CN104017827A - Lentiviral plasmid expression vector as well as construction method and application of lentiviral plasmid expression vector - Google Patents

Abstract

The invention discloses a lentiviral plasmid expression vector as well as a construction method and an application of the lentiviral plasmid expression vector. The lentiviral plasmid expression vector is pCDH-MCS-MuSK-GFP and the nucleotide sequence of the lentiviral plasmid expression vector is shown in SEQ ID NO. 2 in a sequence table. The invention further discloses an application of the lentiviral plasmid expression vector in construction of an anti-muscle-specific receptor tyrosine kinase antibody detection. According to the invention, a stable transfected cell line of MuSK is established by constructing a viral vector, a MuSK antibody is qualitatively and quantitatively detected clinically by an immunofluorescence staining method with relatively high sensitivity and specificity in combination with a flow cytometry, the detection results are more stable and manpower and time costs are greatly saved. The diagnosis and treatment levels of myasthenia gravis are greatly improved by the establishment of the project, the labor capacity and life quality of patients are improved and the lentiviral plasmid expression vector has significant social and economic benefits.

Description

A kind of slow virus plasmid expression vector and construction process and application

Technical field

The present invention relates to a kind of slow virus plasmid expression vector and construction process and application, specifically slow virus plasmid expression vector and construction process thereof and the application in the antibody test of structure anti-muscle specific receptor tyrosine kinase (muscle specific kinase, MuSK).

Background technology

Disease myasthenia (Myasthenia gravis, MG) be a kind of by antibody-mediated, mainly involve neuromuscular junction postsynaptic membrane acetylcholine receptor (acytylcholine receptor, AchR), cause the autoimmune disorder of neuromuscular transmission obstacle.Its Clinical symptoms is part or whole body skeletal muscle fatiguability, is fluctuation myasthenia, has in activity postemphasis, after having a rest, alleviate and light dusk in morning the feature such as heavily.Along with improving constantly and the variation of the factor such as people's living environment of medical diagnosis level, the sickness rate of MG is the trend raising gradually, and therefore, Early Identification is diagnosed instructing treatment and the evaluate its prognosis of two kinds of diseases extremely important.

Myasthenia gravis is obscured because of feature and easy disease similar to other that its symptom has fluctuation, is difficult point medically so diagnose always.The detection of serum specific antibody is significant at the aspect such as diagnosis and study of incident mechanism of MG.The pathogenesis that studies have shown that MG may combine with AChR for the AChR-Ab producing in body, under complement participates in, replys with AChR.Cause that on the one hand cytolemma dissolves, make AChR considerable damage; Can make on the one hand the AChR on film surface crosslinked, increase the catagen speed of AChR.But AChR-Ab can not be detected in approximately 20% Patients With Myasthenia Gravis body.Research finds, 50%AChR-Ab negative patient serum IgG can be combined with muscle specific TE671 cell strain, and not with express people's blastaea nephrocyte (human embryonic kidney cells, HEK293) combination of AChR.Although AChR-Ab negative patient serum can suppress the function of TE671 cell strain AChR, in these serum, the number of AChR does not reduce.That these prove the combination of AChR-Ab negative patient serum IgG antibody is not AChR, but has close ties with AChR, can regulate the myoprotein of AChR, and prove anti-muscle specific receptor tyrosine kinase (muscle specific kinase, MuSK).The direct combination of extracellular section of MuSK-Ab and MuSK, suppresses the AChRs of aggegation albumen (Agrin) mediation in growing in the gathering of synapse cell caudacoria.Although it is also indefinite that these antibody cause amyasthenic mechanism in vivo, the appearance of MuSK-Ab has defined one group of AChR-Ab negative patient subgroup.In the negative MG patients serum of 40%-70%AChR-Ab, contain anti-muscle specific receptor tyrosine kinase antibody.So now negative AChR-Ab MG is divided into again to two portions, the one, the MuSK-Ab positive; The 2nd, AChR-Ab and MuSK-Ab are all negative, also referred to as the negative myasthenia gravis of serum antibody (seronegative myasthenia gravis, SNMG).The discovery of MuSK-Ab, contributes to further to study the pathogenesis of MG and sums up Clinical symptoms.

Mostly the patient of MuSK antibody positive, be that women and middle hair style morning (age of onset is less than 40 years old person) account for 70%, and clinical symptom shows as oblongata myasthenia more, facial muscle is unable, along with myasthenic crisis easily appears in the development of the state of an illness, and facial muscle atrophy.How normal thymus region histology is or slightly undesired, and thymusectomy is to the positive MG patient's curative effect of MuSK-Ab nonsignificance.MG patient is conventionally to anticholinesterase drug thing weak curative effect for the MuSK-Ab positive, traditional immunosuppressant therapy Low Response.MuSK-Ab can only detect in the MG of AChR-Ab feminine gender patients serum, is not present in the serum of the positive MG of AChR-Ab, and can not detects in the patients serum of other muscle relative diseases.MuSK antibody is to have specificly in the appearance of the negative MG of AChR-Ab, has diagnostic significance detecting in AChR-Ab negative patient.And China is not enough to the feature understanding of the positive MG of MuSK-Ab at present, the detection of MuSK-Ab is still located to blank.

The technology that detects in the world at present MuSK antibody mainly contains indirect immunofluorescence (Indirect Immunofluorescence, IIF), the fluorescence immunoassay precipitator method (Fluoroimmunoprecipitation Assay, FIPA), radioimmunoprecipitation (Radioimmunoprecipitation Assay, RIPA), fluorescence immunoassay cell dyeing method (Cell-Based fluorescent immunostaining Assay, and enzyme-linked immunosorbent assay (Enzyme-Linked ImmunoSorbent Assay, ELISA) CBA).ELISA is the method for commonly using, but its susceptibility and specificity are not high; Although RIPA susceptibility and specificity are high, because of the disadvantageous effect of radioactive material confrontation environment etc., its application is restricted; At present ideal with susceptibility and the specificity of CBA and FIPA.But the CBA method average detected cycle is super, and fluorescence efficiency is unstable two days later, and need artificial observation, waste time and energy, and may increase the personal errors in detection; FIPA method relates to isotopic application equally, and environmental hazard increases greatly.In addition, utilize CBA and FIPA to do scientific research for the domestic current a few studies person of detection of MuSK autoantibody, not yet routine is applied to clinically, and therefore which kind of method waits to illustrate as " gold standard " recommended detection that is applied to clinical MuSK antibody.

Summary of the invention

The object of this invention is to provide a kind of slow virus plasmid expression vector and construction process and application.The present invention builds in conjunction with virus vector, transfection, and fluorescence immunization coloration and flow cytometry technology, be mainly used in myasthenia gravis Clinical differential diagnosis, improves myasthenia gravis diagnostic level; Can assist the index as medication curative effect, state of illness monitoring, recurrence prediction; The invention provides a kind of detection method of anti-muscle specific receptor tyrosine kinase autoantibody, can overcome the defect of prior art.Multiple clone site district by the cDNA full-length clone of people MuSK isoform 2 to double expression(DE) lentiviral vectors pCDH-CMV-MCS-EF1-CopGFP, packaging virus, with virus infection 293T cell, the cell of airflow classification stable transfection, obtain the clone of stably express MuSK and GFP, adopt the immunofluorescent staining that sensitivity and specificity are higher to be used for clinical qualitative and quantitative analysis MuSK-Ab in conjunction with fluidic cell detection technique.The foundation of MuSK-Ab detection platform can provide basis for the mechanism of causing a disease of further studying MuSK antibody.

The following technology contents that has been disclosure of the invention for achieving the above object:

An object of the present invention is to provide a kind of slow virus plasmid expression vector, it is characterized in that described slow virus plasmid expression vector is pCDH-MCS-MuSK-GFP, its nucleotide sequence is if sequence table is as shown in SEQ ID NO.2.

