CN104017827A - Lentiviral plasmid expression vector as well as construction method and application of lentiviral plasmid expression vector - Google Patents
Lentiviral plasmid expression vector as well as construction method and application of lentiviral plasmid expression vector Download PDFInfo
- Publication number
- CN104017827A CN104017827A CN201410135044.5A CN201410135044A CN104017827A CN 104017827 A CN104017827 A CN 104017827A CN 201410135044 A CN201410135044 A CN 201410135044A CN 104017827 A CN104017827 A CN 104017827A
- Authority
- CN
- China
- Prior art keywords
- musk
- cell
- add
- serum
- expression vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Abstract
The invention discloses a lentiviral plasmid expression vector as well as a construction method and an application of the lentiviral plasmid expression vector. The lentiviral plasmid expression vector is pCDH-MCS-MuSK-GFP and the nucleotide sequence of the lentiviral plasmid expression vector is shown in SEQ ID NO. 2 in a sequence table. The invention further discloses an application of the lentiviral plasmid expression vector in construction of an anti-muscle-specific receptor tyrosine kinase antibody detection. According to the invention, a stable transfected cell line of MuSK is established by constructing a viral vector, a MuSK antibody is qualitatively and quantitatively detected clinically by an immunofluorescence staining method with relatively high sensitivity and specificity in combination with a flow cytometry, the detection results are more stable and manpower and time costs are greatly saved. The diagnosis and treatment levels of myasthenia gravis are greatly improved by the establishment of the project, the labor capacity and life quality of patients are improved and the lentiviral plasmid expression vector has significant social and economic benefits.
Description
Technical field
The present invention relates to a kind of slow virus plasmid expression vector and construction process and application, specifically slow virus plasmid expression vector and construction process thereof and the application in the antibody test of structure anti-muscle specific receptor tyrosine kinase (muscle specific kinase, MuSK).
Background technology
Disease myasthenia (Myasthenia gravis, MG) be a kind of by antibody-mediated, mainly involve neuromuscular junction postsynaptic membrane acetylcholine receptor (acytylcholine receptor, AchR), cause the autoimmune disorder of neuromuscular transmission obstacle.Its Clinical symptoms is part or whole body skeletal muscle fatiguability, is fluctuation myasthenia, has in activity postemphasis, after having a rest, alleviate and light dusk in morning the feature such as heavily.Along with improving constantly and the variation of the factor such as people's living environment of medical diagnosis level, the sickness rate of MG is the trend raising gradually, and therefore, Early Identification is diagnosed instructing treatment and the evaluate its prognosis of two kinds of diseases extremely important.
Myasthenia gravis is obscured because of feature and easy disease similar to other that its symptom has fluctuation, is difficult point medically so diagnose always.The detection of serum specific antibody is significant at the aspect such as diagnosis and study of incident mechanism of MG.The pathogenesis that studies have shown that MG may combine with AChR for the AChR-Ab producing in body, under complement participates in, replys with AChR.Cause that on the one hand cytolemma dissolves, make AChR considerable damage; Can make on the one hand the AChR on film surface crosslinked, increase the catagen speed of AChR.But AChR-Ab can not be detected in approximately 20% Patients With Myasthenia Gravis body.Research finds, 50%AChR-Ab negative patient serum IgG can be combined with muscle specific TE671 cell strain, and not with express people's blastaea nephrocyte (human embryonic kidney cells, HEK293) combination of AChR.Although AChR-Ab negative patient serum can suppress the function of TE671 cell strain AChR, in these serum, the number of AChR does not reduce.That these prove the combination of AChR-Ab negative patient serum IgG antibody is not AChR, but has close ties with AChR, can regulate the myoprotein of AChR, and prove anti-muscle specific receptor tyrosine kinase (muscle specific kinase, MuSK).The direct combination of extracellular section of MuSK-Ab and MuSK, suppresses the AChRs of aggegation albumen (Agrin) mediation in growing in the gathering of synapse cell caudacoria.Although it is also indefinite that these antibody cause amyasthenic mechanism in vivo, the appearance of MuSK-Ab has defined one group of AChR-Ab negative patient subgroup.In the negative MG patients serum of 40%-70%AChR-Ab, contain anti-muscle specific receptor tyrosine kinase antibody.So now negative AChR-Ab MG is divided into again to two portions, the one, the MuSK-Ab positive; The 2nd, AChR-Ab and MuSK-Ab are all negative, also referred to as the negative myasthenia gravis of serum antibody (seronegative myasthenia gravis, SNMG).The discovery of MuSK-Ab, contributes to further to study the pathogenesis of MG and sums up Clinical symptoms.
Mostly the patient of MuSK antibody positive, be that women and middle hair style morning (age of onset is less than 40 years old person) account for 70%, and clinical symptom shows as oblongata myasthenia more, facial muscle is unable, along with myasthenic crisis easily appears in the development of the state of an illness, and facial muscle atrophy.How normal thymus region histology is or slightly undesired, and thymusectomy is to the positive MG patient's curative effect of MuSK-Ab nonsignificance.MG patient is conventionally to anticholinesterase drug thing weak curative effect for the MuSK-Ab positive, traditional immunosuppressant therapy Low Response.MuSK-Ab can only detect in the MG of AChR-Ab feminine gender patients serum, is not present in the serum of the positive MG of AChR-Ab, and can not detects in the patients serum of other muscle relative diseases.MuSK antibody is to have specificly in the appearance of the negative MG of AChR-Ab, has diagnostic significance detecting in AChR-Ab negative patient.And China is not enough to the feature understanding of the positive MG of MuSK-Ab at present, the detection of MuSK-Ab is still located to blank.
The technology that detects in the world at present MuSK antibody mainly contains indirect immunofluorescence (Indirect Immunofluorescence, IIF), the fluorescence immunoassay precipitator method (Fluoroimmunoprecipitation Assay, FIPA), radioimmunoprecipitation (Radioimmunoprecipitation Assay, RIPA), fluorescence immunoassay cell dyeing method (Cell-Based fluorescent immunostaining Assay, and enzyme-linked immunosorbent assay (Enzyme-Linked ImmunoSorbent Assay, ELISA) CBA).ELISA is the method for commonly using, but its susceptibility and specificity are not high; Although RIPA susceptibility and specificity are high, because of the disadvantageous effect of radioactive material confrontation environment etc., its application is restricted; At present ideal with susceptibility and the specificity of CBA and FIPA.But the CBA method average detected cycle is super, and fluorescence efficiency is unstable two days later, and need artificial observation, waste time and energy, and may increase the personal errors in detection; FIPA method relates to isotopic application equally, and environmental hazard increases greatly.In addition, utilize CBA and FIPA to do scientific research for the domestic current a few studies person of detection of MuSK autoantibody, not yet routine is applied to clinically, and therefore which kind of method waits to illustrate as " gold standard " recommended detection that is applied to clinical MuSK antibody.
