CN104046630A - Aptamer having specificity with human cytomegalovirus PP65 antigen - Google Patents

Abstract

The invention discloses an aptamer having specificity with a human cytomegalovirus PP65 antigen. The gene sequence of the aptamer is represented by SEQ ID No: 1, or SEQ ID No: 2, or SEQ ID No: 3, or SEQ ID No: 4, or SEQ ID No: 5, or SEQ ID No: 6. The oligonucleotide aptamer specifically combined with PP65 is screened from a random ssNDA library by using a systematic evolution technology of ligand by exponential enrichment with the PP65 protein as a target molecule, and the structure of the screened aptamer is analyzed. Compared with antibodies in traditional detection technologies, the oligonucleotide aptamer has the advantages of strong bonding power with the target molecule, good stability, high accuracy, good repeatability, repeated use, long term preservation, accurate site modification, short screening period and the like.

Description

A kind of have specific aptamer with human cytomegalic inclusion disease virus PP65 antigen

Technical field

The invention belongs to biomedical sector, specifically, relate to a kind of and human cytomegalic inclusion disease virus PP65 antigen and there is specific aptamer.

Background technology

Human cytomegalic inclusion disease virus (human cytomegalovirus, HCMV) belongs to herpetoviridae second group bleb subfamily, is a kind of duplex DNA virus.HCMV is worldwide distribution, wide-scale distribution in crowd, and virus is hidden for a long time in host cell, is inapparent infection.Work as gestation, easily cause fetal in utero to infect, cause miscarriage, premature labor, stillborn foetus or fetus congenital malformation; Work as bone marrow transplantation, during the Organ Transplantation Patients immune function depressions such as liver, kidney, heart, latent virus is activated, rises in value and severe infections occurs, and will cause patient's organ transplantation failure even dead.In recent years, there are some researches show that cytomegalovirus infection and some diseases associated with inflammation and proliferative disease have close relationship, comprise some cardiovascular disorder and cancer.Now, cytomegalovirus infection causes great threat to human health, therefore the early diagnosis that HCMV is infected seems particularly important.In HCMV experiment detection technique, viral separation is the gold standard detecting, but length consuming time, result is affected greatly by the sample shelf time.Antibody test need just can detect after patient infection's certain hour, affected by patient's autoimmune state larger, and can not distinguish latent infection and Active infection.Antigenemia detection technique is quick, a responsive diagnostic techniques, but traditional detection method is virus antigen detection carrier mainly with white corpuscle, has limited its clinical application.And its sensitivity and specificity of diagnostic nucleic acid is all good, but testing cost is high and method for extracting nucleic acid need to improve.

SELEX technology, Fas lignand system evolution (the Systematic evolution of ligands byexponential enrichment that claims again exponential enrichment, SELEX) technology is a kind of new combinatorial chemistry technique, apply jumbo random oligonucleotide, and in conjunction with PCR Amplification Technologies, with the oligonucleotide of exponential enrichment and target molecule specific combination, through several screening processes of taking turns or counting wheel, obtain the aptamer of high-affinity, high specific.In the molecular recognition field of laboratory diagnosis and clinical treatment, it provides a technique means quicker, sensitiveer than antibody.At present, this technology has been successfully applied to the screening of many target materials, comprises albumen, small molecules, metal ion, some complicated targets such as virus, bacterium, cell even, and part nucleic acid aptamer has entered clinical experimental stage.

Summary of the invention

The object of the invention is to overcome the deficiencies in the prior art, provide a kind of and there is specific aptamer with human cytomegalic inclusion disease virus PP65 antigen.

The technical scheme that the present invention realizes object is:

There is a specific aptamer with human cytomegalic inclusion disease virus PP65 antigen, it is characterized in that: it has one of sequence of SEQ ID No.1～SEQ ID No.6.

The secondary conformation of SEQ ID No.1～SEQ ID No.6 respectively is:

Beneficial effect: the present invention compares with the antibody in traditional detection technology, oligonucleotide aptamer also stronger, the good stability of tool and target molecule bonding force, accuracy high, reproducible, can Reusability, can preserve for a long time, can carry out the advantages such as the modification of accurate site, screening be shorter.

