocytosis on inducing tumor cell surface becomes ideal biological targeting treatment antibody.
Summary of the invention
First object of the present invention is to provide a kind of humanization anti-egfr antibodies.
Second object of the present invention is to provide the gene of the above-mentioned antibody of coding.
The 3rd object of the present invention is to provide the application of above-mentioned antibody in malignant tumour and the autoimmune disorder medicine of preparation treatment high expression level/overexpression EGFR.
Humanized anti-human EGFR monoclonal antibody provided by the invention, its constant region of light chain, CH are respectively constant region of light chain, the CH of people's whole antibody Immunoglobulin IgG1; Its variable region of light chain, variable region of heavy chain are respectively variable region of light chain and the variable region of heavy chain of humanization modified EGFR mouse source monoclonal antibody LA22, the light chain variable region amino acid sequence of described EGFR mouse source monoclonal antibody LA22 is as shown in SEQ ID NO.2, weight chain variable region amino acid sequence as shown in SEQ ID NO.1, described humanization modifiedly carry out in FR district, variable region.
In one embodiment of the invention, EGFR mouse source monoclonal antibody LA22 CH and constant region of light chain are replaced with human IgG1's CH and constant region of light chain respectively, humanization modified by by the framework region FR of EGFR mouse source monoclonal antibody LA22 heavy chain, variable region of light chain, obtains the Humanized anti-human EGFR monoclonal antibody with the active and antigen avidity of good biological.
Humanized anti-human EGFR monoclonal antibody provided by the invention, its humanization modified variable region of light chain contains just like any aminoacid sequence shown in SEQ ID NO.12～14, and variable region of heavy chain contains just like any aminoacid sequence shown in SEQ ID NO.7～11.
Further, its humanization modified variable region of light chain contains just like the aminoacid sequence shown in SEQ ID NO.14, any that the aminoacid sequence shown in SEQ ID NO.7～11 is contained in variable region of heavy chain.
Further, its humanization modified variable region of light chain containing just like the aminoacid sequence shown in SEQ ID NO.12～14 any, variable region of heavy chain is containing just like the aminoacid sequence shown in SEQ IDNO.10.
Further, its humanization modified variable region of light chain contains just like the aminoacid sequence shown in SEQ ID NO.14 (being light chain h2), and variable region of heavy chain contains just like the aminoacid sequence shown in SEQ ID NO.10 (being heavy chain H3).
The invention provides the gene of the above-mentioned antibody of coding.Encode in the gene of above-mentioned antibody, its nucleotides sequence of the gene of encoded light chain variable region is classified the DNA sequence dna as shown in as arbitrary in SEQ ID NO.20～22 as; Its nucleotides sequence of the gene of encoding heavy chain variable region is classified the DNA sequence dna as shown in as arbitrary in SEQ ID NO.15～19 as.
Preferably, its nucleotides sequence of the gene of encoded light chain variable region is classified the DNA sequence dna as shown in SEQ ID NO.22 as; Its nucleotides sequence of the gene of encoding heavy chain variable region is classified the DNA sequence dna as shown in SEQ ID NO.18 as.
The invention provides the expression vector that contains said gene.
The Host Strains, host cell or the expression cassette that contain described expression vector are in protection domain of the present invention.
The invention provides the application in the disease therapeuticing medicine taking EGFR as target in preparation of above-mentioned human monocloned antibody against EGFR.
Described medicine is the medicine of antitumour drug, anti-inflammatory drug or treatment autoimmune disorder.
The invention provides the medicine or the detection reagent that contain above-mentioned human monocloned antibody against EGFR.