Summary of the invention
The object of this invention is to provide a kind of slow virus plasmid expression vector and construction process and application.The present invention builds in conjunction with virus vector, transfection, and fluorescence immunization coloration and flow cytometry technology, be mainly used in myasthenia gravis Clinical differential diagnosis, improves myasthenia gravis diagnostic level; Can assist the index as medication curative effect, state of illness monitoring, recurrence prediction; The invention provides a kind of detection method of anti-muscle specific receptor tyrosine kinase autoantibody, can overcome the defect of prior art.Multiple clone site district by the cDNA full-length clone of people MuSK isoform 2 to double expression(DE) lentiviral vectors pCDH-CMV-MCS-EF1-CopGFP, packaging virus, with virus infection 293T cell, the cell of airflow classification stable transfection, obtain the clone of stably express MuSK and GFP, adopt the immunofluorescent staining that sensitivity and specificity are higher to be used for clinical qualitative and quantitative analysis MuSK-Ab in conjunction with fluidic cell detection technique.The foundation of MuSK-Ab detection platform can provide basis for the mechanism of causing a disease of further studying MuSK antibody.
The following technology contents that has been disclosure of the invention for achieving the above object:
An object of the present invention is to provide a kind of slow virus plasmid expression vector, it is characterized in that described slow virus plasmid expression vector is pCDH-MCS-MuSK-GFP, its nucleotide sequence is if sequence table is as shown in SEQ ID NO.2.
Another object of the present invention is to provide a kind of construction process of slow virus plasmid expression vector, the step that it comprises:
1) vector construction:
Taking people's muscle tissue cDNA as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR 5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences, in sequence table, shown in SEQ ID NO.1, concrete steps are as follows:
In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, Taq archaeal dna polymerase 0.5 μ l, the about 5U/ μ of final concentration l, ddH
2it is 50 μ l that O mends final volume.The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times, to guarantee abundant extension.
2) application glue reclaims after test kit is cut glue recovery (Axygen company) to amplified fragments and is connected into T carrier, after order-checking aligned sequences is correct, is used NheI and NotI double digestion.Concrete steps are as follows:
Add DNA 1 μ g and corresponding restriction enzyme NheI and NotI 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid.Mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete.After having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply.Control voltage and remain on 60-80V, electric current, more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stops electrophoresis, and ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size.After qualification is correct, with the pCDH-MCS-MCS-EF1-copGFP plasmid vector after NotI double digestion (Shanghai Ji Kai gene company limited) is connected through NheI, obtain expression MuSK used and the slow virus plasmid vector of GFP: pCDH-MCS-MuSK-GFP.The complete sequence of the virus vector building is as shown in SEQ ID NO.2 in sequence table.The complete sequence of the virus vector building:
acgcgtgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacaataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacctgaaagcgaaagggaaaccagagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccactgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcctcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagattggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggttaacttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttatcgatactagtattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagattctagagctagcatgagagagctcgtcaacattccactggtacatattcttactctggttgccttcagcggaactgagaaacttccaaaagctcctgtcatcaccactcctcttgaaacagtggatgccttagttgaagaagtggctactttcatgtgtgcagtggaatcctacccccagcctgagatttcctggactagaaataaaattctcattaaactctttgacacccggtacagcatccgggagaatgggcagctcctcaccatcctgagtgtggaagacagtgatgatggcatttactgctgcacggccaacaatggtgtgggaggagctgtggagagttgtggagccctgcaagtgaagatgaaacctaaaataactcgtcctcccataaatgtgaaaataatagagggattaaaagcagtcctaccatgtactacaatgggtaatcccaaaccatcagtgtcttggataaagggagacagccctctcagggaaaattcccgaattgcagttcttgaatctgggagcttgaggattcataacgtacaaaaggaagatgcaggacagtatcgatgtgtggcaaaaaacagcctcgggacagcatattccaaagtggtgaagctggaagttgaggaagaaagtgaacccgaacaagatactaaagtttttgccaggatcctgcgggctcctgaatcccacaatgtcacctttggctcctttgtgaccctgcactgtacagcaacaggcattcctgtccccaccatcacctggattgaaaacggaaatgctgtttcttctgggtccattcaagagagtgtgaaagaccgagtgattgactcaagactgcagctgtttatcaccaagccaggactctacacatgcatagctaccaataagcatggggagaagttcagtactgccaaggctgcagccaccatcagcatagcagaatggagagagtactgcttggcagtaaaggagctcttctgcgcaaaagaatggctggtaatggaagagaagacccacagaggactctacagatccgagatgcatttgctgtccgtgccagaatgcagcaagcttcccagcatgcattgggaccccacggcctgtgccagactgccacatctagcattcccaccaatgacgtcctcaaagccaagtgtggacattccaaatctgccttcctcctcctcttcttccttctctgtctcacctacatactccatgactgtaataatctccatcatgtccagctttgcaatatttgtgcttcttaccataactactctctattgctgccgaagaagaaaacaatggaaaaataagaaaagagaatcagcagcagtaaccctcaccacactgccttctgagctcttactagatagacttcatcccaaccccatgtaccagaggatgccgctccttctgaaccccaaattgctcagcctggagtatccaaggaataacattgaatatgtgagagacatcggagagggagcgtttggaagggtgtttcaagcaagggcaccaggcttacttccctatgaacctttcactatggtggcagtaaagatgctcaaagaagaagcctcggcagatatgcaagcggactttcagagggaggcagccctcatggcagaatttgacaaccctaacattgtgaagctattaggagtgtgtgctgtcgggaagccaatgtgcctgctctttgaatacatggcctatggtgacctcaatgagttcctccgcagcatgtcccctcacaccgtgtgcagcctcagtcacagtgacttgtctatgagggctcaggtctccagccctgggcccccacccctctcctgtgctgagcagctttgcattgccaggcaggtggcagctggcatggcttacctctcagaacgtaagtttgttcaccgagatttagccaccaggaactgcctggtgggcgagaacatggtggtgaaaattgccgactttggcctctccaggaacatctactcagcagactactacaaagctaatgaaaacgacgctatccctatccgttggatgccaccagagtccattttttataaccgctacactacagagtctgatgtgtgggcctatggcgtggtcctctgggagatcttctcctatggcctgcagccctactatgggatggcccatgaggaggtcatttactacgtgcgagatggcaacatcctctcctgccctgagaactgccccgtggagctgtacaatctcatgcgtctatgttggagcaagctgcctgcagacagacccagtttcaccagtattcaccgaattctggaacgcatgtgtgagagggcagagggaactgtgagtgtctaagcggccgcaaggatctgcgatcgctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcgcatctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttacagatccaagctgtgaccggcgcctacgctagacgccaccatggagagcgacgagagcggcctgcccgccatggagatcgagtgccgcatcaccggcaccctgaacggcgtggagttcgagctggtgggcggcggagagggcacccccaagcagggccgcatgaccaacaagatgaagagcaccaaaggcgccctgaccttcagcccctacctgctgagccacgtgatgggctacggcttctaccacttcggcacctaccccagcggctacgagaaccccttcctgcacgccatcaacaacggcggctacaccaacacccgcatcgagaagtacgaggacggcggcgtgctgcacgtgagcttcagctaccgctacgaggccggccgcgtgatcggcgacttcaaggtggtgggcaccggcttccccgaggacagcgtgatcttcaccgacaagatcatccgcagcaacgccaccgtggagcacctgcaccccatgggcgataacgtgctggtgggcagcttcgcccgcaccttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacatgcacttcaagagcgccatccaccccagcatcctgcagaacgggggccccatgttcgccttccgccgcgtggaggagctgcacagcaacaccgagctgggcatcgtggagtaccagcacgccttcaagacccccatcgccttcgccagatcccgcgctcagtcgtccaattctgccgtggacggcaccgccggacccggctccaccggatctcgctaagtcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaaaataagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagacttttgcagagacggcccaaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagctg。