Another object of the present invention is to provide a kind of construction process of slow virus plasmid expression vector, the step that it comprises:

1) vector construction:

Taking people's muscle tissue cDNA as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR 5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences, in sequence table, shown in SEQ ID NO.1, concrete steps are as follows:

In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, Taq archaeal dna polymerase 0.5 μ l, the about 5U/ μ of final concentration l, ddH ₂it is 50 μ l that O mends final volume.The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times, to guarantee abundant extension.

2) application glue reclaims after test kit is cut glue recovery (Axygen company) to amplified fragments and is connected into T carrier, after order-checking aligned sequences is correct, is used NheI and NotI double digestion.Concrete steps are as follows:

Add DNA 1 μ g and corresponding restriction enzyme NheI and NotI 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid.Mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete.After having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply.Control voltage and remain on 60-80V, electric current, more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stops electrophoresis, and ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size.After qualification is correct, with the pCDH-MCS-MCS-EF1-copGFP plasmid vector after NotI double digestion (Shanghai Ji Kai gene company limited) is connected through NheI, obtain expression MuSK used and the slow virus plasmid vector of GFP: pCDH-MCS-MuSK-GFP.The complete sequence of the virus vector building is as shown in SEQ ID NO.2 in sequence table.The complete sequence of the virus vector building:

acgcgtgtagtcttatgcaatactcttgtagtcttgcaacatggtaacgatgagttagcaacatgccttacaaggagagaaaaagcaccgtgcatgccgattggtggaagtaaggtggtacgatcgtgccttattaggaaggcaacagacgggtctgacatggattggacgaaccactgaattgccgcattgcagagatattgtatttaagtgcctagctcgatacaataaacgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtggcgcccgaacagggacctgaaagcgaaagggaaaccagagctctctcgacgcaggactcggcttgctgaagcgcgcacggcaagaggcgaggggcggcgactggtgagtacgccaaaaattttgactagcggaggctagaaggagagagatgggtgcgagagcgtcagtattaagcgggggagaattagatcgcgatgggaaaaaattcggttaaggccagggggaaagaaaaaatataaattaaaacatatagtatgggcaagcagggagctagaacgattcgcagttaatcctggcctgttagaaacatcagaaggctgtagacaaatactgggacagctacaaccatcccttcagacaggatcagaagaacttagatcattatataatacagtagcaaccctctattgtgtgcatcaaaggatagagataaaagacaccaaggaagctttagacaagatagaggaagagcaaaacaaaagtaagaccaccgcacagcaagcggccactgatcttcagacctggaggaggagatatgagggacaattggagaagtgaattatataaatataaagtagtaaaaattgaaccattaggagtagcacccaccaaggcaaagagaagagtggtgcagagagaaaaaagagcagtgggaataggagctttgttccttgggttcttgggagcagcaggaagcactatgggcgcagcctcaatgacgctgacggtacaggccagacaattattgtctggtatagtgcagcagcagaacaatttgctgagggctattgaggcgcaacagcatctgttgcaactcacagtctggggcatcaagcagctccaggcaagaatcctggctgtggaaagatacctaaaggatcaacagctcctggggatttggggttgctctggaaaactcatttgcaccactgctgtgccttggaatgctagttggagtaataaatctctggaacagattggaatcacacgacctggatggagtgggacagagaaattaacaattacacaagcttaatacactccttaattgaagaatcgcaaaaccagcaagaaaagaatgaacaagaattattggaattagataaatgggcaagtttgtggaattggtttaacataacaaattggctgtggtatataaaattattcataatgatagtaggaggcttggtaggtttaagaatagtttttgctgtactttctatagtgaatagagttaggcagggatattcaccattatcgtttcagacccacctcccaaccccgaggggacccgacaggcccgaaggaatagaagaagaaggtggagagagagacagagacagatccattcgattagtgaacggatctcgacggttaacttttaaaagaaaaggggggattggggggtacagtgcaggggaaagaatagtagacataatagcaacagacatacaaactaaagaattacaaaaacaaattacaaaaattcaaaattttatcgatactagtattatgcccagtacatgaccttatgggactttcctacttggcagtacatctacgtattagtcatcgctattaccatggtgatgcggttttggcagtacatcaatgggcgtggatagcggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatgtcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctcgtttagtgaaccgtcagatcgcctggagacgccatccacgctgttttgacctccatagaagattctagagctagcatgagagagctcgtcaacattccactggtacatattcttactctggttgccttcagcggaactgagaaacttccaaaagctcctgtcatcaccactcctcttgaaacagtggatgccttagttgaagaagtggctactttcatgtgtgcagtggaatcctacccccagcctgagatttcctggactagaaataaaattctcattaaactctttgacacccggtacagcatccgggagaatgggcagctcctcaccatcctgagtgtggaagacagtgatgatggcatttactgctgcacggccaacaatggtgtgggaggagctgtggagagttgtggagccctgcaagtgaagatgaaacctaaaataactcgtcctcccataaatgtgaaaataatagagggattaaaagcagtcctaccatgtactacaatgggtaatcccaaaccatcagtgtcttggataaagggagacagccctctcagggaaaattcccgaattgcagttcttgaatctgggagcttgaggattcataacgtacaaaaggaagatgcaggacagtatcgatgtgtggcaaaaaacagcctcgggacagcatattccaaagtggtgaagctggaagttgaggaagaaagtgaacccgaacaagatactaaagtttttgccaggatcctgcgggctcctgaatcccacaatgtcacctttggctcctttgtgaccctgcactgtacagcaacaggcattcctgtccccaccatcacctggattgaaaacggaaatgctgtttcttctgggtccattcaagagagtgtgaaagaccgagtgattgactcaagactgcagctgtttatcaccaagccaggactctacacatgcatagctaccaataagcatggggagaagttcagtactgccaaggctgcagccaccatcagcatagcagaatggagagagtactgcttggcagtaaaggagctcttctgcgcaaaagaatggctggtaatggaagagaagacccacagaggactctacagatccgagatgcatttgctgtccgtgccagaatgcagcaagcttcccagcatgcattgggaccccacggcctgtgccagactgccacatctagcattcccaccaatgacgtcctcaaagccaagtgtggacattccaaatctgccttcctcctcctcttcttccttctctgtctcacctacatactccatgactgtaataatctccatcatgtccagctttgcaatatttgtgcttcttaccataactactctctattgctgccgaagaagaaaacaatggaaaaataagaaaagagaatcagcagcagtaaccctcaccacactgccttctgagctcttactagatagacttcatcccaaccccatgtaccagaggatgccgctccttctgaaccccaaattgctcagcctggagtatccaaggaataacattgaatatgtgagagacatcggagagggagcgtttggaagggtgtttcaagcaagggcaccaggcttacttccctatgaacctttcactatggtggcagtaaagatgctcaaagaagaagcctcggcagatatgcaagcggactttcagagggaggcagccctcatggcagaatttgacaaccctaacattgtgaagctattaggagtgtgtgctgtcgggaagccaatgtgcctgctctttgaatacatggcctatggtgacctcaatgagttcctccgcagcatgtcccctcacaccgtgtgcagcctcagtcacagtgacttgtctatgagggctcaggtctccagccctgggcccccacccctctcctgtgctgagcagctttgcattgccaggcaggtggcagctggcatggcttacctctcagaacgtaagtttgttcaccgagatttagccaccaggaactgcctggtgggcgagaacatggtggtgaaaattgccgactttggcctctccaggaacatctactcagcagactactacaaagctaatgaaaacgacgctatccctatccgttggatgccaccagagtccattttttataaccgctacactacagagtctgatgtgtgggcctatggcgtggtcctctgggagatcttctcctatggcctgcagccctactatgggatggcccatgaggaggtcatttactacgtgcgagatggcaacatcctctcctgccctgagaactgccccgtggagctgtacaatctcatgcgtctatgttggagcaagctgcctgcagacagacccagtttcaccagtattcaccgaattctggaacgcatgtgtgagagggcagagggaactgtgagtgtctaagcggccgcaaggatctgcgatcgctccggtgcccgtcagtgggcagagcgcacatcgcccacagtccccgagaagttggggggaggggtcggcaattgaacgggtgcctagagaaggtggcgcggggtaaactgggaaagtgatgtcgtgtactggctccgcctttttcccgagggtgggggagaaccgtatataagtgcagtagtcgccgtgaacgttctttttcgcaacgggtttgccgccagaacacagctgaagcttcgaggggctcgcatctctccttcacgcgcccgccgccctacctgaggccgccatccacgccggttgagtcgcgttctgccgcctcccgcctgtggtgcctcctgaactgcgtccgccgtctaggtaagtttaaagctcaggtcgagaccgggcctttgtccggcgctcccttggagcctacctagactcagccggctctccacgctttgcctgaccctgcttgctcaactctacgtctttgtttcgttttctgttctgcgccgttacagatccaagctgtgaccggcgcctacgctagacgccaccatggagagcgacgagagcggcctgcccgccatggagatcgagtgccgcatcaccggcaccctgaacggcgtggagttcgagctggtgggcggcggagagggcacccccaagcagggccgcatgaccaacaagatgaagagcaccaaaggcgccctgaccttcagcccctacctgctgagccacgtgatgggctacggcttctaccacttcggcacctaccccagcggctacgagaaccccttcctgcacgccatcaacaacggcggctacaccaacacccgcatcgagaagtacgaggacggcggcgtgctgcacgtgagcttcagctaccgctacgaggccggccgcgtgatcggcgacttcaaggtggtgggcaccggcttccccgaggacagcgtgatcttcaccgacaagatcatccgcagcaacgccaccgtggagcacctgcaccccatgggcgataacgtgctggtgggcagcttcgcccgcaccttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacatgcacttcaagagcgccatccaccccagcatcctgcagaacgggggccccatgttcgccttccgccgcgtggaggagctgcacagcaacaccgagctgggcatcgtggagtaccagcacgccttcaagacccccatcgccttcgccagatcccgcgctcagtcgtccaattctgccgtggacggcaccgccggacccggctccaccggatctcgctaagtcgacaatcaacctctggattacaaaatttgtgaaagattgactggtattcttaactatgttgctccttttacgctatgtggatacgctgctttaatgcctttgtatcatgctattgcttcccgtatggctttcattttctcctccttgtataaatcctggttgctgtctctttatgaggagttgtggcccgttgtcaggcaacgtggcgtggtgtgcactgtgtttgctgacgcaacccccactggttggggcattgccaccacctgtcagctcctttccgggactttcgctttccccctccctattgccacggcggaactcatcgccgcctgccttgcccgctgctggacaggggctcggctgttgggcactgacaattccgtggtgttgtcggggaaatcatcgtcctttccttggctgctcgcctgtgttgccacctggattctgcgcgggacgtccttctgctacgtcccttcggccctcaatccagcggaccttccttcccgcggcctgctgccggctctgcggcctcttccgcgtcttcgccttcgccctcagacgagtcggatctccctttgggccgcctccccgcctggtacctttaagaccaatgacttacaaggcagctgtagatcttagccactttttaaaagaaaaggggggactggaagggctaattcactcccaacgaaaataagatctgctttttgcttgtactgggtctctctggttagaccagatctgagcctgggagctctctggctaactagggaacccactgcttaagcctcaataaagcttgccttgagtgcttcaagtagtgtgtgcccgtctgttgtgtgactctggtaactagagatccctcagacccttttagtcagtgtggaaaatctctagcagtagtagttcatgtcatcttattattcagtatttataacttgcaaagaaatgaatatcagagagtgagaggaacttgtttattgcagcttataatggttacaaataaagcaatagcatcacaaatttcacaaataaagcatttttttcactgcattctagttgtggtttgtccaaactcatcaatgtatcttatcatgtctggctctagctatcccgcccctaactccgcccagttccgcccattctccgccccatggctgactaattttttttatttatgcagaggccgaggccgcctcggcctctgagctattccagaagtagtgaggaggcttttttggaggcctagacttttgcagagacggcccaaattcgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccacacaacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacattaattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcggccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtctcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgttgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgcaaggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccaagctg。

