CN102242123B - Cytomegalovirus antibody aptamer specific to cytomegalovirus, and biochip formed by same - Google Patents
Cytomegalovirus antibody aptamer specific to cytomegalovirus, and biochip formed by same Download PDFInfo
- Publication number
- CN102242123B CN102242123B CN 201110153338 CN201110153338A CN102242123B CN 102242123 B CN102242123 B CN 102242123B CN 201110153338 CN201110153338 CN 201110153338 CN 201110153338 A CN201110153338 A CN 201110153338A CN 102242123 B CN102242123 B CN 102242123B
- Authority
- CN
- China
- Prior art keywords
- aptamer
- cytomegalovirus
- seq
- biochip
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a cytomegalovirus antibody aptamer specific to cytomegalovirus, and a biochip formed by the cytomegalovirus antibody aptamer simultaneously. Compared with the antibody in the traditional detection technique, the oligonucleotide aptamer disclosed by the invention has the advantages of stronger binding force with a target molecule, good stability, high accuracy, good repeatability, shorter screening period and the like, and can be repeatedly used, stored for a long term and used for accurate site modification. When put into an SPR (surface plasmon resonance) biosensor for detection, the obtained biochip can realize real-time detection, no need of marking samples, a very small required amount of samples, convenient, quick and highly-sensitive detection process, wide range of application, high flux, and detection of a turbid or even opaque sample under most conditions.
Description
Technical field
The invention belongs to biomedical sector, specifically, relate to a kind of and cytomegalovirus and have specific giant cells antibody aptamer and consist of whether to infect cytomegalic biochip in pregnant woman's early detection.
Background technology
Inborn defect is brought great spirit and economical load to family, country and society.At present, clinical birth defects to fetus there is no effective methods for the treatment of.In the method for birth defect prevention, the primary prevention in pregnant early stage is the most effective.
Giant cells is the pathogenic micro-organism of one group of infection in pregnancy, can cause intrauterine infection by placenta or birth canal, causes miscarriage, stillborn foetus or intrauterine growth retardation, congenital malformation, neonatal period infection and baby, physical growth of children dysplasia.China has 26,000 cytomegalovirus infection infant births every year approximately, on average per hour just has 3, and therefore, the cytomegalovirus examination is the important content that pregnant front infectious diseases checks.But data shows according to statistics, and China's current diagnosis is clinical generally to adopt ELISA method, golden mark method etc. to detect serum of women TOX-IgG and the level of CMV-IgG in pregnant age, and false positive rate is higher, and the clinical accurately diagnosis basis that provides can not be provided.
The SELEX technology, the phyletic evolution of index concentration part (systematic evolution ofligands by exponential enrichment, SELEX) is a combinatorial chemistry technique that grows up the nineties in 20th century again.Although the screening process of DNA part and RNA part has not together, generally all comprises following step: (1) sets up dsDNA stochastic sequence storehouse by synthetic.(2) with the target substance reaction, filter out the target material-nucleic acid complex that mutually combines.(3) the protein-nucleic acid mixture that screens is separated, the nucleic acid that obtains carries out pcr amplification, and sex change becomes strand to prepare to carry out the next round screening, and the number of times of screening is determined by the type in library and the enrichment degree of each circulation gained specific sequence.(4) through some take turns that screening obtains, can height can check order in conjunction with the nucleic acid ligands of target material and be used for various research work.The advantages such as it is large to have storage capacity, and the target molecule scope is wide, and avidity is strong are used very extensive.Compare with the antibody in the traditional detection technology, but but oligonucleotide aptamer tool and the target molecule bonding force is stronger, good stability, accuracy height, good reproducibility Reusability prolonged preservation, can carry out the advantages such as accurate site is modified, the screening phase is shorter also, be a kind of efficiently, detection means fast.