The invention provides the primer for cloning mouse source monoclonal antibody LA22 heavy chain, variable region of light chain, be respectively VH1FOR:TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG
VH1BACK:AGGTSMARCTGCAGSAGTCWGG
VK1FOR:GTTAGATCTCCAGCTTGGTCCC
VK1BACK:GACATTCAGCTGACCCAGTCTCCA
The method that the invention provides the above-mentioned human monocloned antibody against EGFR of preparation, comprising:
(1) total RNA of extraction hybridoma mouse LA22 tumour cell, VH1FOR is the cDNA that primer becomes total RNA reverse transcription respectively variable region of heavy chain and variable region of light chain with VK1FOR; Then taking the cDNA of variable region of heavy chain and variable region of light chain as template, carry out monoclonal antibody LA22 antibody heavy chain variable region, the synthetic mouse source of pcr amplification with VH1FOR+VH1BACK respectively, carry out pcr amplification with VK1FOR+VK1BACK and synthesize monoclonal antibody LA22 antibody chain variable region, mouse source; Reclaim object fragment, clone, transformed competence colibacillus cell, screening positive clone;
(2) the check order variable region of light chain design restriction enzyme site of correct positive colony is Kpn I+Xho I, variable region of heavy chain restriction enzyme site KpnI+AgeI, be connected with expression vector pJH16-H39E3.L1kappa and pJH16 respectively, transform, obtain heavy chain, light chain chimeric antibody expression vector;
(3) humanization design is carried out in the variable region of light chain of mouse source LA22 and variable region of heavy chain, obtain 5 humanized weight chain variable region amino acid sequences, aminoacid sequence is respectively as shown in SEQ ID NO.7～11, and its nucleotide sequence is as shown in SEQ ID NO.15～19; With 3 humanized light chain variable region amino acid sequences, aminoacid sequence is respectively as shown in SEQ ID NO.12～14, and its nucleotide sequence is as shown in SEQ ID NO.20～22;
(4) be Kpn I+Xho I by humanization variable region of light chain encoding sequence design restriction enzyme site, variable region of heavy chain encoding sequence design restriction enzyme site is KpnI+AgeI, be connected with expression vector pUC57 respectively, variable region of heavy chain encoding sequence cut to the corresponding site that is inserted into expression vector pJH16 from pUC57 carrier with Kpn I+Age I; With Kpn I+Xho I, variable region of light chain is cut and is inserted into corresponding site in expression vector pJH16-H39E3.L1kappa from pUC57 carrier again, obtain humanization recombinant monoclonal antibodies heavy chain and light chain expression vector;
(5) the humanization recombinant monoclonal antibodies heavy chain that heavy chain, light chain chimeric antibody expression vector and the step (4) step (2) being obtained obtains and light chain expression vector permutation and combination cotransfection competent cell, obtain one group of chimeric monoclonal antibody against EGFR and 30 groups of human monocloned antibody against EGFR.
Humanization anti-egfr antibodies provided by the invention for be the complete different loci of EGFR, tumor suppression mechanism is different from Erbitux, monoclonal antibody of the present invention and Erbitux use simultaneously and can improve curative effect.Main is that it is attached to after the EGFR of tumor cell surface, and the promptly EGFR endocytosis on inducing tumor cell surface becomes ideal biological targeting treatment antibody.The present invention is undertaken humanization modified by antagonism EGFR monoclonal antibody, people source aminoacid sequence in antibody medicine is reached more than 90%, to significantly reduce the risk that this antibody medicine produces the anti-mouse of people source antibody response (HAMA) in patient body, the embodiment of the present invention shows that the avidity that EGFR antibody of the present invention is combined with Human epidermal growth factor receptor is 2.3nM, suitable with mouse source antibody, and overcome HAMA effect, and extend the transformation period of antibody medicine, improve curative effect.
Brief description of the drawings
Fig. 1 is the schematic diagram of the regular-PCR of synthetic chimeric antibody VH and VL encoding sequence.
Fig. 2 is the collection of illustrative plates that the expression vector pJH16-H39E3.L1kappa that uses in the present invention expresses light chain.Wherein, Ck represents the constant region encoding sequence of people's antibody kappa light chain.
Fig. 3 is the expression vector pJH16 carrier using in the present invention, and for expressing humanization LA22 heavy chain, wherein, Exon by j00228 partial sequence represents the CH encoding sequence of people's IgG antibody 1.
Fig. 4 is the electrophorogram that chimeric antibody synthetic gene and carrier enzyme are cut; In Fig. 4 a 1, the KpnI-XhoI enzyme of 2:pUC57-LA22 light chain is cut, and the stripe size cutting is in 450bp left and right, and upper strata band is carrier segments; The KpnI-AgeI enzyme of 3,4:pUC57-LA22 heavy chain is cut, and the stripe size cutting is in 550bp left and right, and upper strata band is carrier segments; In Fig. 4 b, 9,10: be pJH16-H39E3L1, KpnI-XhoI enzyme is cut, the band cutting is in 450bp left and right; 11:pJH16 plasmid, KpnI-AgeI enzyme is cut, and the stripe size cutting is 550bp left and right, and MARKER is Trans2KPlus II DNA Marker.