Further object of the present invention is to provide slow virus plasmid expression vector in the application for the preparation of building anti-muscle specific receptor tyrosine kinase (muscle specific kinase, MuSK) antibody test aspect.The step that wherein detection of anti-muscle specific receptor tyrosine kinase antibody comprises:
1) utilize CaCl
2method virus packaging expression MuSK-GFP(pCDH-MCS-Musk-EF1-copGFP) slow virus of fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, after 1 week, the positive stable transfected cells of sorting.Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection, culture condition: 37 DEG C, containing the HEK293 cell of the DMEM culture medium culturing transfection stably express fusion rotein of 10% foetal calf serum;
Concrete steps: in the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize the slow virus of CaCl2 method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and in the situation that 6 μ g/ml Polybrene exist, infect HEK293 cell, cultivate 14 hours, within second day, change perfect medium into for 37 DEG C, after 1 week, the positive stable transfected cells of flow cytometry sorting; Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection;
2) Flow Cytometry Assay serum Musk antibody:
Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, collect the HEK293 cell of transfection and untransfected, mix in the ratio of 1:1, add up to 5 × 105, clean 1 time with streaming staining damping fluid (1 × PBS containing 3% horse serum and 0.02% sodium azide NaN3), centrifugal rear supernatant discarded, the serum diluting with 100 μ l or people Ig contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample, in addition, Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration,
3) cellular immunofluorescence method is measured serum Musk antibody, specific experiment procedure:
HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution;
To be measured group of serum thaws, examine the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times.
4) statistical study: use GraphPad Prism 4 to draw and statistical study to data.
By the nucleotide sequence shown in SEQ ID NO.1 in people MuSK isoform 2(sequence table) cDNA full-length clone to the multiple clone site district of double expression(DE) lentiviral vectors pCDH-CMV-MCS-EF1-CopGFP, packaging virus, with virus infection 293T cell, the cell of airflow classification stable transfection, obtain the clone of stably express MuSK and GFP, adopt the immunofluorescent staining that sensitivity and specificity are higher to be used for clinical qualitative and quantitative analysis MuSK-Ab in conjunction with fluidic cell detection technique.
Musk isoform 2 sequences (nucleotide sequence shown in SEQ ID NO.1):
atgagagagctcgtcaacattccactggtacatattcttactctggttgccttcagcggaactgagaaacttccaaaagctcctgtcatcaccactcctcttgaaacagtggatgccttagttgaagaagtggctactttcatgtgtgcagtggaatcctacccccagcctgagatttcctggactagaaataaaattctcattaaactctttgacacccggtacagcatccgggagaatgggcagctcctcaccatcctgagtgtggaagacagtgatgatggcatttactgctgcacggccaacaatggtgtgggaggagctgtggagagttgtggagccctgcaagtgaagatgaaacctaaaataactcgtcctcccataaatgtgaaaataatagagggattaaaagcagtcctaccatgtactacaatgggtaatcccaaaccatcagtgtcttggataaagggagacagccctctcagggaaaattcccgaattgcagttcttgaatctgggagcttgaggattcataacgtacaaaaggaagatgcaggacagtatcgatgtgtggcaaaaaacagcctcgggacagcatattccaaagtggtgaagctggaagttgaggaagaaagtgaacccgaacaagatactaaagtttttgccaggatcctgcgggctcctgaatcccacaatgtcacctttggctcctttgtgaccctgcactgtacagcaacaggcattcctgtccccaccatcacctggattgaaaacggaaatgctgtttcttctgggtccattcaagagagtgtgaaagaccgagtgattgactcaagactgcagctgtttatcaccaagccaggactctacacatgcatagctaccaataagcatggggagaagttcagtactgccaaggctgcagccaccatcagcatagcagaatggagagagtactgcttggcagtaaaggagctcttctgcgcaaaagaatggctggtaatggaagagaagacccacagaggactctacagatccgagatgcatttgctgtccgtgccagaatgcagcaagcttcccagcatgcattgggaccccacggcctgtgccagactgccacatctagcattcccaccaatgacgtcctcaaagccaagtgtggacattccaaatctgccttcctcctcctcttcttccttctctgtctcacctacatactccatgactgtaataatctccatcatgtccagctttgcaatatttgtgcttcttaccataactactctctattgctgccgaagaagaaaacaatggaaaaataagaaaagagaatcagcagcagtaaccctcaccacactgccttctgagctcttactagatagacttcatcccaaccccatgtaccagaggatgccgctccttctgaaccccaaattgctcagcctggagtatccaaggaataacattgaatatgtgagagacatcggagagggagcgtttggaagggtgtttcaagcaagggcaccaggcttacttccctatgaacctttcactatggtggcagtaaagatgctcaaagaagaagcctcggcagatatgcaagcggactttcagagggaggcagccctcatggcagaatttgacaaccctaacattgtgaagctattaggagtgtgtgctgtcgggaagccaatgtgcctgctctttgaatacatggcctatggtgacctcaatgagttcctccgcagcatgtcccctcacaccgtgtgcagcctcagtcacagtgacttgtctatgagggctcaggtctccagccctgggcccccacccctctcctgtgctgagcagctttgcattgccaggcaggtggcagctggcatggcttacctctcagaacgtaagtttgttcaccgagatttagccaccaggaactgcctggtgggcgagaacatggtggtgaaaattgccgactttggcctctccaggaacatctactcagcagactactacaaagctaatgaaaacgacgctatccctatccgttggatgccaccagagtccattttttataaccgctacactacagagtctgatgtgtgggcctatggcgtggtcctctgggagatcttctcctatggcctgcagccctactatgggatggcccatgaggaggtcatttactacgtgcgagatggcaacatcctctcctgccctgagaactgccccgtggagctgtacaatctcatgcgtctatgttggagcaagctgcctgcagacagacccagtttcaccagtattcaccgaattctggaacgcatgtgtgagagggcagagggaactgtgagtgtctaa
The present invention sets up the clone of stable transfection MuSK by building virus vector, adopt sensitivity and the higher fluorescence immunoassay cell dyeing of specificity in conjunction with fluidic cell detection technique, for clinical qualitative and quantitative analysis MuSK antibody, make detected result more stable, and greatly save manpower and time cost.The foundation of the platform of MuSK antibody test technology, for the mechanism of causing a disease of further studying MuSK antibody provides basis, is conducive to improve the clinic diagnosis level of myasthenia gravis.The Case definition having on the detection technique basis of international endorsement will be beneficial to further internal and international cooperation, improve the city at home with impact and the status of international central nervous system demyelination diagnosis and treatment aspect.The foundation of this project will greatly improve the treatment level of myasthenia gravis, improves patient's work capacity and quality of life, will produce very large Social benefit and economic benefit.
Brief description of the drawings
Fig. 1 MuSK virus particle collection of illustrative plates;
MuSK gene expression dose schematic diagram after Fig. 2 HEK293 cell infection MuSK virus expression carrier;
MuSK protein expression level schematic diagram after Fig. 3 HEK293 cell infection MuSK virus expression carrier;
Fig. 4 Flow cytometry serum to be checked: gray shade represents MuSK (-) serum specimen, grey solid line represents MuSK (+) serum specimen, solid black lines represents MuSK strong positive serum specimen;
Fig. 5 Flow cytometry serum to be checked, feminine gender, the positive and strong positive MuSK express quantitative analysis;
Fig. 6 streaming detects myasthenia gravis (MG) group serum MuSK antibody expression level in conjunction with cellular immunofluorescence method and traditional C BA method;
Fig. 7 streaming detects the myasthenia gravis (AchR-Ab of acetylcholine receptor antibodies feminine gender in conjunction with cellular immunofluorescence method and traditional C BA method
-mG) group serum MuSK antibody expression level.
Embodiment
Following examples will contribute to understand the present invention, but can not limit content of the present invention.The experimental technique of unreceipted actual conditions in embodiment, conventionally according to the condition described in normal condition and handbook, or the condition of advising according to manufacturer.
Embodiment 1
A kind of slow virus plasmid expression vector is pCDH-MCS-MuSK-GFP, and its nucleotide sequence is if sequence table is as shown in SEQ ID NO.2, and its construction process is undertaken by following step:
1) vector construction: taking people's muscle tissue cDNA as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR 5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences, in sequence table, shown in SEQ ID NO.1, concrete steps are as follows:
In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, Taq archaeal dna polymerase 0.5 μ l, the about 5U/ μ of final concentration l, ddH
2it is 50 μ l that O mends final volume; The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times, to guarantee abundant extension;
2) application glue reclaims test kit amplified fragments is cut to glue recovery; After be connected into T carrier, after order-checking aligned sequences is correct, used NheI and NotI double digestion, concrete steps are as follows:
Add DNA 1 μ g and corresponding restriction enzyme NheI and NotI 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid; Mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete, after having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply, controls voltage and remains on 60-80V, electric current is more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stop electrophoresis, ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size, after qualification is correct, with the pCDH-after NheI and NotI double digestion
mCS-MCS-EF1-copGFP plasmid vector is connected, and obtains expression MuSK used and the slow virus plasmid vector of GFP: pCDH-MCS-MuSK-GFP.
Embodiment 2
Build the application of anti-muscle specific receptor tyrosine kinase antibody test, it is made up of following step:
1) utilize CaCl
2method virus packaging expression MuSK-GFP(pCDH-MCS-Musk-EF1-copGFP) slow virus of fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, after 1 week, the positive stable transfected cells of sorting.Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection, culture condition: 37 DEG C, containing the HEK293 cell of the DMEM culture medium culturing transfection stably express fusion rotein of 10% foetal calf serum;
Concrete steps: in the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize the slow virus of CaCl2 method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and in the situation that 6 μ g/ml Polybrene exist, infect HEK293 cell, cultivate 14 hours, within second day, change perfect medium into for 37 DEG C, after 1 week, the positive stable transfected cells of flow cytometry sorting; Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection;
2) Flow Cytometry Assay serum Musk antibody:
Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, collect the HEK293 cell of transfection and untransfected, mix in the ratio of 1:1, add up to 5 × 105, clean 1 time with streaming staining damping fluid (1 × PBS containing 3% horse serum and 0.02% sodium azide NaN3), centrifugal rear supernatant discarded, the serum diluting with 100 μ l or people Ig contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample, in addition, Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration,
3) cellular immunofluorescence method is measured serum Musk antibody, specific experiment procedure:
HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution;
To be measured group of serum thaws, examine the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times.
4) statistical study: use GraphPad Prism 4 to draw and statistical study to data.
Embodiment 3
Practical situations:
The present invention selects positive Patients With Myasthenia Gravis 127 examples of AchR at random, age 13-80 year, the male sex's 30 examples, women's 37 examples; Negative Patients With Myasthenia Gravis 103 examples of AchR, age 13-80 year, the male sex's 56 examples, women's 71 examples.Derive from the Patients With Myasthenia Gravis of making a definite diagnosis in General Hospital of Tianjin Medical Univ.'s Neurology Clinic and ward for 2008 to 2013.The most important diagnosis basis of myasthenia gravis is that the fatigable inspection of patient's past medical history, clinical manifestation and fluctuation is found, particularly has the performance of getting involved of extraocular muscle and oblongata flesh.Patient that we include in all shows the muscular fatigue of ill fluctuation, and at least meets a Case definition below:
1) test of anticholinesterase medicine-prostigmin(e) is drawn obvious muscular strength and is improved;
2) the neural repetitive nerve stimulation kinematic waves of low frequency width amplitude decay >15%;
3) there is abnormal trembling and block in SFEMG inspection.Control group is 20 routine physical examination of healthy populations, age 20-60 year, and the 10 routine male sex, 10 routine women, age, sex all match with test serum.
Human Embryonic Kidney HEK 293 cells (commercially available) are preserved by this laboratory, transfection reagent is purchased from Invitrogen, competent cell is purchased from Tiangen company, the quick little extraction reagent kit of plasmid extraction kit plasmid is purchased from Tiangen company, the fast middle extraction reagent kit of plasmid is purchased from Biodev company, plasmid rapid, high volume extracts test kit purchased from Tiangen, Biodec company, DMEM substratum (high sugar, contain penicillin and streptomycin) purchased from Solarbia company, trypsinase is purchased from Solarbia company, and foetal calf serum (FCS) is purchased from GIBCO company.
Double expression(DE) lentiviral vectors pCDH-MCS-MCS-EF1-copGFP is purchased from Shanghai Ji Kai gene company limited
1, vector construction:
Taking people's muscle tissue cDNA(people muscle tissue) as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR:5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences (in sequence table shown in SEQ ID NO.1), concrete steps are as follows:
In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, (l), it is 50 μ l that ddH2O mends final volume to the about 5U/ μ of final concentration to Taq archaeal dna polymerase 0.5 μ l.The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times.To guarantee abundant extension.