Surface plasma body resonant vibration (surface plasmon resonance in recent years, SPR) technology because of its have Real-Time Monitoring reaction dynamic process, sensitivity higher, need not mark, without background interference, the characteristics such as with low cost, the desirable detection means that is considered to biomolecule detection has become the focus that the clinical experiment diagnostic field is studied.Ultimate principle is a kind of physical optics phenomenon.Surface plasma (SP) is that the hertzian wave of propagating along interface between metal and dielectric medium forms.When the polarized light of parallel surfaces is incident on the interface to be referred to as the surface plasma body resonant vibration angle, when attenuated total reflectance attenuated total refraction occurs, incident light is coupled in the surface plasma, and luminous energy is absorbed in a large number, reduces owing to surface plasma body resonant vibration causes boundary reflection light display work on this angle.Because SPR is very responsive to the dielectric specific refractory power in metallic surface, its surface plasma body resonant vibration angle of different dielectric mediums is different.Dielectric medium of the same race, its amount that is attached to the metallic surface is different, and then the response intensity of SPR is different.Biosensor based on this principle is that part is fixed in metallic film surface with a kind of molecule of tool specific recognition attribute usually, the assay in the monitoring solution and the cohesive process of this part.In mixture formation or dissociation process, the specific refractory power of metallic film surface solution changes, and is detected by surface plasmon resonance biosensor immediately.Compare with traditional ELISA detection method, surface plasmon resonance biosensor has following distinguishing feature: (1) is detected in real time, dynamically the whole process of monitoring bio interaction of molecules; (2) need not the mark sample, kept molecular activity; (3) the sample requirement is few; (4) testing process is convenient and swift, and is highly sensitive; (5) range of application is very extensive; (6) high-throughput, high-quality analytical data; (7) in most cases, do not need sample is carried out pre-treatment; (8) can detect muddy even opaque sample.Be widely used in now physical quantity and detected chemical detection and biological monitoring.
If can filter out the aptamer of giant cells antibody, then it is coated on the biochip, detect in conjunction with surface plasmon resonance biosensor again, with very quick and accurately.
Summary of the invention
For solving above technical problem, one of purpose of the present invention is to provide that a kind of, good stability stronger with the cytomegalovirus bonding force, accuracy are high, the giant cells antibody aptamer of good reproducibility.
Two of the object of the invention is to provide a kind of and has the biochip that specific giant cells antibody aptamer consists of with cytomegalovirus.
The present invention seeks to realize like this: a kind of have specific giant cells antibody aptamer with cytomegalovirus, and it is characterized in that: he has one of sequence of SEQ ID No.1～SEQ ID No.3.
The secondary conformation of SEQ ID No.1～SEQ ID No.3 respectively is:
A kind of by with cytomegalovirus have that specific giant cells antibody aptamer consists of biochip, comprise substrate of glass (1), be attached with successively golden film (2), articulamentum (3) and surface matrix (4) on the substrate of glass (1), the stream pond of described golden film (2) is coated with the aptamer of SEQ ID No.1～SEQ ID No.3 sequence.
Above-mentioned golden film (2) before coated aptamer, first pre-treatment, i.e. soaking and washing 20min in 1.0mol/L NaOH, use washed with de-ionized water 3 times after taking out, then put into Piranha solution and process 15min, drop into immediately after the taking-up and soak 5min in the dehydrated alcohol, nitrogen dries up.
Before above-mentioned aptamer was coated on the golden film (2), first pre-treatment namely was dissolved into aptamer first the PBS damping fluid, 95 ℃ of sex change 3min, and rapid ice bath 2min, the sulfydryl method is fixed subsequently.
Giant cells antibody aptamer obtains through following methods preparation screening:
Make up random single chain DNA (ssDNA) library and primer: making up length is the ssDNA library of 78 bases, two ends are fixed sequence program, middle 35 Nucleotide are stochastic sequence, wherein N represents A, T, C, any one among the G, storage capacity is about 1015-1016:5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 '.Upstream primer is 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ', and downstream primer is 5 '-TTCGACATGAGGCCCGGATC-3 '.Downstream primer sequence 5 ' end need be used biotin labeling.Random single-stranded DNA banks and primer can be synthetic by primer Synesis Company.