Accompanying drawing explanation

Fig. 1 is the affinity distribution plan of inventor cytomegalovirus PP65 antigen aptamer and target material.

Embodiment

Below, by the concrete operation step of human cytomegalic inclusion disease virus PP65 antigen aptamer screening, the invention will be further described.

Embodiment mono-, structure random single chain DNA (ssDNA) library and primer

Building length is the ssDNA library of 78 bases, and two ends are fixed sequence program, and middle 35 Nucleotide are stochastic sequence, and wherein N represents A, T, and C, any one in G, storage capacity is about 10 ¹⁵-10 ¹⁶: 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 '.Upstream primer is 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ', and downstream primer is 5 '-biotin-(CH2)-TTCGACATGAGGCCCGGATC-3 '.Random single-stranded DNA banks and primer Ke You primer Synesis Company are synthetic.

Pcr amplification and the recovery in double-stranded DNA (dsDNA) library:

PCR reaction system

Reaction parameter	Add-on (unit: μ l)
		10*PCR damping fluid	2.0
MgCl2(25mmol／L)	1.2
		dNTP(2.5mmol／L)	1.6
Primer 1 (10pmol/L)	1.0
		Primer 2 (10pmol/L)	1.0
Template (ssDNA library)	0.1
		TaqDNA polysaccharase	1.0
ddH2O	12.1
		Cumulative volume	20.0

PCR reaction conditions

Temperature (℃)	Effect	Time (S)
			94	Denaturation	300
94	Sex change	30
			65	Annealing	30
72	Extend	30

Carry out altogether 18 circulations, last 72 ℃ are extended 5min., the product obtaining carries out next step experiment (or 4 ℃ of preservations) PcR product purification and recovery: toward the sodium acetate of 3mol/LpH5.2 and the ice-cold dehydrated alcohol of 2-2.5 times of volume that add 0.1 times of volume in DNA solution, on spiral mixer oscillator, vibration mixes and is placed in-20 ℃ of refrigerators and places 30min, then the centrifugal 5min of 12000rpm, abandon supernatant, 70% ethanol that adds 1ml precooling, put upside down centrifuge tube for several times, the centrifugal 5min of 12000rpm, abandon supernatant, after drying precipitation, (can be placed in baking oven 10min) is dissolved in 20 μ LTE damping fluid (pH8.0) or ddH2O, 4 ℃ of preservations are spent the night.

Pcr amplification and the recovery in single stranded DNA (dsDNA) library:

Adopt asymmetric PCR to increase,

PCR reaction system

Reaction parameter	Add-on (unit: μ l)
		10*PCR damping fluid	2.0
MgCl2(25mmol／L)	0.2
		dNTP(2.5mmol／L)	1.6
Primer 1 (0.4pmol/L)	0.5
		Primer 2 (10pmol/L)	2.0
Template (dsDNA library)	0.5
		TaqDNA polysaccharase	0.4
ddH2O	12.8
		Cumulative volume	20.0

PCR reaction conditions

Temperature (℃)	Effect	Time (S)
			94	Denaturation	300
94	Sex change	30
			65	Annealing	30
72	Extend	45

Carry out altogether 40 circulations, last 72 ℃ are extended 7min., and the product obtaining carries out the recovery in next step experiment (or 4 ℃ of preservations) same double-stranded DNA of recovery method (dsDNA) library.

Agarose gel electrophoresis is observed PCR result

The sepharose of preparation 2%: accurately take 2g electrophoresis level agarose, add 100ml 1XTAE electrophoretic buffer, in microwave oven, be heated to dissolve, when gel is cooled to 55 ℃ of left and right, add ethidium bromide (final concentration is 0.5 μ g/mL) to rotate and shake up gently, pour glued membrane into, insert suitable comb, use after allowing gelating soln condense.

PCR product electrophoresis: gel is placed in to electrophoresis chamber, get 3 μ LPCR products and add 1 μ l 6X loading buffer (0.25% tetrabromophenol sulfonphthalein, 0.25% dimethylbenzene cyanogen, 30% aqueous glycerin solution), loading after mixing, separately get 5 μ LDL Marker, add respectively in sepharose hole, in 1XTAE electrophoretic buffer, 80V electrophoresis 15-20min observes electrophoresis result on gel imaging instrument.