Fig. 5 is that light chain humanization synthetic gene enzyme is cut; Wherein 1, the KpnI-Xho I enzyme of 2:pUC57-h0-LA22 light chain is cut; The Kpn I-Xho I enzyme of 3:pUC57-h1-LA22 light chain is cut; The Kpn I-Xho I enzyme of 4:pUC57-h2-LA22 light chain is cut; M:Trans2K Plus II DNA Marker
Fig. 6 is the electrophorogram that carrier enzyme is cut.1: be pJH16-H39E3L1, KpnI-XhoI enzyme is cut, the band cutting is in 8.5kbp left and right; 2:pJH16 plasmid, KpnI-AgeI enzyme is cut, and the stripe size cutting is 7kbp left and right.
Fig. 7 is that heavy chain humanization gene enzyme is cut; The Kpn I+Age I enzyme of 1:pJH16 carrier is cut; The stripe size cutting is 7kbp left and right; The Kpn I+Age I enzyme of 2:pUC57-h0-LA22 heavy chain is cut; The Kpn I+Age I enzyme of 3:pUC57-h1-LA22 heavy chain is cut; The Kpn I+Age I enzyme of 4:pUC57-h2-LA22 heavy chain is cut; The Kpn I+Age I enzyme of 5:pUC57-h3-LA22 heavy chain is cut; The Kpn I+Age I enzyme of 6:pUC57-h4-LA22 heavy chain is cut.
Fig. 8 is sequencing result, BLAST comparison 100%, and checking represents after obtaining building plasmid success for example.Wherein H2-1CMV represents the humanized antibody heavy chain variable region gene sequencing sequence of order-checking; The h2-LA22 antibody heavy chain variable region gene order that h2-LA22 heavy chain is synthetic for the present invention designs.
Fig. 9 is humanization mutational site, three variable region of light chain, and wherein gray scale part is mutational site.
Figure 10 is humanization mutational site, five variable region of heavy chain, and wherein gray scale part is mutational site.
Figure 11 is that cell conditioned medium purifying obtains Humanized monoclonal antibodies SDS-PAGE electrophorogram, and wherein M is albumen ruler II10ul, and 1 is BSA, is 5 μ g, and 2 is the non-reduced 20ul of antibody purification 2ug, and 3 is antibody purification 2ug reductase 12 0ul.
Figure 12 is flow cytometry result, the negative contrast of NC A431 cell, and mLA22 represents the EGFR of the LA22 antibody recognition A431 cell surface in mouse source, hLA22 represents the EGFR of humanized LA22 antibody recognition A431 cell surface.
Figure 13 is the combination that cell ELISA experiment detects the EGFR of LA22 to A431 cell surface.MLA22 is the LA22 in mouse source, and hLA22 is humanized LA22.
Figure 14 is the cell ELISA competitive assay of LA22 and the humanized LA22 in mouse source.The ratio of mouse source LA22 and humanization LA22 is respectively 1:0,2:1,1:1,1:2,0:1.
Figure 15 is that the mLA22 of different antibodies concentration and hLA22 are to Cytostatic to tumor cell result.
Embodiment
Below implement embodiment and further illustrate content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, the amendment that the inventive method, step or condition are done or replacement, all belong to scope of the present invention.
If do not specialize, the conventional means that in embodiment, technique means used is well known to those skilled in the art.Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
The heavy chain of the anti-EGFR mouse of embodiment 1 source monoclonal antibody mLA22, the clone of variable region of light chain
Adopt the method for 5'RACE (Rapid amplification of cDNA ends) to obtain the variable region encoding sequence of anti-EGFR mouse source monoclonal antibody m LA22.Design and synthesize following primer:
VH1FOR:TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG
VH1BACK:AGGTSMARCTGCAGSAGTCWGG
VK1FOR:GTTAGATCTCCAGCTTGGTCCC
V K1BACK:GACATTCAGCTGACCCAGTCTCCA
Wherein, VH1FOR and VK1FOR, for the synthesis of cDNA, then do pcr amplification synthetic antibody heavy chain with VH1FOR+VH1BACK, do pcr amplification synthetic antibody light chain with VK1FOR+VK1BACK, then order-checking.
Extract respectively 1 × 10 with the Qiagen RNeasy test kit of Qiagen company
7total RNA of hybridoma mouse LA22 tumour cell (being provided by United States Patent (USP) owner Denry doctor Sato).Respectively total RNA reverse transcription is become to the cDNA of heavy chain and light chain taking VH1FOR and VK1FOR as primer according to 5'-RACE test kit (Transgen company product) specification sheets, the synthetic Article 1 chain reaction condition of cDNA is: 42 DEG C, and 30min; 85 DEG C, 5min.Then do pcr amplification synthetic antibody variable region of heavy chain with VH1FOR+VH1BACK, do pcr amplification synthetic antibody variable region of light chain with VK1FOR+VK1BACK, two secondary responses all adopt warm start, PCR reaction conditions: 94 DEG C 5 minutes; 94 DEG C 30 seconds, 58 DEG C 45 seconds, 72 DEG C 2 points 10 seconds, 37 circulation: 72 DEG C 7 minutes.PCR product reclaims purifying object fragment (the about 320bp of light chain length, the about 360bp of heavy chain length) after 1% agarose gel electrophoresis separates.Be cloned in pEASY-T1 (Transgen) carrier, transform bacillus coli DH 5
ɑafter cell at the dull and stereotyped enterprising row filter of IPTGIX-gal, getting 8 white bacterial plaques is inoculated in the LB liquid nutrient medium that contains ammonia joint penicillin and increases. screening positive clone, with the plasmid extraction test kit extracting plasmid of QIAGEN and check order, the heavy chain of mouse LA22 and the DNA sequence dna of variable region of light chain are determined.
The DNA sequence dna of the LA22 variable region of heavy chain, mouse source (VH) that order-checking obtains is as shown in SEQ ID NO.3, the DNA sequence dna of variable region of light chain (VL) is as shown in SEQ ID NO.4, and infer and obtain mouse source LA22 weight chain variable region amino acid sequence as shown in SEQ ID NO.1 accordingly, the aminoacid sequence of variable region of light chain is as shown in SEQ ID NO.2.
The structure of embodiment 2 chimeric mAb expression vectors
According to embodiment 1 check order the mouse LA22 heavy chain, the variable region of light chain base sequence that obtain, design light chain restriction enzyme site is Kpn I+Xho I, and Song Jinwei intelligence company synthesize complete genome sequence, and when synthetic, the carrier of connection is pUC57.Giving birth to medical sci-tech (Beijing) company limited purchased from going back to pJH16-H39E3.L1kappa[, is expression vector containing human IgG1; Design heavy chain restriction enzyme site is Kpn I+Age I, give birth to medical sci-tech (Beijing) company limited purchased from going back to pJH16[, containing human IgG1] be expression vector, after they are cut with Jin Weizhi company synthetic mouse LA22 heavy chain, variable region of light chain encoding gene enzyme respectively, 16 DEG C of connections of spending the night.The enzyme of pUC57-LA22 light chain and heavy chain is cut and be the results are shown in Figure 4a, Fig. 4 b.The goal gene obtaining after enzyme is cut and expression vector (pJH16-H39E3.L1kappa and pJH16) are cut glue Qiagen Gel Extraction Kit and are reclaimed, connect and spend the night by T4DNA linked system, then transform bacillus coli DH 5 alpha, sequence verification BLAST comparison 100%, illustrates that chimeric antibody expression vector successfully constructs.The chimeric antibody sequence of heavy chain obtaining is as shown in SEQ ID NO.5, and chimeric antibody sequence of light chain is as shown in SEQ ID NO.6.
The design of embodiment 3 humanization recombinant monoclonal antibodies VL and VH
VL and VH to monoclonal antibody against EGFR m LA22 have carried out humanization design, humanization modifiedly should defer to following methods, the CDR of mouse source monoclonal antibody is migrated to human antibody variable region, substitute human antibody CDR, make human antibody obtain the antigen-binding specificity of mouse source monoclonal antibody, reduce its heterology simultaneously.The principle of the method is only to replace and the obvious region of people's antibody FR difference, is maintaining antibody activity and is taking into account to reduce on heterology basis and select the amino acid substitution similar to people's antibody surface residue; In addition, the section of replacing should be not too much, for affecting side chain size, electric charge, hydrophobicity, do not replace thereby maybe may form the residue that hydrogen bond has influence on complementary antibody determining area (CDR) conformation as far as possible.
Through humanization modified, the variable region of heavy chain that the invention provides 5 humanization modified antibody LA22 is respectively: H0-LA22 heavy chain, H1-LA22 heavy chain, H2-LA22 heavy chain, H3-LA22 heavy chain, H4-LA22 heavy chain, its aminoacid sequence and signal peptide sequence are respectively as shown in SEQ ID NO.7～11, and its nucleotide sequence is respectively as shown in SEQ ID NO.15～19; Provide 3 humanization modified variable region of light chain to be respectively: h0-LA22 light chain, h1-LA22 light chain, h2-LA22 light chain, its aminoacid sequence and signal peptide sequence are respectively as shown in SEQ ID NO.12～14, and its nucleotide sequence is respectively as shown in SEQID NO.20～22.