Pcr amplification and the recovery in double-stranded DNA (dsDNA) library:
The PCR reaction system
The PCR reaction conditions
Carry out altogether 18 circulations, last 72 ℃ are extended 5min., the product that obtains carries out next step experiment (or 4 ℃ of preservations) PCR product purification and recovery: add the sodium acetate of 3mol/L pH5.2 of 0.1 times of volume and the ice-cold dehydrated alcohol of 2-2.5 times of volume in the dna solution, at spiral mixer oscillator vibration mixing and place in-20 ℃ of refrigerators and place 30min, then the centrifugal 5min of 12000rpm, abandon supernatant, 70% ethanol that adds the 1ml precooling, put upside down centrifuge tube for several times, the centrifugal 5min of 12000rpm, abandon supernatant, dry precipitation rear (can place baking oven 10min) and be dissolved in 20 μ LTE damping fluid (pH8.0) or ddH2O, 4 ℃ of preservations are spent the night.
Pcr amplification and the recovery in single stranded DNA (dsDNA) library:
Adopt asymmetric PCR to increase,
The PCR reaction system
The PCR reaction conditions
Carry out altogether 40 circulations, last 72 ℃ are extended 7min., and the product that obtains carries out the recovery in next step experiment (or 4 ℃ of preservations) same double-stranded DNA of recovery method (dsDNA) library.
Agarose gel electrophoresis is observed PCR result
The sepharose of preparation 2%: accurately take by weighing 2g electrophoresis level agarose, add 100ml 1XTAE electrophoretic buffer, in microwave oven, be heated to and dissolve, when treating that gel is cooled to 55 ℃ of left and right sides, adding ethidium bromide (final concentration is 0.5 μ g/mL) rotates gently and shakes up, pour glued membrane into, insert suitable comb, allow the gelating soln rear use of condensing.
PCR product electrophoresis: gel is placed electrophoresis chamber, get 3 μ LPCR products and add 1 μ l 6X loading buffer (0.25% tetrabromophenol sulfonphthalein, 0.25% dimethylbenzene cyanogen, 30% aqueous glycerin solution), loading after mixing, other gets 5 μ LDL Marker, add respectively in the sepharose hole, 80V electrophoresis 15-20min observes electrophoresis result at the gel imaging instrument in the 1XTAE electrophoretic buffer.
The SELEX screening
Coated antibody: the coating buffer (carbonate buffer solution) with PH9.6 0.05mol/L is diluted to desired concn with CMV antibody (TOX-IgG), in each SELEX96 orifice plate, add 100 μ l in each hole of (polystyrene board), establish simultaneously the blank hole, 4 ℃ of preservations are spent the night.Discard solution in the hole next day, washes three times with lavation buffer solution PBST.Dilution is as follows: CMV antibody (TOX-IgG): get 3 μ l reagent (antibody sources ABcam company, the 1mg/ml of unit), add the coated damping fluid dilution of 300 μ l.Weaker concn is all as follows: 1 μ g/ hole, 0.5 μ g/ hole, 0.25 μ g/ hole X3,0.1 μ g/ hole X3,0.05 μ g/ hole X2,0.025 μ g/ hole X2 are by calculating: 12X2=24 hole, altogether coated 24 holes.Add 10 blank holes, totally 34 holes.Sealing: concentration is 3% BSA (calf serum), 300 μ l/ holes, and 4 ℃ of preservations are spent the night.
The combination in ssDNA library: add SELEX binding buffer dilution ssDNA library to 100 μ l, hatch 30min with 37 ℃ in blank hole first, blank anti-sieve is removed the ssDNA of target protein non-specific binding, then transfers in the coated hole of CMV antibody (TOX-IgG) (content is the hole of 1 μ g) and hatches 60min.
Simple elution: with SELEX washing buffer washing 5 times, each 3min.
Strengthen wash-out: in reacting hole, add 100 μ l with SELEX eluting buffer, in 80 ℃ of water-bath effect 10min.