Embodiment bis-, SELEX screening

1. albumen is coated

With the carbonate buffer solution of pH9.60.05mol/L, PP65 albumen is diluted to desired concn, adds 100 μ l in each hole of each SELEX96 orifice plate (polystyrene board), establish blank hole and anti-sieve control wells simultaneously, 4 ℃ are spent the night.Next day, discards solution in hole, with lavation buffer solution PBST, washes three times.

2. sealing

3% BSA (calf serum), 37 ℃ of sealings are spent the night for 1 hour or 4 ℃.

The combination in 3.ssDNA library

The ssDNA library 100 μ l that add SELEX binding buffer to dilute, first hatch with blank hole (or anti-sieve contrasts empty) 37 ℃, anti-sieve is removed the ssDNA with target protein non-specific binding, then transfer in the coated hole of PP65 albumen 37 ℃ and hatch, with SELEX washing buffer washing 5 times.

4. wash-out

Add SELEX eluting buffer, in 80 ℃ of water-bath effect 10min, under wash-out with protein bound ssDNA.

5. the ssDNA of phenol-chloroform extracting, the combination of ethanol deposition and purification

Toward filling, in the 1.5mL Ep pipe of DNA solution to be purified, add isopyknic phenol: chloroform: primary isoamyl alcohol (25:24:1 volume ratio), on spiral mixer oscillator, vibration mixes, the centrifugal 15s of room temperature 12000rpm.With liquid-transfering gun by the upper strata of containing DNA (water) careful new Ep pipe of immigration, toward the sodium acetate (NaAc) and 2～2.5 times of dehydrated alcohols that volume is ice-cold that add the 3mol/L pH5.2 of 0.1 times of volume in ssDNA solution, on spiral mixer oscillator, vibration mixes and is placed in-20 ℃ of 30min, then the centrifugal 5min of 12000rpm, abandon supernatant, 70% ethanol that adds 1mL precooling, put upside down centrifuge tube for several times, the centrifugal 5min of 12000rpm, abandon supernatant, after drying precipitation, be dissolved in 20 μ LTE damping fluid (PH8.0) or ddH20,4 ℃ of preservations.

SsDNA library after being screened by PCR and asymmetric PCR, then carries out electrophoresis detection.Finally carry out altogether 8 take turns screening reach capacity, obtain specificity the highest, the ssDNA library that avidity is the strongest.

Embodiment tri-, Cloning and sequencing

1. reclaiming product connects

The saturated library of screening is connected to pMD18-T Simple Vector(TaKaRa company).

Amplification obtains biotin labeled ssDNA library through asymmetric PCR by the 8th, to take turns the ssDNA library obtaining, by cytomegalovirus PP65 for albumen carbonate (PH9.6) damping fluid be diluted to 10 μ g/ml, get the coated elisa plate of 100 μ l, 4 ℃ are spent the night, PBST (PBS+Tween) washing 4 times, 3min/ time; 3%BSA37 ℃ is sealed 1 hour, PBST washing 4 times, 3min/ time; With the 8th of SELEX binding buffer dilution, take turns biotin labeled ssDNA0.05 μ g/ hole, 37 ℃ of incubation 60min, PBST washing 6 times, 3min/ time; 37 ℃ of the horseradish peroxidases of the marked by streptavidin of dilution in 1: 1000 are hatched 30min, PBST washing 6 times, 3min/ time; Add 37 ℃ of colour developing 15min of tetramethyl benzidine (tetramethylbenzidine, TMB) nitrite ion; 2mol/L vitriol oil termination reaction, microplate reader is measured A value in 450nm place.A value is greater than 0.1, reclaims product, and screening product is connected to pMD18-T simple vector (TaKaRa company).With reference to the pMD18-T Simple Vector of the TaKaRa company description of product, the goal gene PCR product after purifying is connected with cloning vector pMD18-TSimple Vector, 16 ℃ of connections are spent the night.

2. connect the conversion of product

A: by being connected in the EP pipe that product 20 μ L add the E.coli DH5a competent cell that contains 100ul of goal gene fragment and pMD18-T Simple Vector, ice bath 30min.

B: put into 42 ℃ of water-bath heat-shocked 1min, will manage fast and take out ice bath 2min.