Further object of the present invention is to provide slow virus plasmid expression vector in the application for the preparation of building anti-muscle specific receptor tyrosine kinase (muscle specific kinase, MuSK) antibody test aspect.The step that wherein detection of anti-muscle specific receptor tyrosine kinase antibody comprises:

1) utilize CaCl ₂method virus packaging expression MuSK-GFP(pCDH-MCS-Musk-EF1-copGFP) slow virus of fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, after 1 week, the positive stable transfected cells of sorting.Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection, culture condition: 37 DEG C, containing the HEK293 cell of the DMEM culture medium culturing transfection stably express fusion rotein of 10% foetal calf serum;

Concrete steps: in the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize the slow virus of CaCl2 method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and in the situation that 6 μ g/ml Polybrene exist, infect HEK293 cell, cultivate 14 hours, within second day, change perfect medium into for 37 DEG C, after 1 week, the positive stable transfected cells of flow cytometry sorting; Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection;

2) Flow Cytometry Assay serum Musk antibody:

Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, collect the HEK293 cell of transfection and untransfected, mix in the ratio of 1:1, add up to 5 × 105, clean 1 time with streaming staining damping fluid (1 × PBS containing 3% horse serum and 0.02% sodium azide NaN3), centrifugal rear supernatant discarded, the serum diluting with 100 μ l or people Ig contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample, in addition, Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration,

3) cellular immunofluorescence method is measured serum Musk antibody, specific experiment procedure:

HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution;

To be measured group of serum thaws, examine the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times.

4) statistical study: use GraphPad Prism 4 to draw and statistical study to data.

By the nucleotide sequence shown in SEQ ID NO.1 in people MuSK isoform 2(sequence table) cDNA full-length clone to the multiple clone site district of double expression(DE) lentiviral vectors pCDH-CMV-MCS-EF1-CopGFP, packaging virus, with virus infection 293T cell, the cell of airflow classification stable transfection, obtain the clone of stably express MuSK and GFP, adopt the immunofluorescent staining that sensitivity and specificity are higher to be used for clinical qualitative and quantitative analysis MuSK-Ab in conjunction with fluidic cell detection technique.

Musk isoform 2 sequences (nucleotide sequence shown in SEQ ID NO.1):

atgagagagctcgtcaacattccactggtacatattcttactctggttgccttcagcggaactgagaaacttccaaaagctcctgtcatcaccactcctcttgaaacagtggatgccttagttgaagaagtggctactttcatgtgtgcagtggaatcctacccccagcctgagatttcctggactagaaataaaattctcattaaactctttgacacccggtacagcatccgggagaatgggcagctcctcaccatcctgagtgtggaagacagtgatgatggcatttactgctgcacggccaacaatggtgtgggaggagctgtggagagttgtggagccctgcaagtgaagatgaaacctaaaataactcgtcctcccataaatgtgaaaataatagagggattaaaagcagtcctaccatgtactacaatgggtaatcccaaaccatcagtgtcttggataaagggagacagccctctcagggaaaattcccgaattgcagttcttgaatctgggagcttgaggattcataacgtacaaaaggaagatgcaggacagtatcgatgtgtggcaaaaaacagcctcgggacagcatattccaaagtggtgaagctggaagttgaggaagaaagtgaacccgaacaagatactaaagtttttgccaggatcctgcgggctcctgaatcccacaatgtcacctttggctcctttgtgaccctgcactgtacagcaacaggcattcctgtccccaccatcacctggattgaaaacggaaatgctgtttcttctgggtccattcaagagagtgtgaaagaccgagtgattgactcaagactgcagctgtttatcaccaagccaggactctacacatgcatagctaccaataagcatggggagaagttcagtactgccaaggctgcagccaccatcagcatagcagaatggagagagtactgcttggcagtaaaggagctcttctgcgcaaaagaatggctggtaatggaagagaagacccacagaggactctacagatccgagatgcatttgctgtccgtgccagaatgcagcaagcttcccagcatgcattgggaccccacggcctgtgccagactgccacatctagcattcccaccaatgacgtcctcaaagccaagtgtggacattccaaatctgccttcctcctcctcttcttccttctctgtctcacctacatactccatgactgtaataatctccatcatgtccagctttgcaatatttgtgcttcttaccataactactctctattgctgccgaagaagaaaacaatggaaaaataagaaaagagaatcagcagcagtaaccctcaccacactgccttctgagctcttactagatagacttcatcccaaccccatgtaccagaggatgccgctccttctgaaccccaaattgctcagcctggagtatccaaggaataacattgaatatgtgagagacatcggagagggagcgtttggaagggtgtttcaagcaagggcaccaggcttacttccctatgaacctttcactatggtggcagtaaagatgctcaaagaagaagcctcggcagatatgcaagcggactttcagagggaggcagccctcatggcagaatttgacaaccctaacattgtgaagctattaggagtgtgtgctgtcgggaagccaatgtgcctgctctttgaatacatggcctatggtgacctcaatgagttcctccgcagcatgtcccctcacaccgtgtgcagcctcagtcacagtgacttgtctatgagggctcaggtctccagccctgggcccccacccctctcctgtgctgagcagctttgcattgccaggcaggtggcagctggcatggcttacctctcagaacgtaagtttgttcaccgagatttagccaccaggaactgcctggtgggcgagaacatggtggtgaaaattgccgactttggcctctccaggaacatctactcagcagactactacaaagctaatgaaaacgacgctatccctatccgttggatgccaccagagtccattttttataaccgctacactacagagtctgatgtgtgggcctatggcgtggtcctctgggagatcttctcctatggcctgcagccctactatgggatggcccatgaggaggtcatttactacgtgcgagatggcaacatcctctcctgccctgagaactgccccgtggagctgtacaatctcatgcgtctatgttggagcaagctgcctgcagacagacccagtttcaccagtattcaccgaattctggaacgcatgtgtgagagggcagagggaactgtgagtgtctaa

The present invention sets up the clone of stable transfection MuSK by building virus vector, adopt sensitivity and the higher fluorescence immunoassay cell dyeing of specificity in conjunction with fluidic cell detection technique, for clinical qualitative and quantitative analysis MuSK antibody, make detected result more stable, and greatly save manpower and time cost.The foundation of the platform of MuSK antibody test technology, for the mechanism of causing a disease of further studying MuSK antibody provides basis, is conducive to improve the clinic diagnosis level of myasthenia gravis.The Case definition having on the detection technique basis of international endorsement will be beneficial to further internal and international cooperation, improve the city at home with impact and the status of international central nervous system demyelination diagnosis and treatment aspect.The foundation of this project will greatly improve the treatment level of myasthenia gravis, improves patient's work capacity and quality of life, will produce very large Social benefit and economic benefit.

Brief description of the drawings

Fig. 1 MuSK virus particle collection of illustrative plates;

MuSK gene expression dose schematic diagram after Fig. 2 HEK293 cell infection MuSK virus expression carrier;

MuSK protein expression level schematic diagram after Fig. 3 HEK293 cell infection MuSK virus expression carrier;

Fig. 4 Flow cytometry serum to be checked: gray shade represents MuSK (-) serum specimen, grey solid line represents MuSK (+) serum specimen, solid black lines represents MuSK strong positive serum specimen;

Fig. 5 Flow cytometry serum to be checked, feminine gender, the positive and strong positive MuSK express quantitative analysis;

Fig. 6 streaming detects myasthenia gravis (MG) group serum MuSK antibody expression level in conjunction with cellular immunofluorescence method and traditional C BA method;

Fig. 7 streaming detects the myasthenia gravis (AchR-Ab of acetylcholine receptor antibodies feminine gender in conjunction with cellular immunofluorescence method and traditional C BA method ^-mG) group serum MuSK antibody expression level.

Embodiment

Following examples will contribute to understand the present invention, but can not limit content of the present invention.The experimental technique of unreceipted actual conditions in embodiment, conventionally according to the condition described in normal condition and handbook, or the condition of advising according to manufacturer.

Embodiment 1

A kind of slow virus plasmid expression vector is pCDH-MCS-MuSK-GFP, and its nucleotide sequence is if sequence table is as shown in SEQ ID NO.2, and its construction process is undertaken by following step:

1) vector construction: taking people's muscle tissue cDNA as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR 5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences, in sequence table, shown in SEQ ID NO.1, concrete steps are as follows:

In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, Taq archaeal dna polymerase 0.5 μ l, the about 5U/ μ of final concentration l, ddH ₂it is 50 μ l that O mends final volume; The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times, to guarantee abundant extension;

2) application glue reclaims test kit amplified fragments is cut to glue recovery; After be connected into T carrier, after order-checking aligned sequences is correct, used NheI and NotI double digestion, concrete steps are as follows:

Add DNA 1 μ g and corresponding restriction enzyme NheI and NotI 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid; Mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete, after having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply, controls voltage and remains on 60-80V, electric current is more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stop electrophoresis, ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size, after qualification is correct, with the pCDH-after NheI and NotI double digestion mCS-MCS-EF1-copGFP plasmid vector is connected, and obtains expression MuSK used and the slow virus plasmid vector of GFP: pCDH-MCS-MuSK-GFP.

Embodiment 2

Build the application of anti-muscle specific receptor tyrosine kinase antibody test, it is made up of following step:

1) utilize CaCl ₂method virus packaging expression MuSK-GFP(pCDH-MCS-Musk-EF1-copGFP) slow virus of fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, after 1 week, the positive stable transfected cells of sorting.Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection, culture condition: 37 DEG C, containing the HEK293 cell of the DMEM culture medium culturing transfection stably express fusion rotein of 10% foetal calf serum;

Concrete steps: in the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize the slow virus of CaCl2 method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and in the situation that 6 μ g/ml Polybrene exist, infect HEK293 cell, cultivate 14 hours, within second day, change perfect medium into for 37 DEG C, after 1 week, the positive stable transfected cells of flow cytometry sorting; Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection;

2) Flow Cytometry Assay serum Musk antibody:

Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, collect the HEK293 cell of transfection and untransfected, mix in the ratio of 1:1, add up to 5 × 105, clean 1 time with streaming staining damping fluid (1 × PBS containing 3% horse serum and 0.02% sodium azide NaN3), centrifugal rear supernatant discarded, the serum diluting with 100 μ l or people Ig contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample, in addition, Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration,

3) cellular immunofluorescence method is measured serum Musk antibody, specific experiment procedure:

HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution;

To be measured group of serum thaws, examine the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times.

4) statistical study: use GraphPad Prism 4 to draw and statistical study to data.

Embodiment 3

Practical situations:

The present invention selects positive Patients With Myasthenia Gravis 127 examples of AchR at random, age 13-80 year, the male sex's 30 examples, women's 37 examples; Negative Patients With Myasthenia Gravis 103 examples of AchR, age 13-80 year, the male sex's 56 examples, women's 71 examples.Derive from the Patients With Myasthenia Gravis of making a definite diagnosis in General Hospital of Tianjin Medical Univ.'s Neurology Clinic and ward for 2008 to 2013.The most important diagnosis basis of myasthenia gravis is that the fatigable inspection of patient's past medical history, clinical manifestation and fluctuation is found, particularly has the performance of getting involved of extraocular muscle and oblongata flesh.Patient that we include in all shows the muscular fatigue of ill fluctuation, and at least meets a Case definition below:

1) test of anticholinesterase medicine-prostigmin(e) is drawn obvious muscular strength and is improved;

2) the neural repetitive nerve stimulation kinematic waves of low frequency width amplitude decay >15%;

3) there is abnormal trembling and block in SFEMG inspection.Control group is 20 routine physical examination of healthy populations, age 20-60 year, and the 10 routine male sex, 10 routine women, age, sex all match with test serum.

Human Embryonic Kidney HEK 293 cells (commercially available) are preserved by this laboratory, transfection reagent is purchased from Invitrogen, competent cell is purchased from Tiangen company, the quick little extraction reagent kit of plasmid extraction kit plasmid is purchased from Tiangen company, the fast middle extraction reagent kit of plasmid is purchased from Biodev company, plasmid rapid, high volume extracts test kit purchased from Tiangen, Biodec company, DMEM substratum (high sugar, contain penicillin and streptomycin) purchased from Solarbia company, trypsinase is purchased from Solarbia company, and foetal calf serum (FCS) is purchased from GIBCO company.

Double expression(DE) lentiviral vectors pCDH-MCS-MCS-EF1-copGFP is purchased from Shanghai Ji Kai gene company limited

1, vector construction:

Taking people's muscle tissue cDNA(people muscle tissue) as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR:5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences (in sequence table shown in SEQ ID NO.1), concrete steps are as follows:

In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, (l), it is 50 μ l that ddH2O mends final volume to the about 5U/ μ of final concentration to Taq archaeal dna polymerase 0.5 μ l.The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times.To guarantee abundant extension.

2) application glue reclaims after test kit is cut glue recovery (Axygen company) to amplified fragments and is connected into T carrier, after order-checking aligned sequences is correct, is used NheI and NotI double digestion.Concrete steps are as follows: add DNA 1 μ g and corresponding restriction enzyme (NheI and NotI) 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid.Mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete.After having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply.Control voltage and remain on 60-80V, electric current, more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stops electrophoresis, and ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size.After qualification is correct, with the pCDH-MCS-MCS-EF1-copGFP plasmid vector after NotI double digestion is connected through NheI, obtain expression MuSK used and the slow virus plasmid expression vector of GFP.The complete sequence of the virus vector building (in sequence table shown in SEQ ID NO.2).Slow virus plasmid expression vector: pCDH-MCS-MuSK-GFP.

2, the acquisition of virus packaging and HEK293 stably transfected cell line

Clone and cultivation thereof: Human Embryonic Kidney HEK 293 clones are by this chamber cellar culture.Cell is placed in the DMEM substratum that contains 10% inactivated fetal bovine serum, puts into 37 DEG C, 5% CO ₂incubator, cultivates according to a conventional method, gets cell in logarithmic phase for experiment.

The recovery of cell and going down to posterity: add 20mL DMEM substratum in advance in 50ml centrifuge tube, from liquid nitrogen container take out that frozen cell drops into rapidly 37oC water-bath and constantly shake it is thawed within the shortest time, with after 70% alcohol disinfecting cryopreservation tube appearance, cell is stored to liquid and be transferred in above-mentioned centrifuge tube, centrifugal 10 minutes of 1000rmp.Abandon supernatant, re-suspended cell is placed in the DMEM substratum containing 10% foetal calf serum, 37 ° of C, 5%CO ₂, cultivate under saturated humidity.

In the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize the slow virus (pCDH-MCS-Musk-EF1-copGFP) of CaCl2 method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, 37 DEG C of overnight incubation (14 hours), change perfect medium for second day into, after 1 week, the positive stable transfected cells of flow cytometry sorting.Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection.

3, in conjunction with flow cytometry, (FlowCytometry, FCM are shown in document Nat Methods. 2013 Mar in conjunction with flow cytometry principle of operation to immunofluorescent staining method; 10 (3): 228-38.) measure serum MuSK antibody:

Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, the HEK293 cell of collection transfection and untransfected, mixes in the ratio of 1:1, adds up to 5 × 10 ⁵, with streaming staining damping fluid, (1 × PBS is containing 3% horse serum and 0.02% sodium azide NaN ₃) clean 1 time, centrifugal rear supernatant discarded, the serum diluting with 100 μ l or human normal immunoglobulin contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample.In addition, the Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration.

4, cellular immunofluorescence method is measured serum MuSK antibody:

HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution.

To be measured group of serum thaws, examine the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times.

5, statistical study: use GraphPad Prism 4 to draw and statistical study to data.

6, result

Transfection efficiency and the Subcellular Localization of MuSK plasmid DNA transfection HEK293 cell: DAPI dyes the capable Subcellular Localization of core and shows, nuclei dyeing is blue, and the main epi-position of MuSK antigen protein of HEK293 cell expressing is on cytolemma.

Cellular immunofluorescence is 9.1% (21/230) in conjunction with Flow Cytometry Assay serum MuSK antibody: MG group MuSK antibody positive rate; Normal healthy controls group is all negative; Test in triplicate, detected result is consistent.Comparative analysis discovery does not detect MuSK antibody in the patients serum of the AChR-Ab positive, and MuSK antibody positive rate in the MG patient of AChR-Ab feminine gender is 20.4%(21/103).

Cellular immunofluorescence (CBA) is measured serum MuSK antibody: MG group MuSK antibody positive rate is 6.9% (16/230); Normal healthy controls group is all negative; Test in triplicate, detected result is consistent.Comparative analysis discovery does not detect MuSK antibody in the patients serum of the AChR-Ab positive, and MuSK antibody positive rate in the MG patient of AChR-Ab feminine gender is 15.5%(16/103).

Cellular immunofluorescence contrasts in conjunction with flow cytometry and traditional C BA method: for AQP4 antibody, CBA is that the sensitivity of 6.9%, CBA method is 9.1% in conjunction with the sensitivity of streaming method; Two kinds of methods detect AQP4 antibodies specific and are 100% (in table 1).

Table 1 patients serum MuSK antibody positive rate .

SEQUENCE LISTING

<110> General Hospital of Tianjin Medical Univ.

<120> slow virus plasmid expression vector and construction process and application

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 2352

<212> DNA

<213> artificial sequence

<400> 1

atgagagagc tcgtcaacat tccactggta catattctta ctctggttgc cttcagcgga 60

actgagaaac ttccaaaagc tcctgtcatc accactcctc ttgaaacagt ggatgcctta 120

gttgaagaag tggctacttt catgtgtgca gtggaatcct acccccagcc tgagatttcc 180

tggactagaa ataaaattct cattaaactc tttgacaccc ggtacagcat ccgggagaat 240

gggcagctcc tcaccatcct gagtgtggaa gacagtgatg atggcattta ctgctgcacg 300

gccaacaatg gtgtgggagg agctgtggag agttgtggag ccctgcaagt gaagatgaaa 360

cctaaaataa ctcgtcctcc cataaatgtg aaaataatag agggattaaa agcagtccta 420

ccatgtacta caatgggtaa tcccaaacca tcagtgtctt ggataaaggg agacagccct 480

ctcagggaaa attcccgaat tgcagttctt gaatctggga gcttgaggat tcataacgta 540

caaaaggaag atgcaggaca gtatcgatgt gtggcaaaaa acagcctcgg gacagcatat 600

tccaaagtgg tgaagctgga agttgaggaa gaaagtgaac ccgaacaaga tactaaagtt 660

tttgccagga tcctgcgggc tcctgaatcc cacaatgtca cctttggctc ctttgtgacc 720

ctgcactgta cagcaacagg cattcctgtc cccaccatca cctggattga aaacggaaat 780

gctgtttctt ctgggtccat tcaagagagt gtgaaagacc gagtgattga ctcaagactg 840

cagctgttta tcaccaagcc aggactctac acatgcatag ctaccaataa gcatggggag 900

aagttcagta ctgccaaggc tgcagccacc atcagcatag cagaatggag agagtactgc 960

ttggcagtaa aggagctctt ctgcgcaaaa gaatggctgg taatggaaga gaagacccac 1020

agaggactct acagatccga gatgcatttg ctgtccgtgc cagaatgcag caagcttccc 1080

agcatgcatt gggaccccac ggcctgtgcc agactgccac atctagcatt cccaccaatg 1140

acgtcctcaa agccaagtgt ggacattcca aatctgcctt cctcctcctc ttcttccttc 1200

tctgtctcac ctacatactc catgactgta ataatctcca tcatgtccag ctttgcaata 1260

tttgtgcttc ttaccataac tactctctat tgctgccgaa gaagaaaaca atggaaaaat 1320

aagaaaagag aatcagcagc agtaaccctc accacactgc cttctgagct cttactagat 1380

agacttcatc ccaaccccat gtaccagagg atgccgctcc ttctgaaccc caaattgctc 1440

agcctggagt atccaaggaa taacattgaa tatgtgagag acatcggaga gggagcgttt 1500

ggaagggtgt ttcaagcaag ggcaccaggc ttacttccct atgaaccttt cactatggtg 1560

gcagtaaaga tgctcaaaga agaagcctcg gcagatatgc aagcggactt tcagagggag 1620

gcagccctca tggcagaatt tgacaaccct aacattgtga agctattagg agtgtgtgct 1680

gtcgggaagc caatgtgcct gctctttgaa tacatggcct atggtgacct caatgagttc 1740

ctccgcagca tgtcccctca caccgtgtgc agcctcagtc acagtgactt gtctatgagg 1800

gctcaggtct ccagccctgg gcccccaccc ctctcctgtg ctgagcagct ttgcattgcc 1860

aggcaggtgg cagctggcat ggcttacctc tcagaacgta agtttgttca ccgagattta 1920

gccaccagga actgcctggt gggcgagaac atggtggtga aaattgccga ctttggcctc 1980

tccaggaaca tctactcagc agactactac aaagctaatg aaaacgacgc tatccctatc 2040

cgttggatgc caccagagtc cattttttat aaccgctaca ctacagagtc tgatgtgtgg 2100

gcctatggcg tggtcctctg ggagatcttc tcctatggcc tgcagcccta ctatgggatg 2160

gcccatgagg aggtcattta ctacgtgcga gatggcaaca tcctctcctg ccctgagaac 2220

tgccccgtgg agctgtacaa tctcatgcgt ctatgttgga gcaagctgcc tgcagacaga 2280

cccagtttca ccagtattca ccgaattctg gaacgcatgt gtgagagggc agagggaact 2340

gtgagtgtct aa 2352

<210> 2

<211> 9874

<212> DNA

<213> artificial sequence

<400> 2

acgcgtgtag tcttatgcaa tactcttgta gtcttgcaac atggtaacga tgagttagca 60

acatgcctta caaggagaga aaaagcaccg tgcatgccga ttggtggaag taaggtggta 120

cgatcgtgcc ttattaggaa ggcaacagac gggtctgaca tggattggac gaaccactga 180

attgccgcat tgcagagata ttgtatttaa gtgcctagct cgatacaata aacgggtctc 240

tctggttaga ccagatctga gcctgggagc tctctggcta actagggaac ccactgctta 300

agcctcaata aagcttgcct tgagtgcttc aagtagtgtg tgcccgtctg ttgtgtgact 360

ctggtaacta gagatccctc agaccctttt agtcagtgtg gaaaatctct agcagtggcg 420

cccgaacagg gacctgaaag cgaaagggaa accagagctc tctcgacgca ggactcggct 480

tgctgaagcg cgcacggcaa gaggcgaggg gcggcgactg gtgagtacgc caaaaatttt 540

gactagcgga ggctagaagg agagagatgg gtgcgagagc gtcagtatta agcgggggag 600

aattagatcg cgatgggaaa aaattcggtt aaggccaggg ggaaagaaaa aatataaatt 660

aaaacatata gtatgggcaa gcagggagct agaacgattc gcagttaatc ctggcctgtt 720

agaaacatca gaaggctgta gacaaatact gggacagcta caaccatccc ttcagacagg 780

atcagaagaa cttagatcat tatataatac agtagcaacc ctctattgtg tgcatcaaag 840

gatagagata aaagacacca aggaagcttt agacaagata gaggaagagc aaaacaaaag 900

taagaccacc gcacagcaag cggccactga tcttcagacc tggaggagga gatatgaggg 960

acaattggag aagtgaatta tataaatata aagtagtaaa aattgaacca ttaggagtag 1020

cacccaccaa ggcaaagaga agagtggtgc agagagaaaa aagagcagtg ggaataggag 1080

ctttgttcct tgggttcttg ggagcagcag gaagcactat gggcgcagcc tcaatgacgc 1140

tgacggtaca ggccagacaa ttattgtctg gtatagtgca gcagcagaac aatttgctga 1200

gggctattga ggcgcaacag catctgttgc aactcacagt ctggggcatc aagcagctcc 1260

aggcaagaat cctggctgtg gaaagatacc taaaggatca acagctcctg gggatttggg 1320

gttgctctgg aaaactcatt tgcaccactg ctgtgccttg gaatgctagt tggagtaata 1380

aatctctgga acagattgga atcacacgac ctggatggag tgggacagag aaattaacaa 1440

ttacacaagc ttaatacact ccttaattga agaatcgcaa aaccagcaag aaaagaatga 1500

acaagaatta ttggaattag ataaatgggc aagtttgtgg aattggttta acataacaaa 1560

ttggctgtgg tatataaaat tattcataat gatagtagga ggcttggtag gtttaagaat 1620

agtttttgct gtactttcta tagtgaatag agttaggcag ggatattcac cattatcgtt 1680

tcagacccac ctcccaaccc cgaggggacc cgacaggccc gaaggaatag aagaagaagg 1740

tggagagaga gacagagaca gatccattcg attagtgaac ggatctcgac ggttaacttt 1800

taaaagaaaa ggggggattg gggggtacag tgcaggggaa agaatagtag acataatagc 1860

aacagacata caaactaaag aattacaaaa acaaattaca aaaattcaaa attttatcga 1920

tactagtatt atgcccagta catgacctta tgggactttc ctacttggca gtacatctac 1980

gtattagtca tcgctattac catggtgatg cggttttggc agtacatcaa tgggcgtgga 2040

tagcggtttg actcacgggg atttccaagt ctccacccca ttgacgtcaa tgggagtttg 2100

ttttggcacc aaaatcaacg ggactttcca aaatgtcgta acaactccgc cccattgacg 2160

caaatgggcg gtaggcgtgt acggtgggag gtctatataa gcagagctcg tttagtgaac 2220

cgtcagatcg cctggagacg ccatccacgc tgttttgacc tccatagaag attctagagc 2280

tagcatgaga gagctcgtca acattccact ggtacatatt cttactctgg ttgccttcag 2340

cggaactgag aaacttccaa aagctcctgt catcaccact cctcttgaaa cagtggatgc 2400

cttagttgaa gaagtggcta ctttcatgtg tgcagtggaa tcctaccccc agcctgagat 2460

ttcctggact agaaataaaa ttctcattaa actctttgac acccggtaca gcatccggga 2520

gaatgggcag ctcctcacca tcctgagtgt ggaagacagt gatgatggca tttactgctg 2580

cacggccaac aatggtgtgg gaggagctgt ggagagttgt ggagccctgc aagtgaagat 2640

gaaacctaaa ataactcgtc ctcccataaa tgtgaaaata atagagggat taaaagcagt 2700

cctaccatgt actacaatgg gtaatcccaa accatcagtg tcttggataa agggagacag 2760

ccctctcagg gaaaattccc gaattgcagt tcttgaatct gggagcttga ggattcataa 2820

cgtacaaaag gaagatgcag gacagtatcg atgtgtggca aaaaacagcc tcgggacagc 2880

atattccaaa gtggtgaagc tggaagttga ggaagaaagt gaacccgaac aagatactaa 2940

agtttttgcc aggatcctgc gggctcctga atcccacaat gtcacctttg gctcctttgt 3000

gaccctgcac tgtacagcaa caggcattcc tgtccccacc atcacctgga ttgaaaacgg 3060

aaatgctgtt tcttctgggt ccattcaaga gagtgtgaaa gaccgagtga ttgactcaag 3120

actgcagctg tttatcacca agccaggact ctacacatgc atagctacca ataagcatgg 3180

ggagaagttc agtactgcca aggctgcagc caccatcagc atagcagaat ggagagagta 3240

ctgcttggca gtaaaggagc tcttctgcgc aaaagaatgg ctggtaatgg aagagaagac 3300

ccacagagga ctctacagat ccgagatgca tttgctgtcc gtgccagaat gcagcaagct 3360

tcccagcatg cattgggacc ccacggcctg tgccagactg ccacatctag cattcccacc 3420

aatgacgtcc tcaaagccaa gtgtggacat tccaaatctg ccttcctcct cctcttcttc 3480

cttctctgtc tcacctacat actccatgac tgtaataatc tccatcatgt ccagctttgc 3540

aatatttgtg cttcttacca taactactct ctattgctgc cgaagaagaa aacaatggaa 3600

aaataagaaa agagaatcag cagcagtaac cctcaccaca ctgccttctg agctcttact 3660

agatagactt catcccaacc ccatgtacca gaggatgccg ctccttctga accccaaatt 3720

gctcagcctg gagtatccaa ggaataacat tgaatatgtg agagacatcg gagagggagc 3780

gtttggaagg gtgtttcaag caagggcacc aggcttactt ccctatgaac ctttcactat 3840

ggtggcagta aagatgctca aagaagaagc ctcggcagat atgcaagcgg actttcagag 3900

ggaggcagcc ctcatggcag aatttgacaa ccctaacatt gtgaagctat taggagtgtg 3960

tgctgtcggg aagccaatgt gcctgctctt tgaatacatg gcctatggtg acctcaatga 4020

gttcctccgc agcatgtccc ctcacaccgt gtgcagcctc agtcacagtg acttgtctat 4080

gagggctcag gtctccagcc ctgggccccc acccctctcc tgtgctgagc agctttgcat 4140

tgccaggcag gtggcagctg gcatggctta cctctcagaa cgtaagtttg ttcaccgaga 4200

tttagccacc aggaactgcc tggtgggcga gaacatggtg gtgaaaattg ccgactttgg 4260

cctctccagg aacatctact cagcagacta ctacaaagct aatgaaaacg acgctatccc 4320

tatccgttgg atgccaccag agtccatttt ttataaccgc tacactacag agtctgatgt 4380

gtgggcctat ggcgtggtcc tctgggagat cttctcctat ggcctgcagc cctactatgg 4440

gatggcccat gaggaggtca tttactacgt gcgagatggc aacatcctct cctgccctga 4500

gaactgcccc gtggagctgt acaatctcat gcgtctatgt tggagcaagc tgcctgcaga 4560

cagacccagt ttcaccagta ttcaccgaat tctggaacgc atgtgtgaga gggcagaggg 4620

aactgtgagt gtctaagcgg ccgcaaggat ctgcgatcgc tccggtgccc gtcagtgggc 4680

agagcgcaca tcgcccacag tccccgagaa gttgggggga ggggtcggca attgaacggg 4740

tgcctagaga aggtggcgcg gggtaaactg ggaaagtgat gtcgtgtact ggctccgcct 4800

ttttcccgag ggtgggggag aaccgtatat aagtgcagta gtcgccgtga acgttctttt 4860

tcgcaacggg tttgccgcca gaacacagct gaagcttcga ggggctcgca tctctccttc 4920

acgcgcccgc cgccctacct gaggccgcca tccacgccgg ttgagtcgcg ttctgccgcc 4980

tcccgcctgt ggtgcctcct gaactgcgtc cgccgtctag gtaagtttaa agctcaggtc 5040

gagaccgggc ctttgtccgg cgctcccttg gagcctacct agactcagcc ggctctccac 5100

gctttgcctg accctgcttg ctcaactcta cgtctttgtt tcgttttctg ttctgcgccg 5160

ttacagatcc aagctgtgac cggcgcctac gctagacgcc accatggaga gcgacgagag 5220

cggcctgccc gccatggaga tcgagtgccg catcaccggc accctgaacg gcgtggagtt 5280

cgagctggtg ggcggcggag agggcacccc caagcagggc cgcatgacca acaagatgaa 5340

gagcaccaaa ggcgccctga ccttcagccc ctacctgctg agccacgtga tgggctacgg 5400

cttctaccac ttcggcacct accccagcgg ctacgagaac cccttcctgc acgccatcaa 5460

caacggcggc tacaccaaca cccgcatcga gaagtacgag gacggcggcg tgctgcacgt 5520

gagcttcagc taccgctacg aggccggccg cgtgatcggc gacttcaagg tggtgggcac 5580

cggcttcccc gaggacagcg tgatcttcac cgacaagatc atccgcagca acgccaccgt 5640

ggagcacctg caccccatgg gcgataacgt gctggtgggc agcttcgccc gcaccttcag 5700

cctgcgcgac ggcggctact acagcttcgt ggtggacagc cacatgcact tcaagagcgc 5760

catccacccc agcatcctgc agaacggggg ccccatgttc gccttccgcc gcgtggagga 5820

gctgcacagc aacaccgagc tgggcatcgt ggagtaccag cacgccttca agacccccat 5880

cgccttcgcc agatcccgcg ctcagtcgtc caattctgcc gtggacggca ccgccggacc 5940

cggctccacc ggatctcgct aagtcgacaa tcaacctctg gattacaaaa tttgtgaaag 6000

attgactggt attcttaact atgttgctcc ttttacgcta tgtggatacg ctgctttaat 6060

gcctttgtat catgctattg cttcccgtat ggctttcatt ttctcctcct tgtataaatc 6120

ctggttgctg tctctttatg aggagttgtg gcccgttgtc aggcaacgtg gcgtggtgtg 6180

cactgtgttt gctgacgcaa cccccactgg ttggggcatt gccaccacct gtcagctcct 6240

ttccgggact ttcgctttcc ccctccctat tgccacggcg gaactcatcg ccgcctgcct 6300

tgcccgctgc tggacagggg ctcggctgtt gggcactgac aattccgtgg tgttgtcggg 6360

gaaatcatcg tcctttcctt ggctgctcgc ctgtgttgcc acctggattc tgcgcgggac 6420

gtccttctgc tacgtccctt cggccctcaa tccagcggac cttccttccc gcggcctgct 6480

gccggctctg cggcctcttc cgcgtcttcg ccttcgccct cagacgagtc ggatctccct 6540

ttgggccgcc tccccgcctg gtacctttaa gaccaatgac ttacaaggca gctgtagatc 6600

ttagccactt tttaaaagaa aaggggggac tggaagggct aattcactcc caacgaaaat 6660

aagatctgct ttttgcttgt actgggtctc tctggttaga ccagatctga gcctgggagc 6720

tctctggcta actagggaac ccactgctta agcctcaata aagcttgcct tgagtgcttc 6780

aagtagtgtg tgcccgtctg ttgtgtgact ctggtaacta gagatccctc agaccctttt 6840

agtcagtgtg gaaaatctct agcagtagta gttcatgtca tcttattatt cagtatttat 6900

aacttgcaaa gaaatgaata tcagagagtg agaggaactt gtttattgca gcttataatg 6960

gttacaaata aagcaatagc atcacaaatt tcacaaataa agcatttttt tcactgcatt 7020

ctagttgtgg tttgtccaaa ctcatcaatg tatcttatca tgtctggctc tagctatccc 7080

gcccctaact ccgcccagtt ccgcccattc tccgccccat ggctgactaa ttttttttat 7140

ttatgcagag gccgaggccg cctcggcctc tgagctattc cagaagtagt gaggaggctt 7200

ttttggaggc ctagactttt gcagagacgg cccaaattcg taatcatggt catagctgtt 7260

tcctgtgtga aattgttatc cgctcacaat tccacacaac atacgagccg gaagcataaa 7320

gtgtaaagcc tggggtgcct aatgagtgag ctaactcaca ttaattgcgt tgcgctcact 7380

gcccgctttc cagtcgggaa acctgtcgtg ccagctgcat taatgaatcg gccaacgcgc 7440

ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 7500

ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 7560

cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 7620

gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 7680

tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 7740

ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 7800

atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 7860

gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 7920

tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 7980

cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 8040

cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt 8100

tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 8160

cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 8220

cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg 8280

gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 8340

gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 8400

gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 8460

ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 8520

atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 8580

agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 8640

ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 8700

tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 8760

ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 8820

caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 8880

gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 8940

atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 9000

accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 9060

aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct 9120

gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 9180

tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 9240

aagggcgaca cggaaatgtt gaatactcat actcttcctt tttcaatatt attgaagcat 9300

ttatcagggt tattgtctca tgagcggata catatttgaa tgtatttaga aaaataaaca 9360

aataggggtt ccgcgcacat ttccccgaaa agtgccacct gacgtctaag aaaccattat 9420

tatcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc tcgcgcgttt 9480

cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca cagcttgtct 9540

gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg ttggcgggtg 9600

tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc accatatgcg 9660

gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc attcgccatt 9720

caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat tacgccagct 9780

ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt tttcccagtc 9840

acgacgttgt aaaacgacgg ccagtgccaa gctg 9874

。

Claims (5)

1. a slow virus plasmid expression vector, is characterized in that described slow virus plasmid expression vector is pCDH-MCS-MuSK-GFP, and its nucleotide sequence is as shown in SEQ ID NO.2.

2. a construction process for slow virus plasmid expression vector described in claim 1, is characterized in that being undertaken by following step:

1) vector construction: taking people's muscle tissue cDNA as template, utilize primer MuskF:5'-CCAGCTAGCATGAGAGAGCTCGTCAACATTCCAC-3' and MuskR 5'-CACAGCGGCCGCTTAGACACTCACAGTTCCCTCTGCC-3' amplification MuSK isoform 2 cDNA sequences, in sequence table, shown in SEQ ID NO.1, concrete steps are as follows:

In PCR reaction tubes, add successively DNA profiling 300 ng, the each final concentration of primer is 0.4 μ mol/L, and dNTP final concentration is 0.2 μ mol/L, 10 × PCR damping fluid, 5 μ l, Taq archaeal dna polymerase 0.5 μ l, the about 5U/ μ of final concentration l, ddH ₂it is 50 μ l that O mends final volume; The cycling program of PCR is: 94 DEG C of sex change 4 minutes, and 98 DEG C of 10s, 68 DEG C of annealing 45s, 72 DEG C are extended 2min, circulate altogether 32 times, to guarantee abundant extension;

2) application glue reclaims test kit amplified fragments is cut to glue recovery; After be connected into T carrier, after order-checking aligned sequences is correct, used NheI and NotI double digestion, concrete steps are as follows:

Add DNA 1 μ g and corresponding restriction enzyme NheI and NotI 2 μ l, then add redistilled water to make cumulative volume to be 19 μ l, after interior pipe solution is mixed, to add 1 μ l enzyme liquid, mix after reaction system, 37 DEG C of water bath heat preservation 2-3 hour, make endonuclease reaction complete, after having reacted, prepare sepharose, get 10 μ l enzymolysis solutions and 2 μ l 6 × load sample liquid mix, carefully add in sample cell with micropipette rifle, add the electrophoresis chamber lid that closes after sample, demand working power supply, control voltage and remain on 60-80V, electric current is more than 40mA, in the time that tetrabromophenol sulfonphthalein band moves to apart from the about 2cm in gel forward position, stop electrophoresis, ultraviolet imagery systematic observation is also measured DNA endonuclease bamhi size, after qualification is correct, with through NheI, the pCDH-MCS-MCS-EF1-copGFP plasmid vector after NotI double digestion is connected, obtain expression MuSK used and the slow virus plasmid vector of GFP: pCDH-MCS-MuSK-GFP.

Described in claim 1 slow virus plasmid expression vector in the application for the preparation of building aspect anti-muscle specific receptor tyrosine kinase antibody test.

4. described in claim 3, build the application of anti-muscle specific receptor tyrosine kinase antibody test, it is characterized in that it is made up of following step:

1) utilize CaCl ₂method virus packaging expression MuSK-GFP(pCDH-MCS-Musk-EF1-copGFP) slow virus of fusion rotein, collect viral suspension and infect HEK293 cell in the situation that 6 μ g/ml Polybrene exist, after 1 week, the positive stable transfected cells of sorting.

5. continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection, culture condition: 37 DEG C, containing the HEK293 cell of the DMEM culture medium culturing transfection stably express fusion rotein of 10% foetal calf serum;

Concrete steps: in the time that HEK293 cell grows to 70% density, remove old substratum, clean cell with PBS, utilize CaCl ₂the slow virus of method virus packaging expression MuSK-GFP fusion rotein, collect viral suspension and in the situation that 6 μ g/ml Polybrene exist, infect HEK293 cell, cultivate 14 hours, within second day, change perfect medium into for 37 DEG C, after 1 week, the positive stable transfected cells of flow cytometry sorting; Continue to go down to posterity after cultivating and carry out postsearch screening, obtain the HEK293 clone of stably express fusion rotein of 100% transfection;

2) Flow Cytometry Assay serum Musk antibody:

Obtain after serum to be checked, with containing 1%BSA(Sigma) DMEM-Hepes washing lotion dilution test serum, collect the HEK293 cell of transfection and untransfected, mix in the ratio of 1:1, add up to 5 × 105, clean 1 time with streaming staining damping fluid (1 × PBS containing 3% horse serum and 0.02% sodium azide NaN3), centrifugal rear supernatant discarded, the serum diluting with 100 μ l or people Ig contrast re-suspended cell, 4 degree are hatched 30min, then add streaming staining buffer solution for cleaning 1 time, after centrifugal collecting cell, add the mountain goat anti-human igg of the Fast blue mark after 100ul dilution, 4 degree lucifuges are hatched 30 min, streaming staining buffer solution for cleaning 1 time, then use 300ul streaming staining damping fluid re-suspended cell, flow cytometer Dual channel detection fluorescent signal, taking non-transfected cells subgroup and human IgG dyeing group as contrast, judge MuSK antibody positive sample, in addition, Fast blue signal power in GFP positive cell monoid can be used to indicate the relative quantity of antibody concentration,

3) cellular immunofluorescence method is measured serum Musk antibody, specific experiment procedure:

HEK293 cell is cultivated, gone down to posterity, and proceed in Tissue Culture Flask; Utilize PEI to carry out cell transfecting to people MuSK cDNA (MuSK-GFP) plasmid of EGFP mark; In the time that transfection efficiency to 70% is above, adds appropriate cell lysis buffer solution, then add appropriate proteinase inhibitor; Collecting cell lysate is in EP pipe, and wheel turns 1 hour, and the centrifugal 15min of 13000rpm collects supernatant, is corresponding antigens extracting solution;

To be measured group of serum thaws, observe the centrifugal 5min that filters, get supernatant 10 μ l, add respectively the 50 μ l antigen extracting solutions that diluted, mix trailing wheel and turn over night, then add appropriate non-specific mountain goat anti-human igg, hatch rear centrifugally, abandon supernatant, collecting precipitation, finally, by 1ml cracking Extraction buffer rinsing precipitation, repeat 3 times; To precipitate and move in 96 orifice plates, and in high-speed multiple channel continuous wavelength microplate reader, obtain fluorescence absorbancy, with the above positive judging criterion of normal healthy controls group fluorescence average+3 times standard deviation, every part of serum detects equal double blinding, and repeats 3 times;

4) statistical study: use GraphPad Prism 4 to draw and statistical study to data.