Refining ssDNA: add isopyknic phenol in the 1.5ml EP pipe that fills ssDNA solution to be purified: chloroform: the solution of primary isoamyl alcohol (25: 24: 1), the mixing that vibrates on the spiral mixer oscillator, the centrifugal 15s of room temperature 12000rpm.To contain in the careful new EP pipe of immigration in the upper strata (water) of DNA with liquid-transfering gun, add the sodium acetate of 3mol/L pH5.2 of 0.1 times of volume and the ice-cold dehydrated alcohol of 2-2.5 times of volume in the ssDNA solution, at spiral mixer oscillator vibration mixing and place in-20 ℃ of refrigerators and place 30min, then the centrifugal 10min of 12000rpm, abandon supernatant, 70% ethanol that adds the 1ml precooling, put upside down centrifuge tube for several times, the centrifugal 5min of 12000rpm, abandon supernatant, (can place 37 ℃ of baking oven 10min) is dissolved in 20 μ l TE damping fluid (pH8.0) or ddH2O after drying precipitation, and 4 ℃ of preservations are spent the night.
Electrophoresis detection is carried out in ssDNA library after obtaining screening by PCR and asymmetric PCR then.Carry out altogether at last 12 take turns the screening reach capacity, it is the highest to obtain specificity, the ssDNA library that avidity is the strongest.
Measure affinity
Amplification obtains biotin labeled ssDNA library through asymmetric PCR to take turns the ssDNA library that obtains with the 12nd, the CMV antibody (TOX-IgG) that purifying is obtained is diluted to the coated elisa plate of 10 μ g/ml with carbonate (PH9.6) damping fluid, 4 ℃ are spent the night, PBST (PBS+Tween) washing 3 times, 3min/ time; 37 ℃ of sealings of 3%BSA 1 hour, PBST washing 3 times, 3min/ time; Take turns biotin labeled ssDNA0.05 μ g/ hole with the 12nd of SELEX binding buffer dilution, add simultaneously 37 ℃ of incubation 60min of cytomegalovirus albumen (TOX) 100 μ l of different concns gradient, PBST washing 4 times, 3min/ time; 37 ℃ of the horseradish peroxidases of the marked by streptavidin of dilution in 1: 2000 are hatched 30min, PBST washing 4 times, 3min/ time; Add 37 ℃ of colour developings of tetramethyl benzidine (tetramethylbenzidine, TMB) nitrite ion 15min; 2mol/L vitriol oil termination reaction, microplate reader are measured the A value in the 450nm place.The A value is after 0.157 recovery product connection 12 is taken turns, will screen product and be connected to pMD18-T simple vector (TaKaRa company).With reference to the description of product of the pMD18-T simple vector of TaKaRa company, the goal gene PCR product behind the purifying is connected with cloning vector pMD18-Tsimple vector, goal gene fragment and carrier segments reaction system are as follows:
PMD18-T/PCR product/connection damping fluid: 1 μ l/9 μ l/10 μ l
16 ℃ of connections are spent the night
Connect the conversion of product
A, goal gene fragment and pMD18-T simple vector be connected in the EP pipe that product 20 μ l add the E.coli DH5 α competent cell that contains 100 μ l ice bath 30min
B, put into 42 ℃ of water-bath heat-shocked 1min, will manage fast and take out ice bath 2min
C, every pipe add SOC nutrient solution 600 μ l, 37 ℃ of shaking tables, and 150rpm cultivates 60min, makes the antibiosis disposition marker gene of bacteria resuscitation and expression plasmid coding.
D, the competent cell that proper volume has been transformed are coated on the LB flat board that contains penbritin 100 μ g/ml, and flat board is placed room temperature until liquid is absorbed.
E, inversion flat board in 37 ℃ of constant temperature culture, bacterium colony occurs after 12-16 hour, and the several bacterium colony PCR of picking identify at random.
F, 110 mono-clonals of picking add and fill in the 600 μ l LB liquid nutrient mediums 1.5ml EP pipe of (containing penbritin 100 μ g/ml) 37 ℃ of shaking tables, 200rpm, overnight incubation at random.Add 600 μ l (equivalent), 80% autoclaving glycerine next day, sealing orifice is preserved bacterial classification in-70 ℃.
The extraction of recombinant plasmid
Get 50 μ l mono-clonal bacterium liquid and be inoculated in the LB substratum that 5ml contains penbritin 100 μ g/ml, 37 ℃ of shaking tables, 250rpm, overnight incubation.
It is as follows to extract in a small amount the plasmid concrete operations:
A, get about 3.0ml clone bacterium liquid and put in the 1.5ml eppendof pipe, the centrifugal 2min of 12000rpm/min abandons supernatant
B, thalline are resuspended in the 100 μ l solution 1, ice bath 10min
C, add the solution 2 of the new configuration of 200 μ l, ice bath 5min
D, add 150 μ l solution 3, ice bath 10min, 4 ℃, the centrifugal 10min of 12000rpm/min
E, supernatant move in the clean pipe, add the extracting of equal-volume phenol-chloroform once
F, the dehydrated alcohol that amasss with diploid precipitate double-stranded DNA, and the centrifugal 10min of 12000rpm/min abandons supernatant
G, usefulness 1ml 70% washing with alcohol precipitate once, and room temperature is fully dry
H, precipitation is dissolved among the TE of 20 μ l, adds the RNA enzyme, making its final concentration is 20 μ g/ml, 37 ℃ of water-bath 30min, digestion RNA
I, get 2 μ l and carry out 2% agarose gel electrophoresis
PCR identifies
To extract plasmid as template, add primer 1 and carry out pcr amplification reaction, the product electrophoresis with primer 2.
Fit affinity detects
Obtain ssDNA after single clone's process asymmetric PCR amplification with picking, with this ssDNA and coated 1 good μ g/ hole antibodies, enzyme-linked method is measured its affinity.
Affinity is as shown in Figure 3 following.
Order-checking
The picking mono-clonal send the order-checking of order-checking company
The sequence of giant cells antibody aptamer:
2F12A2
GGGAGCTCAGAATAAACGCTCAAGAGGCCCGATCTTCGACATGAGGCCCGGATC
2F12A3
GGGAGCTCAGAATAAACGCTCAAGCTTCGACATGAGGCCCGGATC
2F12A4
GGGAGCTCAGAATAAACGCTCAACGCATTTCGCAACACGACTTGGCCAACGTTCCTGGT
TCGACATGAGGCCCGGATC
2F12A5
GGGAGCTCAGAATAAACGCTCAACGGTCAACTCGTGTATTCGACATGAGGCCCGGATC
2F12A7
GGGAGCTCAGAATAAACGCTCAAGGGAGCCCCCTTCGACATGAGGCCCGGATC
2F12A8
GGGAGCTCAGAATAAACGCTCAATAGCAGTTTTCGTCGACTGCATCATTGTATTGATGTT
CGACATGAGGCCCGGATC
2F12A10
GGGAGCTCAGAATAAACGCTCAATGGGAGCTGATGTCGCATGGGTTTGGATCACATGAT
TCGACATGAGGCCTGGATC
3 giant cells aptamers that affinity is the highest
For
2F12A10
GGGAGCTCAGAATAAACGCTCAATGGGAGCTGATGTCGCATGGGTTTGGATCACATGAT
TCGACATGA
2F12A5 GGGAGCTCAGAATAAACGCTCAACGGTCAACTCGTGTATTCGACATGAGGCCC
GGATC
2F12A2
GGGAGCTCAGAATAAACGCTCAAGAGGCCCGATCTTCGACATGAGGCCCGGATC
Aptamer is coated with biochip
Then we detect in conjunction with surface plasmon resonance biosensor at the coated the strongest aptamer of affinity of surface matrix, and concrete grammar is as follows:
The biochip surface pre-treatment is put into 1.0mol/LNaOH soaking and washing 20min with the biochip that surface matrix is coated with the gold film electrode of Streptavidin, use washed with de-ionized water 3 times after taking out, then biochip is put into Piranha solution and processed 15min, immediately it is dropped in the dehydrated alcohol after the taking-up and soak 5min, nitrogen dries up for subsequent use.
The aptamer pre-treatment: the dissolving of PBS damping fluid, 95 ℃ of sex change 3min, rapid ice bath 2min, the sulfydryl method is fixed subsequently.
Sulfydryl method probe is fixed: the biotinylated aptamer through denaturing treatment covers pretreated chip surface matrix, make aptamer firmly be fixed on the biochip, aptamer adopts optimum concn 1.0umol/L, the PBS buffer solution for cleaning is 3 times behind the 2h, 0.02%BSA seals about 1h, PBS buffer solution for cleaning.
Beneficial effect: the present invention compares with the antibody in the traditional detection technology, but but oligonucleotide aptamer tool and the target molecule bonding force is stronger, good stability, accuracy height, good reproducibility Reusability prolonged preservation, can carry out the advantages such as accurate site is modified, the screening phase is shorter also; Resulting biochip is put into surface plasmon resonance biosensor and is detected, can realize that (1) is detected in real time, (2) need not the mark sample, (3) sample requirement is few, (4) testing process is convenient and swift, highly sensitive, (5) range of application very extensively, (6) high-throughput, (7) in most cases, (8) can detect muddiness even opaque sample.
Figure of description
Fig. 1 is the synoptic diagram of biochip of the present invention;
Fig. 2 is that SPR detects data plot;
Fig. 3 is the affinity distribution plan of giant cells aptamer and antibody.
Embodiment:
Surface plasmon resonance biosensor provides for the Beijing JinPuJia Medical Treatment Science Co., Ltd, concrete instrument model is UMPHO A600/B type, biochip provides for the Beijing JinPuJia Medical Treatment Science Co., Ltd, concrete chip model and UMPHO A600/B type surface plasmon resonance biosensor are complementary, comprise substrate of glass 1, golden film 2, articulamentum 3, surface matrix 4, be attached with successively golden film 2, articulamentum 3 and surface matrix 4 on the substrate of glass 1,4 or 8 water conservancy diversion ponds are arranged on the described golden film 2, and this stream pond is coated with the aptamer of SEQ ID No.1～SEQ ID No.3 sequence.In making chip processes, first to golden film 2 pre-treatment, i.e. soaking and washing 20min in 1.0mol/L NaOH, use washed with de-ionized water 3 times after taking out, then put into Piranha solution and process 15min, drop into immediately after the taking-up and soak 5min in the dehydrated alcohol, nitrogen dries up for subsequent use.To the aptamer pre-treatment, namely first aptamer is dissolved into the PBS damping fluid again, 95 ℃ of sex change 3min, rapid ice bath 2min, the sulfydryl method is fixed subsequently.After biochip completed, the biochip that will be coated with again aptamer was written in the spr sensor, passes into excessive protein antibodies, and the aptamer on itself and the chip is reacted, and recorded at last experimental result, carried out analysis.SPR detects data plot as shown in Figure 2
SPR shown in Figure 2 detects data plot
Stream pond 1: negative control
Stream pond 5-7: the cytomegalovirus aptamer detects stream pond (concentration: 1.0umol/L)
Interpretation of result:
According to detected result, the differential seat angle that we can draw stream pond 1 (negative control) is-5.7, and the differential seat angle of stream pond 2-8 (detecting the stream pond) is followed successively by: 143.6,138,76.5,84.2,115.1,98.7,260.6.There were significant differences between the two (p＜0.01).Explanation can be carried out to toxoplasma gondii virus the analysis of quantitative and semi-quantitative by surface plasmon resonance biosensor.