2) application glue reclaims after test kit is cut glue recovery (Axygen company) to amplified fragments and is connected into T carrier, after order-checking aligned sequences is correct, is used NheI and NotI double digestion.Concrete steps are as follows: add DNA 1 μ g and corresponding restriction enzyme (NheI and NotI) 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid.Mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete.After having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply.Control voltage and remain on 60-80V, electric current, more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stops electrophoresis, and ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size.After qualification is correct, with the pCDH-MCS-MCS-EF1-copGFP plasmid vector after NotI double digestion is connected through NheI, obtain expression MuSK used and the slow virus plasmid expression vector of GFP.The complete sequence of the virus vector building (in sequence table shown in SEQ ID NO.2).Slow virus plasmid expression vector: pCDH-MCS-MuSK-GFP.
2, the acquisition of virus packaging and HEK293 stably transfected cell line
Clone and cultivation thereof: Human Embryonic Kidney HEK 293 clones are by this chamber cellar culture.Cell is placed in the DMEM substratum that contains 10% inactivated fetal bovine serum, puts into 37 DEG C, 5% CO
2incubator, cultivates according to a conventional method, gets cell in logarithmic phase for experiment.
The recovery of cell and going down to posterity: add 20mL DMEM substratum in advance in 50ml centrifuge tube, from liquid nitrogen container take out that frozen cell drops into rapidly 37oC water-bath and constantly shake it is thawed within the shortest time, with after 70% alcohol disinfecting cryopreservation tube appearance, cell is stored to liquid and be transferred in above-mentioned centrifuge tube, centrifugal 10 minutes of 1000rmp.Abandon supernatant, re-suspended cell is placed in the DMEM substratum containing 10% foetal calf serum, 37 ° of C, 5%CO
2, cultivate under saturated humidity.
In the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize the slow virus (pCDH-MCS-Musk-EF1-copGFP) of CaCl2 method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, 37 DEG C of overnight incubation (14 hours), change perfect medium for second day into, after 1 week, the positive stable transfected cells of flow cytometry sorting.Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection.
3, in conjunction with flow cytometry, (FlowCytometry, FCM are shown in document Nat Methods. 2013 Mar in conjunction with flow cytometry principle of operation to immunofluorescent staining method; 10 (3): 228-38.) measure serum MuSK antibody:
Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, the HEK293 cell of collection transfection and untransfected, mixes in the ratio of 1:1, adds up to 5 × 10
5, with streaming staining damping fluid, (1 × PBS is containing 3% horse serum and 0.02% sodium azide NaN
3) clean 1 time, centrifugal rear supernatant discarded, the serum diluting with 100 μ l or human normal immunoglobulin contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample.In addition, the Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration.
4, cellular immunofluorescence method is measured serum MuSK antibody:
HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution.
To be measured group of serum thaws, examine the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times.
5, statistical study: use GraphPad Prism 4 to draw and statistical study to data.
6, result
Transfection efficiency and the Subcellular Localization of MuSK plasmid DNA transfection HEK293 cell: DAPI dyes the capable Subcellular Localization of core and shows, nuclei dyeing is blue, and the main epi-position of MuSK antigen protein of HEK293 cell expressing is on cytolemma.
Cellular immunofluorescence is 9.1% (21/230) in conjunction with Flow Cytometry Assay serum MuSK antibody: MG group MuSK antibody positive rate; Normal healthy controls group is all negative; Test in triplicate, detected result is consistent.Comparative analysis discovery does not detect MuSK antibody in the patients serum of the AChR-Ab positive, and MuSK antibody positive rate in the MG patient of AChR-Ab feminine gender is 20.4%(21/103).
Cellular immunofluorescence (CBA) is measured serum MuSK antibody: MG group MuSK antibody positive rate is 6.9% (16/230); Normal healthy controls group is all negative; Test in triplicate, detected result is consistent.Comparative analysis discovery does not detect MuSK antibody in the patients serum of the AChR-Ab positive, and MuSK antibody positive rate in the MG patient of AChR-Ab feminine gender is 15.5%(16/103).
Cellular immunofluorescence contrasts in conjunction with flow cytometry and traditional C BA method: for AQP4 antibody, CBA is that the sensitivity of 6.9%, CBA method is 9.1% in conjunction with the sensitivity of streaming method; Two kinds of methods detect AQP4 antibodies specific and are 100% (in table 1).
Table 1 patients serum MuSK antibody positive rate
.
SEQUENCE LISTING
<110> General Hospital of Tianjin Medical Univ.
<120> slow virus plasmid expression vector and construction process and application
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 2352
<212> DNA
<213> artificial sequence
<400> 1
atgagagagc tcgtcaacat tccactggta catattctta ctctggttgc cttcagcgga 60
actgagaaac ttccaaaagc tcctgtcatc accactcctc ttgaaacagt ggatgcctta 120
gttgaagaag tggctacttt catgtgtgca gtggaatcct acccccagcc tgagatttcc 180
tggactagaa ataaaattct cattaaactc tttgacaccc ggtacagcat ccgggagaat 240
gggcagctcc tcaccatcct gagtgtggaa gacagtgatg atggcattta ctgctgcacg 300
gccaacaatg gtgtgggagg agctgtggag agttgtggag ccctgcaagt gaagatgaaa 360
cctaaaataa ctcgtcctcc cataaatgtg aaaataatag agggattaaa agcagtccta 420
ccatgtacta caatgggtaa tcccaaacca tcagtgtctt ggataaaggg agacagccct 480
ctcagggaaa attcccgaat tgcagttctt gaatctggga gcttgaggat tcataacgta 540
caaaaggaag atgcaggaca gtatcgatgt gtggcaaaaa acagcctcgg gacagcatat 600
tccaaagtgg tgaagctgga agttgaggaa gaaagtgaac ccgaacaaga tactaaagtt 660
tttgccagga tcctgcgggc tcctgaatcc cacaatgtca cctttggctc ctttgtgacc 720
ctgcactgta cagcaacagg cattcctgtc cccaccatca cctggattga aaacggaaat 780
gctgtttctt ctgggtccat tcaagagagt gtgaaagacc gagtgattga ctcaagactg 840
cagctgttta tcaccaagcc aggactctac acatgcatag ctaccaataa gcatggggag 900
aagttcagta ctgccaaggc tgcagccacc atcagcatag cagaatggag agagtactgc 960
ttggcagtaa aggagctctt ctgcgcaaaa gaatggctgg taatggaaga gaagacccac 1020
agaggactct acagatccga gatgcatttg ctgtccgtgc cagaatgcag caagcttccc 1080
agcatgcatt gggaccccac ggcctgtgcc agactgccac atctagcatt cccaccaatg 1140
acgtcctcaa agccaagtgt ggacattcca aatctgcctt cctcctcctc ttcttccttc 1200
tctgtctcac ctacatactc catgactgta ataatctcca tcatgtccag ctttgcaata 1260
tttgtgcttc ttaccataac tactctctat tgctgccgaa gaagaaaaca atggaaaaat 1320
aagaaaagag aatcagcagc agtaaccctc accacactgc cttctgagct cttactagat 1380
agacttcatc ccaaccccat gtaccagagg atgccgctcc ttctgaaccc caaattgctc 1440
agcctggagt atccaaggaa taacattgaa tatgtgagag acatcggaga gggagcgttt 1500
ggaagggtgt ttcaagcaag ggcaccaggc ttacttccct atgaaccttt cactatggtg 1560
gcagtaaaga tgctcaaaga agaagcctcg gcagatatgc aagcggactt tcagagggag 1620
gcagccctca tggcagaatt tgacaaccct aacattgtga agctattagg agtgtgtgct 1680
gtcgggaagc caatgtgcct gctctttgaa tacatggcct atggtgacct caatgagttc 1740
ctccgcagca tgtcccctca caccgtgtgc agcctcagtc acagtgactt gtctatgagg 1800
gctcaggtct ccagccctgg gcccccaccc ctctcctgtg ctgagcagct ttgcattgcc 1860
aggcaggtgg cagctggcat ggcttacctc tcagaacgta agtttgttca ccgagattta 1920
gccaccagga actgcctggt gggcgagaac atggtggtga aaattgccga ctttggcctc 1980
tccaggaaca tctactcagc agactactac aaagctaatg aaaacgacgc tatccctatc 2040
cgttggatgc caccagagtc cattttttat aaccgctaca ctacagagtc tgatgtgtgg 2100
gcctatggcg tggtcctctg ggagatcttc tcctatggcc tgcagcccta ctatgggatg 2160
gcccatgagg aggtcattta ctacgtgcga gatggcaaca tcctctcctg ccctgagaac 2220
tgccccgtgg agctgtacaa tctcatgcgt ctatgttgga gcaagctgcc tgcagacaga 2280
cccagtttca ccagtattca ccgaattctg gaacgcatgt gtgagagggc agagggaact 2340
gtgagtgtct aa 2352
<210> 2
<211> 9874
<212> DNA
<213> artificial sequence
<400> 2
acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60
acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120
cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180
attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240
tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300
agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360
ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420
cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480
tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540
gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600
aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660
aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720
agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780
atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840
gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900
taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960
acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020
cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080
ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140
tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200
gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260
aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320
gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380
aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440
ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500
acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560
ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620
agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680
tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740
tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggttaacttt 1800
taaaagaaaa ggggggattg gggggtacag tgcaggggaa agaatagtag acataatagc 1860
aacagacata caaactaaag aattacaaaa acaaattaca aaaattcaaa attttatcga 1920
tactagtatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac 1980
gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga 2040
tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg 2100
ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg 2160
caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac 2220
cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag attctagagc 2280
tagcatgaga gagctcgtca acattccact ggtacatatt cttactctgg ttgccttcag 2340
cggaactgag aaacttccaa aagctcctgt catcaccact cctcttgaaa cagtggatgc 2400
cttagttgaa gaagtggcta ctttcatgtg tgcagtggaa tcctaccccc agcctgagat 2460
ttcctggact agaaataaaa ttctcattaa actctttgac acccggtaca gcatccggga 2520
gaatgggcag ctcctcacca tcctgagtgt ggaagacagt gatgatggca tttactgctg 2580
cacggccaac aatggtgtgg gaggagctgt ggagagttgt ggagccctgc aagtgaagat 2640
gaaacctaaa ataactcgtc ctcccataaa tgtgaaaata atagagggat taaaagcagt 2700
cctaccatgt actacaatgg gtaatcccaa accatcagtg tcttggataa agggagacag 2760
ccctctcagg gaaaattccc gaattgcagt tcttgaatct gggagcttga ggattcataa 2820
cgtacaaaag gaagatgcag gacagtatcg atgtgtggca aaaaacagcc tcgggacagc 2880
atattccaaa gtggtgaagc tggaagttga ggaagaaagt gaacccgaac aagatactaa 2940
agtttttgcc aggatcctgc gggctcctga atcccacaat gtcacctttg gctcctttgt 3000
gaccctgcac tgtacagcaa caggcattcc tgtccccacc atcacctgga ttgaaaacgg 3060
aaatgctgtt tcttctgggt ccattcaaga gagtgtgaaa gaccgagtga ttgactcaag 3120
actgcagctg tttatcacca agccaggact ctacacatgc atagctacca ataagcatgg 3180
ggagaagttc agtactgcca aggctgcagc caccatcagc atagcagaat ggagagagta 3240
ctgcttggca gtaaaggagc tcttctgcgc aaaagaatgg ctggtaatgg aagagaagac 3300
ccacagagga ctctacagat ccgagatgca tttgctgtcc gtgccagaat gcagcaagct 3360
tcccagcatg cattgggacc ccacggcctg tgccagactg ccacatctag cattcccacc 3420
aatgacgtcc tcaaagccaa gtgtggacat tccaaatctg ccttcctcct cctcttcttc 3480
cttctctgtc tcacctacat actccatgac tgtaataatc tccatcatgt ccagctttgc 3540
aatatttgtg cttcttacca taactactct ctattgctgc cgaagaagaa aacaatggaa 3600
aaataagaaa agagaatcag cagcagtaac cctcaccaca ctgccttctg agctcttact 3660
agatagactt catcccaacc ccatgtacca gaggatgccg ctccttctga accccaaatt 3720
gctcagcctg gagtatccaa ggaataacat tgaatatgtg agagacatcg gagagggagc 3780
gtttggaagg gtgtttcaag caagggcacc aggcttactt ccctatgaac ctttcactat 3840
ggtggcagta aagatgctca aagaagaagc ctcggcagat atgcaagcgg actttcagag 3900
ggaggcagcc ctcatggcag aatttgacaa ccctaacatt gtgaagctat taggagtgtg 3960
tgctgtcggg aagccaatgt gcctgctctt tgaatacatg gcctatggtg acctcaatga 4020
gttcctccgc agcatgtccc ctcacaccgt gtgcagcctc agtcacagtg acttgtctat 4080
gagggctcag gtctccagcc ctgggccccc acccctctcc tgtgctgagc agctttgcat 4140
tgccaggcag gtggcagctg gcatggctta cctctcagaa cgtaagtttg ttcaccgaga 4200
tttagccacc aggaactgcc tggtgggcga gaacatggtg gtgaaaattg ccgactttgg 4260
cctctccagg aacatctact cagcagacta ctacaaagct aatgaaaacg acgctatccc 4320
tatccgttgg atgccaccag agtccatttt ttataaccgc tacactacag agtctgatgt 4380
gtgggcctat ggcgtggtcc tctgggagat cttctcctat ggcctgcagc cctactatgg 4440
gatggcccat gaggaggtca tttactacgt gcgagatggc aacatcctct cctgccctga 4500
gaactgcccc gtggagctgt acaatctcat gcgtctatgt tggagcaagc tgcctgcaga 4560
cagacccagt ttcaccagta ttcaccgaat tctggaacgc atgtgtgaga gggcagaggg 4620
aactgtgagt gtctaagcgg ccgcaaggat ctgcgatcgc tccggtgccc gtcagtgggc 4680
agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaacggg 4740
tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct 4800
ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt 4860
tcgcaacggg tttgccgcca gaacacagct gaagcttcga ggggctcgca tctctccttc 4920
acgcgcccgc cgccctacct gaggccgcca tccacgccgg ttgagtcgcg ttctgccgcc 4980
tcccgcctgt ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa agctcaggtc 5040
gagaccgggc ctttgtccgg cgctcccttg gagcctacct agactcagcc ggctctccac 5100
gctttgcctg accctgcttg ctcaactcta cgtctttgtt tcgttttctg ttctgcgccg 5160
ttacagatcc aagctgtgac cggcgcctac gctagacgcc accatggaga gcgacgagag 5220
cggcctgccc gccatggaga tcgagtgccg catcaccggc accctgaacg gcgtggagtt 5280
cgagctggtg ggcggcggag agggcacccc caagcagggc cgcatgacca acaagatgaa 5340
gagcaccaaa ggcgccctga ccttcagccc ctacctgctg agccacgtga tgggctacgg 5400
cttctaccac ttcggcacct accccagcgg ctacgagaac cccttcctgc acgccatcaa 5460
caacggcggc tacaccaaca cccgcatcga gaagtacgag gacggcggcg tgctgcacgt 5520
gagcttcagc taccgctacg aggccggccg cgtgatcggc gacttcaagg tggtgggcac 5580
cggcttcccc gaggacagcg tgatcttcac cgacaagatc atccgcagca acgccaccgt 5640
ggagcacctg caccccatgg gcgataacgt gctggtgggc agcttcgccc gcaccttcag 5700
cctgcgcgac ggcggctact acagcttcgt ggtggacagc cacatgcact tcaagagcgc 5760
catccacccc agcatcctgc agaacggggg ccccatgttc gccttccgcc gcgtggagga 5820
gctgcacagc aacaccgagc tgggcatcgt ggagtaccag cacgccttca agacccccat 5880
cgccttcgcc agatcccgcg ctcagtcgtc caattctgcc gtggacggca ccgccggacc 5940
cggctccacc ggatctcgct aagtcgacaa tcaacctctg gattacaaaa tttgtgaaag 6000
attgactggt attcttaact atgttgctcc ttttacgcta tgtggatacg ctgctttaat 6060
gcctttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct tgtataaatc 6120
ctggttgctg tctctttatg aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg 6180
cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct gtcagctcct 6240
ttccgggact ttcgctttcc ccctccctat tgccacggcg gaactcatcg ccgcctgcct 6300
tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg tgttgtcggg 6360
gaaatcatcg tcctttcctt ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac 6420
gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc gcggcctgct 6480
gccggctctg cggcctcttc cgcgtcttcg ccttcgccct cagacgagtc ggatctccct 6540
ttgggccgcc tccccgcctg gtacctttaa gaccaatgac ttacaaggca gctgtagatc 6600
ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc caacgaaaat 6660
aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga gcctgggagc 6720
tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct tgagtgcttc 6780
aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc agaccctttt 6840
agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt cagtatttat 6900
aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca gcttataatg 6960
gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt 7020
ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc tagctatccc 7080
gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa ttttttttat 7140
ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt gaggaggctt 7200
ttttggaggc ctagactttt gcagagacgg cccaaattcg taatcatggt catagctgtt 7260
tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 7320
gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 7380
gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 7440
ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 7500
ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 7560
cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 7620
gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 7680
tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 7740
ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 7800
atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 7860
gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 7920
tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 7980
cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 8040
cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt 8100
tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 8160
cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 8220
cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg 8280
gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 8340
gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 8400
gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 8460
ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 8520
atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 8580
agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 8640
ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 8700
tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 8760
ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 8820
caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 8880
gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 8940
atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 9000
accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 9060
aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct 9120
gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 9180
tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 9240
aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 9300
ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 9360
aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat 9420
tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc tcgcgcgttt 9480
cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct 9540
gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg 9600
tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatgcg 9660
gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc attcgccatt 9720
caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct 9780
ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc 9840
acgacgttgt aaaacgacgg ccagtgccaa gctg 9874
。
Claims (5)
1. a slow virus plasmid expression vector, is characterized in that described slow virus plasmid expression vector is pCDH-MCS-MuSK-GFP, and its nucleotide sequence is as shown in SEQ ID NO.2.
2. a construction process for slow virus plasmid expression vector described in claim 1, is characterized in that being undertaken by following step:
1) vector construction: taking people's muscle tissue cDNA as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR 5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences, in sequence table, shown in SEQ ID NO.1, concrete steps are as follows:
In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, Taq archaeal dna polymerase 0.5 μ l, the about 5U/ μ of final concentration l, ddH
2it is 50 μ l that O mends final volume; The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times, to guarantee abundant extension;
2) application glue reclaims test kit amplified fragments is cut to glue recovery; After be connected into T carrier, after order-checking aligned sequences is correct, used NheI and NotI double digestion, concrete steps are as follows:
Add DNA 1 μ g and corresponding restriction enzyme NheI and NotI 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid, mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete, after having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply, control voltage and remain on 60-80V, electric current is more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stop electrophoresis, ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size, after qualification is correct, with through NheI, the pCDH-MCS-MCS-EF1-copGFP plasmid vector after NotI double digestion is connected, obtain expression MuSK used and the slow virus plasmid vector of GFP: pCDH-MCS-MuSK-GFP.
Described in claim 1 slow virus plasmid expression vector in the application for the preparation of building aspect anti-muscle specific receptor tyrosine kinase antibody test.
4. described in claim 3, build the application of anti-muscle specific receptor tyrosine kinase antibody test, it is characterized in that it is made up of following step:
1) utilize CaCl
2method virus packaging expression MuSK-GFP(pCDH-MCS-Musk-EF1-copGFP) slow virus of fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, after 1 week, the positive stable transfected cells of sorting.
5. continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection, culture condition: 37 DEG C, containing the HEK293 cell of the DMEM culture medium culturing transfection stably express fusion rotein of 10% foetal calf serum;
Concrete steps: in the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize CaCl
2the slow virus of method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and in the situation that 6 μ g/ml Polybrene exist, infect HEK293 cell, cultivate 14 hours, within second day, change perfect medium into for 37 DEG C, after 1 week, the positive stable transfected cells of flow cytometry sorting; Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection;
2) Flow Cytometry Assay serum Musk antibody:
Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, collect the HEK293 cell of transfection and untransfected, mix in the ratio of 1:1, add up to 5 × 105, clean 1 time with streaming staining damping fluid (1 × PBS containing 3% horse serum and 0.02% sodium azide NaN3), centrifugal rear supernatant discarded, the serum diluting with 100 μ l or people Ig contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample, in addition, Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration,
3) cellular immunofluorescence method is measured serum Musk antibody, specific experiment procedure:
HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution;
To be measured group of serum thaws, observe the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times;
4) statistical study: use GraphPad Prism 4 to draw and statistical study to data.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410135044.5A CN104017827A (en) | 2014-04-04 | 2014-04-04 | Lentiviral plasmid expression vector as well as construction method and application of lentiviral plasmid expression vector |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410135044.5A CN104017827A (en) | 2014-04-04 | 2014-04-04 | Lentiviral plasmid expression vector as well as construction method and application of lentiviral plasmid expression vector |
Publications (1)
Publication Number | Publication Date |
---|---|
CN104017827A true CN104017827A (en) | 2014-09-03 |
Family
ID=51434825
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410135044.5A Pending CN104017827A (en) | 2014-04-04 | 2014-04-04 | Lentiviral plasmid expression vector as well as construction method and application of lentiviral plasmid expression vector |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN104017827A (en) |
Cited By (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108893492A (en) * | 2018-07-16 | 2018-11-27 | 段海峰 | A kind of recombinant slow virus production kit and its application |
CN110004179A (en) * | 2019-04-16 | 2019-07-12 | 浙江诺迦生物科技有限公司 | A kind of universal test method and its detection kit of Cannabinoids active material |
CN110606888A (en) * | 2019-08-12 | 2019-12-24 | 陕西脉元生物科技有限公司 | Detection material for anti-GABABR autoantibody in human body fluid, preparation method and application |
CN111304254A (en) * | 2020-02-20 | 2020-06-19 | 齐鲁医药学院 | Preparation method of neutrophil preparation with over-expressed hACE2 gene |
CN112230002A (en) * | 2020-10-20 | 2021-01-15 | 成都海默云因医学检验实验室有限公司 | Method for detecting antibodies of fascin NF155 and NF186 in serum and cerebrospinal fluid |
CN112684172A (en) * | 2021-01-26 | 2021-04-20 | 郑州大学 | Method for detecting serum anti-HMGCR antibody of immune necrotic myopathy |
-
2014
- 2014-04-04 CN CN201410135044.5A patent/CN104017827A/en active Pending
Non-Patent Citations (3)
Title |
---|
J. ZHANG ET AL.: "AQP1 EXPRESSION ALTERATIONS AFFECT MORPHOLOGY AND WATER TRANSPORT IN SCHWANN CELLS AND HYPOXIA-INDUCED UP-REGULATION OF AQP1 OCCURS IN A HIF-1a-DEPENDENT MANNER", 《NEUROSCIENCE》 * |
范新新: "重症肌无力患者抗AchR抗体及其抗MuSK抗体的检测及意义", 《中国优秀硕士论文全文数据库(电子期刊)医药卫生科技辑》 * |
许嘉珍: "肌肉特异性酪氨酸激酶-红色荧光蛋白融合荧光蛋白基因的构建", 《中国优秀硕士论文全文数据库(电子期刊)医药卫生科技辑》 * |
Cited By (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108893492A (en) * | 2018-07-16 | 2018-11-27 | 段海峰 | A kind of recombinant slow virus production kit and its application |
CN108893492B (en) * | 2018-07-16 | 2022-03-29 | 段海峰 | Recombinant lentivirus production kit and application thereof |
CN110004179A (en) * | 2019-04-16 | 2019-07-12 | 浙江诺迦生物科技有限公司 | A kind of universal test method and its detection kit of Cannabinoids active material |
CN110004179B (en) * | 2019-04-16 | 2023-06-06 | 浙江诺迦生物科技有限公司 | Universal detection method and detection kit for cannabinoid active substances |
CN110606888A (en) * | 2019-08-12 | 2019-12-24 | 陕西脉元生物科技有限公司 | Detection material for anti-GABABR autoantibody in human body fluid, preparation method and application |
CN111304254A (en) * | 2020-02-20 | 2020-06-19 | 齐鲁医药学院 | Preparation method of neutrophil preparation with over-expressed hACE2 gene |
CN112230002A (en) * | 2020-10-20 | 2021-01-15 | 成都海默云因医学检验实验室有限公司 | Method for detecting antibodies of fascin NF155 and NF186 in serum and cerebrospinal fluid |
CN112684172A (en) * | 2021-01-26 | 2021-04-20 | 郑州大学 | Method for detecting serum anti-HMGCR antibody of immune necrotic myopathy |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
US20200063135A1 (en) | Methods, systems, and compositions for neuronal differentiation of multipotent stromal cells | |
CN104017827A (en) | Lentiviral plasmid expression vector as well as construction method and application of lentiviral plasmid expression vector | |
CN113549618B (en) | SARS-CoV-2 nucleic acid detection method based on RAA amplification and CRISPR-Cas13a system | |
US20020025561A1 (en) | Vectors for gene-self-assembly | |
CN108395996B (en) | Classical swine fever virus subunit vaccine and preparation method and application thereof | |
CN113481327A (en) | Novel coronavirus ORF1ab gene detection method based on RAA amplification and CRISPR-Cas12a | |
CN104271816A (en) | Surface anchored light chain bait antibody display system | |
CN107937428B (en) | Construction method of carrier integrating functions of microRNA and CAR | |
CN114933970B (en) | Toxoplasma gene knock-out strain lacking 6-phosphogluconate dehydrogenase 1 gene | |
CN113584223B (en) | Identification method of D614G mutation in SARS-CoV-2 based on CRISPR-Cas12a | |
CN113073097B (en) | CHO cell endogenous temperature-sensitive promoter and application thereof | |
CN107661496A (en) | A kind of pig parvoviral immune composition and preparation method and application | |
CN112322706A (en) | Specific human gene fragment, primer probe and application thereof | |
CN111727244B (en) | Universal detection probe for circulating tumor cells | |
CN112301059A (en) | CAR-NK transgenic vector based on replication-defective recombinant lentivirus and construction method and application thereof | |
CN112980800A (en) | CAR-T cell, construction method and application thereof | |
CN111321163A (en) | Construction and application of bacillus subtilis linear plasmid system | |
CN115678856A (en) | Tumor killing cell and application thereof | |
CN113718047B (en) | Kit for detecting 10 bacteria in human breast milk by fluorescence quantitative method and application thereof | |
CN114540345B (en) | Label fluorescent probe with hairpin structure and fluorescent detection method | |
CN110607380B (en) | Mulberry phytoplasma ltrA gene and application thereof in molecular detection of mulberry phytoplasma | |
CN107384921A (en) | MiR216a is used for propagation, invasion and attack and the migration for suppressing osteosarcoma cell | |
CN114752615B (en) | CD 19-targeted CAR-T cell overexpressing ATP5IF1 gene and application thereof | |
CN113736741A (en) | Cloned cell strain for determining biological activity of teriparatide | |
KR102468650B1 (en) | Recombinant vector inducing expression of T7 RNA polymerase and mRNA capping enzyme and uses thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20140903 |
|
WD01 | Invention patent application deemed withdrawn after publication |