C: every pipe adds SOC nutrient solution 600 μ l, 37 ℃ of shaking tables, 150rpm, cultivates 1h, makes the antibiotics resistance marker gene of bacteria resuscitation expression plasmid coding.

D: the competent cell that proper volume has been transformed is coated on the LB flat board that contains penbritin 100 μ g/ml, and flat board is placed in to room temperature until liquid is absorbed.

E: be inverted flat board, in 37 ℃ of constant temperature culture, occur bacterium colony after 12～16h, the several bacterium colony PCR of random picking identify.

F: random 110 mono-clonals of picking, add in the 1.5ml EP pipe that fills 600 μ L LB liquid nutrient mediums (containing penbritin 100 μ g/ml) 37 ℃ of shaking tables, 200rpm, overnight incubation.Add 600 μ L(equivalent next day) 80% autoclaving glycerine, sealing orifice, preserves bacterial classification in-70 ℃.

3. the extraction of recombinant plasmid

Get 50 μ L mono-clonal bacterium liquid and be inoculated in 5ml containing the LB substratum of penbritin 100 μ g/ml, 37 ℃ of shaking tables, 250rpm, overnight incubation.With plasmid extraction test kit, extract recombinant plasmid.

4.PCR identifies

The extraction plasmid of take is template, adds SELEX primer I and primer I I to carry out pcr amplification reaction, and product electrophoresis is determined positive colony, and send the order-checking of order-checking company.

The sequence of human cytomegalic inclusion disease virus PP65 antigen aptamer:

A4

GGGAGCTCAGAATAAACGCTCAAGGCATGGTCCTCGATCGTATGGCTTTGCGGTCGTGTTCGACATGAGGCCCGGATC

A5

GGGAGCTCAGAATAAACGCTCAATATCCCTATTCCGCTCCATGTTGCGTACCCGTGCCTTCGACATGAGGCCCGGATC

A6

GGGAGCTCAGAATAAACGCTCAACGGATTAGTCAATAGACTGGTGGCTTTGTGTGGTGTTCGACATGAGGCCCGGATC

A7

GGGAGCTCAGAATAAACGCTCAATATCCCTATTCCGCTCCATGCTGCGTACCCGTGCCTTCGACATGAGGCCCGGATC

A10

GGGAGCTCAGAATAAACGCTCAATGTGTTCATTTTTGGGGCTTGCGGGTGGTTCGCTGTTCGACATGAGGCCCGGATC

A19

GGGAGCTCAGAATAAACGCTCAACGTCCCTCTCGTGTTGCTGCTGCTTTTTCCTGTGGTTCGACATGAGGCCCGGATC

5. fit affinity detects

The single clone who selects is obtained to ssDNA after SELEX primer I and the amplification of primer III asymmetric PCR, and by this ssDNA and the protein binding being coated with, enzyme-linked method is measured its affinity.By the coated hole of every hole 1 μ g ssDNA and 2 μ g albumen in 100 μ Lselex binding buffer 37 ℃ hatch 40 min; Selex washing buffer washing 5 times,, add marked by streptavidin horseradish peroxidase 100 μ L, hatch 30min for 37 ℃; Lavation buffer solution washing 5 times, then every hole adds each 50 μ L of substrate nitrite ion A, B, 37 ℃ of colour developing 15min; The 2mol/L vitriol oil 50 μ L termination reactions, microplate reader is measured absorbancy (A) value in 450nm place.Record fit affinity as follows:

The affinity distribution plan of (referring to Fig. 1) human cytomegalic inclusion disease virus PP65 antigen aptamer and target material

Numbering	OD value	Numbering	OD value
				A4	2.726	A10	1.271
A5	1.054	A19	1.137
				A6	1.522	NC	0.067
A7	1.629	?	?

The negative contrast of note: NC.

Claims (2)

1. there is a specific aptamer with human cytomegalic inclusion disease virus PP65 antigen, it is characterized in that: one of sequence that it is SEQ ID No.1～SEQ ID No.6.

2. a kind of according to claim 1 have specific aptamer with human cytomegalic inclusion disease virus PP65 antigen, it is characterized in that the secondary conformation of SEQ ID No.1～SEQ ID No.6 respectively is: