CN104031131B - A kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance - Google Patents

A kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance Download PDF

Info

Publication number
CN104031131B
CN104031131B CN201410227807.9A CN201410227807A CN104031131B CN 104031131 B CN104031131 B CN 104031131B CN 201410227807 A CN201410227807 A CN 201410227807A CN 104031131 B CN104031131 B CN 104031131B
Authority
CN
China
Prior art keywords
sit1
plant
sequence
salt
dna molecular
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201410227807.9A
Other languages
Chinese (zh)
Other versions
CN104031131A (en
Inventor
孙颖
王耕
李晨辉
艾连峰
张胜伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hebei Normal University
Original Assignee
Hebei Normal University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hebei Normal University filed Critical Hebei Normal University
Priority to CN201410227807.9A priority Critical patent/CN104031131B/en
Publication of CN104031131A publication Critical patent/CN104031131A/en
Application granted granted Critical
Publication of CN104031131B publication Critical patent/CN104031131B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance。The invention provides a kind of albumen, be following (a) or (b): the protein that (a) aminoacid sequence shown in sequence in sequence table 3 forms；(b) by the aminoacid sequence shown in sequence in sequence table 3 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and the protein that by sequence 3 derives relevant to plant stress tolerance。The experiment proves that, present invention discover that Oryza sativa L. receptoroid kinase mutant gene SIT1KE, it imports in plant can improve plant salt endurance, and higher than the salt tolerance of wild type SIT1 gene。Prove that this mutant gene has salt tolerance, for improving, crops salt-resistance provides important theoretical foundation and using value。

Description

A kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance
Technical field
The present invention relates to biological technical field, particularly relate to a kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance。
Background technology
Salt stress is the topmost abiotic factor affecting crop yield at present in the world。According to the incomplete statistics of FAO (Food and Agriculture Organization of the United Nation), China's salt-soda soil area accounts for more than the 20% of total cultivated area, and owing to irrigation method is improper and the reason such as scarcity of fresh water resources, this ratio is also in continuous growth。Research crop tolerance to salt mechanism, for increasing crops planting area, improves grain yield and has very important significance。
Plant is when suffering extraneous salt stress, plant can make a series of stress, it is concentrated mainly on ion channel and the gene such as regulator and transcription factor thereof about this report on the one hand at present, such as Zhu Jiankang teaches classical SOS (SaltOverlySensitive) system that laboratory is reported, substantially by three main ingredient SOS1, SOS2, SOS3 are constituted, this system outer row regulating plant Na ion by phosphorylation。Also has the gene family transport protein HKT1 of another kind of classics, oneth HKT albumen is cloned out in Semen Tritici aestivi and finds that this gene can have selective affine sodium ion and potassium ion, but AtHKT1 is but not as Semen Tritici aestivi HKT and equally has higher ion selectivity in arabidopsis, but in participating in adjustment arabidopsis sodium ion equilibrium process on the ground and under ground portion, the OsHKT2.1 identified in Oryza sativa L. is then that the absorption that have adjusted the sodium ion when low potassium in root plays a role。And scientists has identified many all kinds of transcription factor relevant with salt stress in transcription factor, such as some zinc finger proteins, MYB, AP2/ERF, WRKY and NAC class transcription factor be all report several big class transcription factor regulating salt response much more relatively, such as Zat12, ZFP179, ZFP182, the genes such as SNAC1, SNAC2, SERF1。Also having only a few is the kinase whose such as OsSIK1 of the receptoroid about the responsible signal sensing being positioned at cell surface about the report of plant salt endurance, Srlk, AtLecRK2, salt stress signal is through a series of intermediate transfer process, induction downstream stress response gene expression, makes plant produce resistance to reactant salt。Receptor-like kinase is one of gene family the hugest in plant, has become a study hotspot in botany field about the research of this genoid。Receptor-like kinase albumen is mainly made up of three parts: the ectodomain of various structures, membrane-spanning domain and conservative intracellular kinase domain。Difference according to receptor-like kinase ectodomain, receptor-like kinase family is divided into multiple subfamily。After before more than 20 years, first receptor-like kinase is found in Semen Maydis, increasing receptoroid kinases is cloned out, and be proved to take part in from growth and development of plants to participating in Response to stress, the not affine process of selfing such as plant, the reception of hormone signal and transmission, the adjustment of growth promoter, the various aspects of the growth and development of plants such as disease resistance response。
Existing result shows that receptoroid kinases probably sensing molecule as the salt stress signal of cell surface plays a role。Therefore, the effect in plant salt tolerance reacts of the research receptor-like kinase, is highly important for illustrating the Salt-resistance mechanism of plant。The discovery of this gene and point mutation form thereof and the research of its function is provided new clue for the mechanism setting forth plant salt endurance and genetic engineering breeding aspect provides new material and using value。
Summary of the invention
It is an object of the present invention to provide a kind of SIT1 mutain and encoding gene thereof。
The SIT1 mutain of the present invention, is following (a) or (b):
A protein that () aminoacid sequence shown in sequence in sequence table 3 forms；
(b) by the aminoacid sequence shown in sequence in sequence table 3 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and the protein that by sequence 3 derives relevant to plant stress tolerance。
The replacement of above-mentioned one or several amino acid residue of process and/or disappearance and/or be added to less than the replacement of 10 amino acid residues and/or disappearance and/or interpolation。
The DNA molecular encoding above-mentioned albumen is also the scope of protection of the invention。
Above-mentioned DNA molecular is the DNA molecular of any one in following (1)-(3):
(1) coding region is the DNA molecular shown in sequence 2 in sequence table；
(2) DNA molecular of albumen relevant to the hybridization of DNA sequence that (1) limits and coding and plant stress tolerance under strict conditions；
(3) DNA sequence limited with (1) at least has 70%, at least has 75%, at least has 80%, at least has 85%, at least has 90%, at least has 95%, at least has 96%, at least has 97%, at least has 98% or at least have 99% homology and the DNA molecular of coding and plant stress tolerance correlative protein。
Above-mentioned stringent condition is as follows: 50 DEG C, at 7% sodium lauryl sulphate (SDS), 0.5MNaPO4Hybridize with in the mixed solution of 1mMEDTA, at 50 DEG C, 2 × SSC, 0.1%SDS rinses；
Also it is the scope of protection of the invention containing the recombinant vector of above-mentioned DNA molecular, expression cassette, transgenic cell line or recombinant bacterium。
Above-mentioned recombinant vector is inserted in expression vector by above-mentioned DNA molecular, obtains expressing the recombinant vector of above-mentioned albumen。
In an embodiment of the present invention, expression vector is pCAMBIA1300-35S::MH carrier, and recombinant vector is that the nucleotide shown in sequence in sequence table 2 is inserted the carrier obtained between XbaI and the BglII double enzyme site of pCAMBIA1300-35S::MH carrier。
PCAMBIA1300-35S::MH carrier is that the DNA molecular shown in sequence 5 is inserted the carrier that BamHI and the EcoRI restriction enzyme site of pCAMBIA1300 carrier obtains。
The primer pair expanding above-mentioned DNA molecular total length or its any fragment is also the scope of protection of the invention。
The application in regulation and control plant stress tolerance of above-mentioned albumen, above-mentioned DNA molecular or above-mentioned recombinant vector, expression cassette, transgenic cell line or recombinant bacterium is also the scope of protection of the invention。
In above-mentioned application, described resistance of reverse is salt tolerance；
Described regulation and control plant stress tolerance is for improving plant stress tolerance；
Described plant is dicotyledon or monocotyledon。
It is a further object to provide a kind of method cultivating transgenic plant。
Method provided by the invention, for the DNA molecular of above-mentioned albumen is imported purpose plant, it is thus achieved that transgenic plant, the resistance of reverse of described transgenic plant is higher than described purpose plant。
In said method, described resistance of reverse is salt tolerance；
Described purpose plant is dicotyledon or monocotyledon。
The experiment proves that, present invention discover that Oryza sativa L. receptoroid kinase mutant gene SIT1KE, it imports in plant can improve plant salt endurance, and higher than the salt tolerance of wild type SIT1 gene。Prove that this mutant gene has salt tolerance, for improving, crops salt-resistance provides important theoretical foundation and using value。
Accompanying drawing explanation
Fig. 1 is the Salt Tolerance Analysis figure of SIT1 arabidopsis overexpression mutant
Detailed description of the invention
The experimental technique used in following embodiment if no special instructions, is conventional method。
Material used in following embodiment, reagent etc., if no special instructions, all commercially obtain。
Embodiment 1, SIT1 mutant gene SIT1KEAnd the structure of over-express vector
1, the acquisition of SIT1 gene
Extract Japanese fine rice leaf RNA, it is template that reverse transcription obtains cDNA, pcr amplification is carried out with primer 5 ' GCTCTAGATGCGGCGTCCCGAGCTAA3 ' and 5 ' GAAGATCTCGCTCGAGGAATGTCA3 ', obtain the PCR primer of 2034bp, through order-checking, there is the nucleotide shown in sequence 1, remove the gene of termination codon for SIT1。
2, SIT1 mutant gene SIT1KEAcquisition
1) process LAN SIT1 gene recombined vector
PCAMBIA1300-35S::MH carrier is that the DNA molecular shown in sequence 5 is inserted the carrier that BamHI and the EcoRI restriction enzyme site of pCAMBIA1300 carrier obtains。
Using cDNA as template, pcr amplification is carried out with 5 ' GCTCTAGATGCGGCGTCCCGAGCTAA3 ' and 5 ' GAAGATCTCGCTCGAGGAATGTCA3 ', obtaining the PCR primer of 2034bp, through order-checking, this PCR primer has sequence 1 from the 1st-2022 nucleotide of 5 ' ends。
By the above-mentioned PCR primer of XbaI and BglII double digestion, the digestion products obtained connects with the pCAMBIA1300-35S::MH carrier through same enzyme action, obtains recombinant vector pCAMBIA1300-35S::SIT1-7M6H, for process LAN SIT1 gene recombined vector。
Through order-checking, this carrier is that from the 1st-2022 nucleotide of 5 ' ends, sequence 1 is inserted the carrier obtained between XbaI and the BglII restriction enzyme site of pCAMBIA1300-35S::MH carrier。
2) SIT1 kinases point mutation carrier
Sequence 1 is the SIT1 of termination codon from the 1st-2022 nucleotide of 5 ' ends。
Gateway method is utilized to be connected into pENTR this fragmentTM/ SD/D-TOPO carrier, obtains recombinant vector pENTRTM/SD/D-TOPO-SIT1。
Design SIT1KEPoint mutation primer, with reference to Transgene point mutation kit method recombinant vector pENTRTM/ SD/D-TOPO-SIT1 produces containing SIT1KERecombinant vector。
SIT1KEPoint mutation primer is as follows:
5'GTGGAGATTGCAGTGGAGAAGGTATCCCACG3' and
5'CCACTGCAATCTCCACTCGGGATACCAGTA3'
With XbaI and BglII double digestion containing SIT1KERecombinant vector, reclaim 2034bp fragment, connect with the carrier pCAMBIA1300-35S::MH through same enzyme action, obtain pCAMBIA1300-35S::SIT1KE-7M6H。Through order-checking, this carrier is that the nucleotide shown in sequence in sequence table 2 is inserted the carrier obtained between XbaI and the BglII double enzyme site of pCAMBIA1300-35S::MH carrier。
In sequence table, the nucleotide shown in sequence 2 is SIT1 mutant gene SIT1KE, the Protein S IT1 of this gene codeKEAminoacid sequence be sequence 3 in sequence table。
In sequence table, the nucleotide shown in sequence 1 is SIT1 gene, and the aminoacid sequence of the Protein S IT1 of this gene code is sequence 4 in sequence table。
The sequence 1 of SIT1 gene sports GAG from 5 ' end 1156-1158 position AAG, obtains the SIT1 shown in sequence 2KE；
The sequence 4 of SIT1 albumen is glutamic acid from the 386th lysine mutation of N ' end, obtains the SIT1 shown in sequence 3KE。
Embodiment 2, mutant gene SIT1KEApplication in improving plant stress tolerance
1, SIT1 is turnedKEThe structure of arabidopsis
The recombiant plasmid pCAMBIA1300-35S::SIT1 that embodiment 1 is obtainedKE-7M6H converts Agrobacterium GV3101, and (extracting plasmid order-checking to identify, plasmid is pCAMBIA1300-35S::SIT1 to obtain the GV3101 containing recombiant plasmidKE-7M6H)。
The genetic transformation of arabidopsis: the deployed conversion medium containing Agrobacterium is poured in sizeable beaker or wide-mouth Cans, will cut arabidopsis (the kind col-0 of arabidopsis of angle fruit and open bud in advance, hereinafter referred to as wildtype Arabidopsis thaliana) the whole aerial parts of recipient plant is all immersed in conversion medium, soaks 5-6min；Take out Arabidopsis plant, by stem, leaf, the unnecessary globule such as take and shake off gently, couch on smooth desktop or stool, it is placed in clean plastic casing Deng globule substantially dry, still the posture couched is maintained, and cover lucifuge insulation, renewal cultivation 16-36h in 22 DEG C of illumination cultivation rooms with black sack；Throw off black bag, arabidopsis is vertically placed again, normally cultivate in 22 DEG C of illumination cultivation rooms；After general growth 2-3 week, angle fruit majority is full, now waters less and nutritional solution as far as possible, promotes seed maturity；After seed maturity, being put in 1.5mlEp pipe, add proper amount of dry drying prescription silica gel, short-term preservation under room temperature, best dry seed of long-term preservation is placed in-70 DEG C of refrigerators, obtains T1 for turning SIT1KEArabidopsis seed。
Extract T1 for turning SIT1KEArabidopsis leaf genomic DNA, carries out pcr amplification with 5 '-ATGCGGCGTCCCGAGCTAA-3 ' and 5 '-CGCTCGAGGAATGTCA-3 ', and what obtain 2022bp turns SIT1 for positive T1 generationKEArabidopsis。
In sowing positive T1 generation, turns SIT1KEArabidopsis goes down to posterity, until obtaining T3 generation to turn SIT1KEArabidopsis。T3 utilizes c-MYC antibody (sigma) to detect SIT1 for pure and mild plant by westernblotKEThe expression of-MYC fusion protein。
Adopting same method to proceed in arabidopsis by pCAMBIA1300-35S::SIT1-7M6H, cultivating until obtaining T3 generation to turn SIT1 arabidopsis。
2、SIT1KEApplication in improving Salt Resistance of Rice
In T3 generation, is turned SIT1KEArabidopsis strain 4#, 9# cultivate in the 1/2MS culture medium containing 100mMNaCl, turn SIT1 arabidopsis for comparison with wildtype Arabidopsis thaliana Col and T3 generation。Experiment repeats 3 times, results averaged。
Result is as it is shown in figure 1, A figure is phenotypic map, and B figure is survival rate cartogram, and wherein, SIT1 turns SIT1 arabidopsis, SIT1 in T3 generationKE9 and SIT1KE4 turn SIT1 for T3 generationKEArabidopsis strain, col are wildtype Arabidopsis thaliana；It can be seen that
Under normal operation, each strain is without significant difference；
Under 100mMNaCl coerces, compared with turning SIT1 arabidopsis with wildtype Arabidopsis thaliana and T3 generation, point mutation SIT1DAIn T3 generation, turns SIT1KEArabidopsis SIT1KE9 and SIT1KE4 all show obvious salt tolerant resistance, turn SIT1KEThe survival rate (being more than 95%) of arabidopsis, higher than wild-type plant (about 85%), is significantly larger than T3 for turning SIT1 arabidopsis SIT1。
The above results shows, SIT1KEPlant salt can be improved, in plant salt endurance, play Pasitive Regulation Effect of Genseng。

Claims (7)

1. an albumen, the protein that the aminoacid sequence shown in sequence in sequence table 3 forms。
2. the DNA molecular of albumen described in coding claim 1。
3. DNA molecular as claimed in claim 2, it is characterised in that: described DNA molecular is coding region is the DNA molecular shown in sequence 2 in sequence table。
4. contain the recombinant vector of DNA molecular described in Claims 2 or 3, expression cassette or recombinant bacterium。
5. recombinant vector as claimed in claim 4, it is characterised in that:
Described recombinant vector, for being inserted in expression vector by DNA molecular described in Claims 2 or 3, obtains expressing the recombinant vector of albumen described in claim 1。
6. DNA molecular described in albumen, Claims 2 or 3 described in claim 1 or the application in regulation and control plant stress tolerance of recombinant vector, expression cassette or recombinant bacterium described in claim 4；Described resistance of reverse is salt tolerance；
Described regulation and control plant stress tolerance is for improving plant stress tolerance；
Described plant is dicotyledon。
7. the method cultivating transgenic plant, for importing purpose plant by the DNA molecular of albumen described in coding claim 1, it is thus achieved that transgenic plant, the resistance of reverse of described transgenic plant is higher than described purpose plant；Described resistance of reverse is salt tolerance；Described purpose plant is dicotyledon。
CN201410227807.9A 2014-05-27 2014-05-27 A kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance Expired - Fee Related CN104031131B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410227807.9A CN104031131B (en) 2014-05-27 2014-05-27 A kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410227807.9A CN104031131B (en) 2014-05-27 2014-05-27 A kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance

Publications (2)

Publication Number Publication Date
CN104031131A CN104031131A (en) 2014-09-10
CN104031131B true CN104031131B (en) 2016-06-22

Family

ID=51462147

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410227807.9A Expired - Fee Related CN104031131B (en) 2014-05-27 2014-05-27 A kind of SIT1 mutain and encoding gene thereof and its application in plant stress tolerance

Country Status (1)

Country Link
CN (1) CN104031131B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102140443A (en) * 2010-02-03 2011-08-03 中国科学院遗传与发育生物学研究所 Plant stress-resistant associated protein, and encoding gene and application thereof
CN103305485A (en) * 2012-03-13 2013-09-18 中国农业科学院作物科学研究所 Plant stress tolerance related protein W106 and coding gene as well as application thereof

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102140443A (en) * 2010-02-03 2011-08-03 中国科学院遗传与发育生物学研究所 Plant stress-resistant associated protein, and encoding gene and application thereof
CN103305485A (en) * 2012-03-13 2013-09-18 中国农业科学院作物科学研究所 Plant stress tolerance related protein W106 and coding gene as well as application thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
NP_001047547.1;Takana,T等;《Genbank》;20100608 *
植物凝集素类受体激酶的研究进展;王育等;《生命科学研究》;20120630;第16卷(第3期);第266-271页 *

Also Published As

Publication number Publication date
CN104031131A (en) 2014-09-10

Similar Documents

Publication Publication Date Title
CN101855355B (en) There is the plant of the Correlated Yield Characters of raising and the method for preparing this plant
CN109456982B (en) Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance
Lopez et al. Accumulation of a 22‐kDa protein and its mRNA in the leaves of Raphanus sativus in response to salt stress or water deficit
CN105746255B (en) The purposes of herbicide tolerant protein
CN105802933A (en) Herbicide tolerance protein and coding gene and application thereof
MX2010013622A (en) Plants having enhanced yield-related traits and a method for making the same.
CN103719136A (en) Pest control method
CN104480121B (en) Control ZmCLA1 genes and its method in the seed selection type of resistance to more seedlings corn and the application of maize leaves corner dimension
CN105724139B (en) The purposes of herbicide tolerant protein
CN103718896A (en) Method for controlling pests
CN102459615B (en) Drought tolerant plants
CN110643618A (en) Jatropha curcas MYB transcription factor JcMYB16 gene and application thereof in improving drought resistance of plants
CN103719137A (en) Pest control method
CN105766992A (en) Application of protein having tolerance to herbicides
CN105724140B (en) The purposes of herbicide tolerant protein
US7786346B2 (en) Generation of plants with improved drought tolerance
CN101809155A (en) Transgenic plants with increased stress tolerance and yield
CN105017395B (en) A kind of rubber tree blooms modulin HbTFL1-2 and its encoding gene and application
CN104293802A (en) Lotus japonicus ERF transcription factors as well as encoding gent, expression vector and application thereof
CN104610439B (en) Protein, its encoding gene and the purposes related to abiotic stress reaction
US7754945B2 (en) Generation of plants with improved drought tolerance
CN104313033A (en) Lotis corniculatus L. stress resistance related transcription factor and coding gene and application thereof
JP2009540822A (en) Use of plant chromatin remodeling genes to regulate plant structure and growth
CN105037518B (en) A kind of rubber tree blooms modulin HbTFL1 3 and its encoding gene and application
CN106755062A (en) Use the method for transformation of sulfonylurea herbicide hydrolase gene alternatively label

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20160622

Termination date: 20200527

CF01 Termination of patent right due to non-payment of annual fee