The structure of embodiment 4 humanization recombinant monoclonal antibodies expression vectors
3 humanization variable region of light chain encoding sequence design restriction enzyme sites that embodiment 3 is obtained are KpnI+Xho I, 5 variable region of heavy chain encoding sequence design restriction enzyme sites are KpnI+AgeI, be connected with expression vector pUC57 respectively, variable region of heavy chain encoding sequence cut to the corresponding site that is inserted into expression vector pJH16 from pUC57 carrier with Kpn I+Age I; With Kpn I+Xho I, variable region of light chain is cut and is inserted into corresponding site in expression vector pJH16-H39E3.L1kappa from pUC57 carrier again, obtain humanization recombinant monoclonal antibodies heavy chain and light chain expression vector.The enzyme of light chain and heavy chain is cut the result and is seen Fig. 5, Fig. 6, Fig. 7.
Result shows, it is all correct that enzyme is cut checking, and the gene order ho/h1/h2-LA22 in 1～4 road shown in Fig. 5 is estimated to size cuts glue recovery for 430bp; The vector gene sequence pJH16-H39E3.L1kappa of 1 swimming lane shown in Fig. 6 is estimated to size is the vector gene sequence pJH16 expectation 7kb of 8.5kb and 2 swimming lanes, all cuts glue and reclaims; By 2,3 shown in Fig. 7, the gene order H0/H1/H2/H3/H4-LA22 heavy chain expectation size in 4,5,6 roads is cut glue for 550bp left and right and is reclaimed, and the pJH16 carrier size in the 1st road is about to 7kb fragment simultaneously and cuts glue recovery.The DNA fragmentation of the carrier cutting out in gel and gene is reclaimed and obtains band with Qiagen Gel Extraction Kit.Connect and spend the night by T4DNA linked system, transform DH5a.Order-checking, BLAST comparison 100%, checking builds plasmid success.See Fig. 8.
The expression and purification of embodiment 5 humanization anti-egfr antibodies
PJH16-LA22 heavy chain, light chain humanized antibody expression vector transfection Escherichia coli DH5a respectively that pJH16-LA22 heavy chain, light chain chimeric antibody expression vector and the embodiment 4 building with embodiment 2 builds.Be inoculated in 100m1LB substratum, cultivate according to ordinary method.Results culture, by the UltraPure plasmid DNA of the Qiagen company test kit extracting and purifying plasmid DNA of isozygotying.The plasmid DNA of above-mentioned purifying is adopted to liposome method test kit transfection 293F or the Chinese hamster ovary celI (handsome company of the U.S.) of Invitrogen company, operation is carried out with reference to the specification sheets of producer.
First 293F cell is carried out to the transfection that difference is light, heavy chain plasmid combines, totally 20 groups of 293F transient expressions.Cultivate after 3 days, get culture supernatant, add in 96 orifice plates that are surrounded by advance EGFR, adopt ELISA indirect method, preliminary assessment secretory antibody is in conjunction with the activity of EGFR.The partial detection of above-mentioned 20 groups is as shown in table 1 below.NC is using antibody diluent as negative control.
The different heavy chains that table 1 screens, the antibody activity evaluation result of light chain combination
Stably express evaluation adopts electrotransfection method transfection CHO cell, and on selective medium Opti-CHO (U.S. handsome-opti-cho medium), carry out MTX pressurization screening (MTX is purchased from sigma company), pressurize with 50nM, 100nM, these three gradients of 250nM respectively, carry out 7d titer determination for every cell of taking turns after pressurization, measuring method adopts ELISA-double antibodies sandwich method to determine the antibody production of the rear engineering cell strain of every step pressurization.After this process completes, utilize limiting dilution assay to carry out mono-clonal screening, the method is mainly by cell being diluted to bed board (96 orifice plate), at 37 DEG C of 5%CO
2under condition, cultivate and after about 14 days, get 50 microlitres and carry out antibody production primary dcreening operation (adopting ELISA-double antibodies sandwich to send out mensuration) and clone preferably picking enlarged culturing for the selection result.Partial results is as table 2: result shows, different heavy chains is all expressed with the combination of light chain h2, and engineering cell strain has produced corresponding antibody (ELISA evaluation result data).
The antibody ELISA evaluation result of the different heavy chains that table 2 screens and light chain h2 combination
Antibody purification: utilize protein A affinity chromatography post to the direct separation and purification of the culture supernatant of above-mentioned 5 stable cell lines and then obtain Humanized monoclonal antibodies of the present invention.Result is as follows:
SDS-PAGE electrophoretic examinations proves, products therefrom purity is greater than 90%.The results are shown in Figure 11.
The biological activity determination of embodiment 6 humanization anti-egfr antibodies
1, Biacore measuring avidity detects the avidity of Humanized anti-human epidermal growth factor receptor antibody of the present invention and EGFR, the BIAcore system of application based on Applications of surface plasmon resonance detected the combination that mLA22 and hLA22(contain heavy chain H3+ light chain h2) with the binding ability of recombinant human epidermal growth factor acceptor (EGFR), the results are shown in Table 3, the bonding force of mLA22 is 2nM, and hLA22(heavy chain H3+ light chain h2) bonding force be 2.3nM, both have all reached 10
-9, illustrate that humanization anti-egfr antibodies of the present invention is suitable with mouse source anti-egfr antibodies binding ability.
Table 3 humanization anti-egfr antibodies avidity
2, flow cytometry is collected the A431 cell (from ATCC) of EGFR high expression level, respectively with 20ug/mLA22 or hLA224 DEG C of incubation 60min after, add respectively anti-mouse or anti-human two anti-(the Jackson Lab) of FITC mark, after 4 DEG C of continuation incubation 60min, flow cytometer detects.Result shows, the combination that mLA22 and hLA22(contain heavy chain H3+ light chain h2) all can identify the EGFR of A431 cell surface.The results are shown in Figure 12.
3, cell ELISA experiment 2 × 10
4individual/hole A431 cell is in 96 orifice plates, and 37 DEG C, 5%CO
2cultivate after 24 hours containing the DMEM nutrient solution of 10% foetal calf serum, abandon substratum, with sealing after 1 hour with 5% milk powder after PBS, add respectively mLA22 and the hLA22 of different concns to continue to hatch 1 hour, then add anti-mouse and anti-human two anti-, incubated at room after 1 hour with developing the color after PBS wash clean, OD
450reading.The results are shown in Figure 13.Presentation of results, mLA22 and hLA22 all can identify the EGFR of A431 cell expressing, all in the about 4ug/ml value of reaching capacity, show that the humanized antibody hLA22 that the present invention develops is suitable with the LA22 in mouse source in avidity.
2 × 10
4individual/hole A431 cell is in 96 orifice plates, and 37 DEG C, 5%CO
2, cultivate after 24 hours containing the DMEM nutrient solution of 10% foetal calf serum, abandon substratum, with sealing after 1 hour with 5% milk powder after PBS, add the mLA22-HRP of 3ug/ml and the hLA22 of different ratios to continue to hatch 1 hour, incubated at room after 1 hour with developing the color after PBS wash clean, OD
450reading.The results are shown in Figure 14.Result shows, can hLA22 competition suppress the combination of the EGFR of mLA22 and A431 cell surface, and both bonding forces is suitable.
4, Cytostatic to tumor cell experiment inoculation 2 × 10
3individual/hole A431 cell is in 96 orifice plates, and 37 DEG C, 5%CO
2, cultivate after 4 hours containing the DMEM nutrient solution of 10% foetal calf serum, change respectively the mLA22 that contains different concns and the serum-free DMEM(100ul/ hole of hLA22 into), 37 DEG C, 5%CO
2, to cultivate after 4 days, mtt assay detects viable cell quantity, calculates growth of tumour cell inhibiting rate.
Growth of tumour cell inhibiting rate (%)=(not processing cell count one antibody treatment cell count containing the DMEM of antibody) ÷ does not process cell count × 100% containing the DMEM of antibody
The results are shown in Figure 15.Result shows, mLA22 and hLA22 all can suppress the propagation of A431 cell, and humanized hLA22 has kept mLA22 to suppress the ability that tumour is grown up substantially, and both inhibitions are suitable.
Claims (10)
1. a Humanized anti-human EGFR monoclonal antibody, is characterized in that, its constant region of light chain, CH are respectively constant region of light chain, the CH of people's whole antibody immunoglobulin (Ig); Its variable region of light chain, variable region of heavy chain are respectively variable region of light chain and the variable region of heavy chain of humanization modified EGFR mouse source monoclonal antibody LA22, the light chain variable region amino acid sequence of described EGFR mouse source monoclonal antibody LA22 is as shown in SEQ ID NO.2, weight chain variable region amino acid sequence as shown in SEQ ID NO.1, described humanization modifiedly carry out in FR district, variable region.
2. Humanized anti-human EGFR monoclonal antibody as claimed in claim 1, it is characterized in that, its humanization modified variable region of light chain contains just like any aminoacid sequence shown in SEQ ID NO.12～14, and variable region of heavy chain contains just like any aminoacid sequence shown in SEQ ID NO.7～11.
3. Humanized anti-human EGFR monoclonal antibody as claimed in claim 1, it is characterized in that, its humanization modified variable region of light chain contains just like the aminoacid sequence shown in SEQ ID NO.14, any that the aminoacid sequence shown in SEQ ID NO.7～11 is contained in variable region of heavy chain.
4. Humanized anti-human EGFR monoclonal antibody as claimed in claim 1, it is characterized in that, its humanization modified variable region of light chain contains any just like the aminoacid sequence shown in SEQ ID NO.12～14, and variable region of heavy chain contains just like the aminoacid sequence shown in SEQ ID NO.10.
5. Humanized anti-human EGFR monoclonal antibody as claimed in claim 1, it is characterized in that, its humanization modified variable region of light chain contains just like the aminoacid sequence shown in SEQ ID NO.14, and variable region of heavy chain contains just like the aminoacid sequence shown in SEQ ID NO.10.
6. the gene of antibody described in coding claim 1～5 any one.
7. gene as claimed in claim 6, is characterized in that, its nucleotides sequence of the gene of encoded light chain variable region is classified the DNA sequence dna as shown in SEQ ID NO22 as; Its nucleotides sequence of the gene of encoding heavy chain variable region is classified the DNA sequence dna as shown in SEQ ID NO18 as.
8. contain the expression vector of gene described in claim 7.
9. the arbitrary described antibody of claim 1～5 application in the disease therapeuticing medicine taking EGFR as target in preparation.
10. contain medicine or the detection reagent of antibody described in claim 1～5 any one.
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410083224.3A CN104059148B (en) | 2013-03-18 | 2014-03-07 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
| US15/124,288 US10611833B2 (en) | 2014-03-07 | 2015-03-06 | Humanized anti-human epidermal growth factor receptor antibody and application thereof |
| PCT/CN2015/073801 WO2015131855A1 (en) | 2013-03-18 | 2015-03-06 | Humanised anti-human epidermal growth factor receptor antibody and application thereof |
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310086034.2 | 2013-03-18 | ||
| CN201310086034 | 2013-03-18 | ||
| CN201410083224.3A CN104059148B (en) | 2013-03-18 | 2014-03-07 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104059148A true CN104059148A (en) | 2014-09-24 |
| CN104059148B CN104059148B (en) | 2016-09-07 |
Family
ID=54062533
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410083224.3A Active CN104059148B (en) | 2013-03-18 | 2014-03-07 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN104059148B (en) |
| WO (1) | WO2015131855A1 (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015131855A1 (en) * | 2013-03-18 | 2015-09-11 | 回而生医药科技（北京）有限公司 | Humanised anti-human epidermal growth factor receptor antibody and application thereof |
| US10611833B2 (en) | 2014-03-07 | 2020-04-07 | Welson Pharmaceuticals, Inc. | Humanized anti-human epidermal growth factor receptor antibody and application thereof |
| CN115819587A (en) * | 2022-10-14 | 2023-03-21 | 北京东方百泰生物科技股份有限公司 | anti-NKG 2A monoclonal antibody and application thereof |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110878122B (en) * | 2018-09-06 | 2023-07-28 | 上海张江生物技术有限公司 | Recombinant anti-PD-L1 monoclonal antibodies |
| CN111879923A (en) * | 2020-08-06 | 2020-11-03 | 深圳科隆生物新材料有限公司 | Kit capable of eliminating HAMA effect |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5459061A (en) * | 1990-01-26 | 1995-10-17 | W. Alton Jones Cell Science Center, Inc. | Hybridomas producing monoclonal antibodies which specifically bind to continuous epitope on the human EGF receptor and compete with EGF for binding to the EGF receptor |
| CN101277716A (en) * | 2005-04-27 | 2008-10-01 | 回而生医药科技有限公司 | Antibodies for the treatment of cancers |
| CN101675075A (en) * | 2007-03-01 | 2010-03-17 | 西福根有限公司 | Recombinant anti-epidermal growth factor receptor antibody compositions |
| CN102325549A (en) * | 2009-03-31 | 2012-01-18 | 罗氏格黎卡特股份公司 | Treatment of cancer with umanized anti-egfr igg1 antibody and irinotecan |