[0036] sequence table
＜110〉the First Affiliated Hospital of Third Military Medical University of PLA
＜120〉giant cells antibody aptamer oligonucleotide sequence
<160>3
<210>1
<211>68
<212>DNA
＜213〉artificial sequence
<220>
<400>GGGAGCTCAG AATAAACGCT CAATGGGAGC TGATGTCGCA
TGGGTTTGGA TCACATGATT CGACATGA
<210>2
<211>68
<212>DNA
＜213〉artificial sequence
<220>
<400>GGGAGCTCAG AATAAACGCT CAACGGTCAA
CTCGTGTATT CGACATGAGG CCCGGATC
<210>3
<211>54
<212>DNA
＜213〉artificial sequence
<220>
<400>GGGAGCTCAG
CAACGCATTT CAAGAGGCCC GATCTTCGAC ATGAGGCCCG GATC
Sequence table
＜110〉the First Affiliated Hospital of Third Military Medical University of PLA
＜120〉giant cells antibody aptamer oligonucleotide sequence
<160> 3
<210> 1
<211> 68
<212> DNA
＜213〉artificial sequence
<220>
<400> GGGAGCTCAG AATAAACGCT CAATGGGAGC TGATGTCGCA
TGGGTTTGGA TCACATGATT CGACATGA
<210> 2
<211> 68
<212> DNA
＜213〉artificial sequence
<220>
<400> GGGAGCTCAG AATAAACGCT CAACGGTCAA
CTCGTGTATT CGACATGAGG CCCGGATC
<210> 3
<211> 54
<212> DNA
＜213〉artificial sequence
<220>
<400>GGGAGCTCAG CAACGCATTT CAAGAGGCCC GATCTTCGAC ATGAGGCCCG GATC
Claims (5)
1. one kind has specific giant cells antibody aptamer with cytomegalovirus, and it is characterized in that: it is one of sequence of SEQ ID No.1～SEQ ID No.3.
2. described a kind of and cytomegalovirus have specific giant cells antibody aptamer according to claim 1, it is characterized in that the secondary conformation of SEQ ID No.1～SEQ ID No.3 respectively is:
3. one kind has the biochip that specific giant cells antibody aptamer consists of by claim 1 or 2 described and cytomegaloviruses, comprise substrate of glass (1), be attached with successively golden film (2), articulamentum (3) and surface matrix (4) on the substrate of glass (1), this is characterized in that: the stream pond of described golden film (2) is coated with the aptamer of SEQ ID No.1～SEQ ID No.3 sequence.
4. described biochip according to claim 3, it is characterized in that: described golden film (2) is before coated aptamer, elder generation's pre-treatment, i.e. soaking and washing 20 min in 1.0mol/L NaOH, use washed with de-ionized water 3 times after taking out, then put into Piranha solution and process 15 min, drop into immediately after the taking-up and soak 5 min in the dehydrated alcohol, nitrogen dries up.
5. described biochip according to claim 4 is characterized in that: described aptamer be coated on golden film (2) upper before, first pre-treatment namely is dissolved into aptamer first the PBS damping fluid, 95 ℃ of sex change 3 min, rapid ice bath 2 min, the sulfydryl method is fixed subsequently.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110153338 CN102242123B (en) | 2011-06-09 | 2011-06-09 | Cytomegalovirus antibody aptamer specific to cytomegalovirus, and biochip formed by same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201110153338 CN102242123B (en) | 2011-06-09 | 2011-06-09 | Cytomegalovirus antibody aptamer specific to cytomegalovirus, and biochip formed by same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102242123A CN102242123A (en) | 2011-11-16 |
| CN102242123B true CN102242123B (en) | 2013-01-16 |
Family
ID=44960371
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201110153338 Expired - Fee Related CN102242123B (en) | 2011-06-09 | 2011-06-09 | Cytomegalovirus antibody aptamer specific to cytomegalovirus, and biochip formed by same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102242123B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103558380B (en) * | 2013-11-07 | 2015-07-22 | 中国人民解放军第三军医大学第一附属医院 | Method for quickly detecting PP65 based on biochip |
| CN104046630B (en) * | 2013-11-07 | 2016-06-08 | 中国人民解放军第三军医大学第一附属医院 | A kind of have specific aptamer with human cytomegalic inclusion disease virus PP65 antigen |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814799A (en) * | 2005-12-09 | 2006-08-09 | 浙江大学 | Herpes-like virus gene chip and its use |
| CN101586149A (en) * | 2008-06-24 | 2009-11-25 | 山东省医药生物技术研究中心 | Oligonucleotide chip and application thereof |
-
2011
- 2011-06-09 CN CN 201110153338 patent/CN102242123B/en not_active Expired - Fee Related
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1814799A (en) * | 2005-12-09 | 2006-08-09 | 浙江大学 | Herpes-like virus gene chip and its use |
| CN101586149A (en) * | 2008-06-24 | 2009-11-25 | 山东省医药生物技术研究中心 | Oligonucleotide chip and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| JUN WANG et al..In vitro selection of novel RNA ligands that bind human cytomegalovirus and block viral infection.《RNA》.2000,第6卷571-583. * |
| Zhiren Zhang et al..Nucleic acid aptamers in human viral disease.《Arch Immunol Ther Exp》.2004,第52卷207-315. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102242123A (en) | 2011-11-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111693712A (en) | Method for detecting new coronavirus SARS-CoV-2N protein by adopting aptamer | |
| CN104131105B (en) | A kind of screening technique of specific binding alpha-fetoprotein aptamer | |
| CN102234648B (en) | Toxoplasma gondii antibody aptamer with specificity to toxoplasma gondii bacteria and constructed biochip | |
| Zhu et al. | A highly sensitive aptamer-immunoassay for vascular endothelial growth factor coupled with portable glucose meter and hybridization chain reaction | |
| CN107151661A (en) | A kind of people's excretion body protein, kit and its application | |
| CN101539576A (en) | Hepatitis B virus pre S1 antigen chemiluminscence immunoassay kit and preparation method thereof | |
| CN103543275B (en) | Method for rapidly detecting PP65 based on magnetic bead | |
| CN102242123B (en) | Cytomegalovirus antibody aptamer specific to cytomegalovirus, and biochip formed by same | |
| CN104131006A (en) | Rapid detection kit for human adenoviruses | |
| CN102312019B (en) | Biological chip for rapidly detecting pre-pregnant intrauterine toxoplasma gondii and cytomegalovirus infection | |
| CN115073613A (en) | Fusion protein GLuc-p30 and preparation method and application thereof | |
| CN205741036U (en) | A kind of detection DNA rat salmonella typhi nano biological sensor Han SSeC | |
| WO2020014883A1 (en) | Single-stranded dna aptamer specifically recognizing tobramycin and application thereof | |
| CN106645750B (en) | A kind of ELISA detection kit and application thereof of humanized asprosin albumen | |
| CN105259348B (en) | A kind of secreting type Sema4C albumen and its application | |
| Wang et al. | A signal on–off strategy based on the digestion of DNA cubes assisted by the CRISPR–Cas12a system for ultrasensitive HBV detection in solid-state nanopores | |
| CN106399316B (en) | The nucleic acid aptamer of Gremlin-1 and its application for identification | |
| CN104988155B (en) | With the human nasopharyngeal carcinoma LMP2A aptamers combined and its biochip of composition | |
| WO2016072464A1 (en) | Arteriosclerosis and cancer detection method using deoxyhypusine synthase gene as indicator | |
| CN112575065B (en) | Detection method based on hybrid chain reaction amplified output signal and detection kit thereof | |
| Moshref et al. | Aptamer-based diagnosis of various SARS-CoV2 strains isolated from clinical specimens | |
| CN107151672A (en) | A kind of recombinant plasmid and application thereof | |
| CN110819632B (en) | Aptamer for binding to trastuzumab | |
| CN103558380B (en) | Method for quickly detecting PP65 based on biochip | |
| CN107058226A (en) | The method of accurate fast Acquisition circulating tumor cell |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20130116 Termination date: 20130609 |