| CN102753580A (en) * | 2009-10-28 | 2012-10-24 | 亚培生物医疗股份有限公司 | Anti-egfr antibodies and their uses |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104059148B (en) * | 2013-03-18 | 2016-09-07 | 回而生医药科技（北京）有限公司 | humanized anti-human epidermal growth factor receptor antibody and application thereof |
-
2014
- 2014-03-07 CN CN201410083224.3A patent/CN104059148B/en active Active
-
2015
- 2015-03-06 WO PCT/CN2015/073801 patent/WO2015131855A1/en active Application Filing
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5459061A (en) * | 1990-01-26 | 1995-10-17 | W. Alton Jones Cell Science Center, Inc. | Hybridomas producing monoclonal antibodies which specifically bind to continuous epitope on the human EGF receptor and compete with EGF for binding to the EGF receptor |
| CN101277716A (en) * | 2005-04-27 | 2008-10-01 | 回而生医药科技有限公司 | Antibodies for the treatment of cancers |
| CN101675075A (en) * | 2007-03-01 | 2010-03-17 | 西福根有限公司 | Recombinant anti-epidermal growth factor receptor antibody compositions |
| CN102325549A (en) * | 2009-03-31 | 2012-01-18 | 罗氏格黎卡特股份公司 | Treatment of cancer with umanized anti-egfr igg1 antibody and irinotecan |
| CN102753580A (en) * | 2009-10-28 | 2012-10-24 | 亚培生物医疗股份有限公司 | Anti-egfr antibodies and their uses |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2015131855A1 (en) * | 2013-03-18 | 2015-09-11 | 回而生医药科技（北京）有限公司 | Humanised anti-human epidermal growth factor receptor antibody and application thereof |
| US10611833B2 (en) | 2014-03-07 | 2020-04-07 | Welson Pharmaceuticals, Inc. | Humanized anti-human epidermal growth factor receptor antibody and application thereof |
| CN115819587A (en) * | 2022-10-14 | 2023-03-21 | 北京东方百泰生物科技股份有限公司 | anti-NKG 2A monoclonal antibody and application thereof |
| CN115819587B (en) * | 2022-10-14 | 2023-06-09 | 北京东方百泰生物科技股份有限公司 | anti-NKG 2A monoclonal antibody and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104059148B (en) | 2016-09-07 |
| WO2015131855A1 (en) | 2015-09-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10556954B2 (en) | Anti-PD-L1 nanobody, coding sequence and use thereof | |
| US20220002418A1 (en) | Anti-pd-l1/vegf bifunctional antibody and use thereof | |
| US10118964B2 (en) | Construction and application of bispecific antibody HER2xCD3 | |
| CN105121474B9 (en) | Fusion immunomodulatory protein and preparation method thereof | |
| US20240043567A1 (en) | Bispecific antibody and application thereof | |
| WO2018050039A1 (en) | Novel anti-pd-1 nano-antibody and application thereof | |
| KR101477762B1 (en) | Specific binding proteins and uses thereof | |
| CN112794909B (en) | anti-TIGIT monoclonal antibody and application thereof | |
| CN108250303B (en) | Single-domain antibody fusion protein and application thereof | |
| CN103124740A (en) | Anti-SSX-2 T cell receptors and related materials and methods of use | |
| CN104059148A (en) | Humanized anti human epidermal growth factor receptor antibody and application thereof | |
| CN104829728A (en) | Construction and application of bispecific antibody HER2*CD3 | |
| CN104558192A (en) | Construction and application of bispecific antibody HER2*CD3 | |
| JP2022521937A (en) | Antibody molecules that bind to NKp30 and their use | |
| WO2021219127A1 (en) | Bispecific antibody targeting her2 and pd-1 and application thereof | |
| EP3904381A1 (en) | Antibody fusion protein, preparation method therefor and application thereof | |
| JP2023522492A (en) | Bispecific antibody targeting human claudin and human PDL1 protein and use thereof | |
| CN104830901A (en) | Construction method of murine tumor model and application thereof | |
| CN104098698A (en) | Antibody against CD3, and preparation method and application thereof | |
| CN110396131B (en) | ErbB2 single-chain antibody, chimeric antigen receptor targeting human ErbB2, recombinant vector, recombinant cell and application | |
| CN104558193A (en) | Preparation method and application of bispecific antibody targeting mouse T lymphocyte CD3 and human tumor antigen HER2 | |
| CN112048019B (en) | Anti-human CD47 monoclonal antibodies | |
| CN103172741B (en) | Full people source anti-egfr antibodies | |
| WO2022194201A1 (en) | Cldn18.2-targeting antibody or antigen binding fragment thereof and use thereof | |
| WO2021244553A1 (en) | Tetravalent bispecific antibody against pd-1 and egfr |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |