CN104004078A - Application of OsVTC1-1 in improvement of plant salt stress tolerance - Google Patents

Application of OsVTC1-1 in improvement of plant salt stress tolerance Download PDF

Info

Publication number
CN104004078A
CN104004078A CN201410269067.5A CN201410269067A CN104004078A CN 104004078 A CN104004078 A CN 104004078A CN 201410269067 A CN201410269067 A CN 201410269067A CN 104004078 A CN104004078 A CN 104004078A
Authority
CN
China
Prior art keywords
plant
osvtc1
gene
salt stress
application
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201410269067.5A
Other languages
Chinese (zh)
Inventor
张执金
秦华
邓载安
张传玉
王亚云
王娟
张海文
权瑞党
黄荣峰
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Biotechnology Research Institute of CAAS
Original Assignee
Biotechnology Research Institute of CAAS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biotechnology Research Institute of CAAS filed Critical Biotechnology Research Institute of CAAS
Priority to CN201410269067.5A priority Critical patent/CN104004078A/en
Publication of CN104004078A publication Critical patent/CN104004078A/en
Pending legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241—Nucleotidyltransferases (2.7.7)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/07—Nucleotidyltransferases (2.7.7)
    • C12Y207/07022—Mannose-1-phosphate guanylyltransferase (GDP) (2.7.7.22)

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention discloses application of OsVTC1-1 protein in the improvement of plant vitamin C synthesis. In vitro, the OsVTC1-1 protein can catalyze mannose-1-mannose to generate GDP-mannose, and it shows that the OsVTC1-1 protein has GDP-mannose pyrophosphorylase activity, may participate in the galactose path in vivo so as to regulate and control synthesis of the Vc, and can improve the plant salt stress tolerance. The OsVTC1-1 can increase the Vc content in the mutant ctc1-1 of Arabidopsis VTC1, and therefore the salt tolerance of transgentic plants is increased. In addition, expression of the OsVTC1-1 in rice is interfered with so that synthesis of the rice Vc can be obviously restrained, and therefore the salt stress tolerance of rice is reduced. It can be seen that the OsVTC1-1 protein has an important effect on improving the plant salt stress tolerance.

Description

The application of OsVTC1-1 in improving plant salt stress tolerance
Technical field
The present invention relates to the application of a kind of OsVTC1-1 albumen in improving plant salt stress tolerance.
Background technology
Vitamins C is important antioxidant and coenzyme in animal and plant body, can remove the active oxygen (ROS) accumulating in plant materials under normal physiological activity and stress conditions, in the stress response of plant, can improve the ROS of plant interior accumulation, in improving stress tolerance in plants, there is vital role, so there is vital role by Vitamin C content in the method raising plant of biotechnology in improving Plant stress patience.
Research shows that L-semi-lactosi approach is the biosynthetic main path of plant vitamin C, and in its activity and plant, Vitamin C content is closely related.Semi-lactosi approach route of synthesis be take phosphofructose as initial substrate, phosphofructose is at the generation 6-of mannose-6-phosphate isomerase phosphomannose, 6-phosphomannose generates 1-phosphomannose under the effect of Phosphomannomutase, 1-phosphomannose generates GDP-seminose at GDP-mannose pyrophosphorylase, enter the main regulatory pathway of plant vitamin C biosynthesizing, then GDP-seminose order is at GDP-seminose-3', 5'-epimerase, GDP-L-semi-lactosi Starch phosphorylase, galactose-1-phosphate enzyme, galactose dehydrogenase, under the catalysis of the relevant enzyme such as galactanolactone dehydrogenase, generate vitamins C.In L-semi-lactosi approach, the GDP-mannose pyrophosphorylase that catalysis 1-phosphomannose generates GDP-seminose is a crucial regulation and control enzyme of this route of synthesis, in its activity and plant, vitamins C resultant quantity is closely related, in plant vitamin C biosynthesizing, brings into play crucial regulating and controlling effect.The Point mutont of Arabidopis thaliana GDP-mannose pyrophosphorylase VTC1 vtc1-1because of the GDP-mannose pyrophosphorylase activity decreased of VTC1, suppressed ascorbic biosynthesizing in Arabidopis thaliana, its Vitamin C content only has 25-30% of wild-type.And VTC1 afunction mutant has not only suppressed ascorbic biosynthesizing, and affected the flowering time of plant, many-sided physiological activities such as oxidative stress patience, have reduced the patience that plant is coerced salt etc.So the expression of the gene by the GDP-mannose pyrophosphorylase of encoding in regulating plant, not only can regulating plant in ascorbic biosynthesizing, and salt stress patience that can regulating plant.
At present, although in model plant Arabidopis thaliana in Vc route of synthesis the function of key gene more clearly, food crop as paddy rice in Vc not clear.We have cloned the homologous gene of Arabidopis thaliana VTC1 from paddy rice by the method for homologous clone osVTC1-1.Vivoexpression purifying OsVTC1-1 albumen, detect the enzymic activity of OsVTC1-1 albumen in vitro.Experimental result is presented at external OsVTC1-1 and can catalysis 1-phosphomannose generates GDP-seminose, shows that OsVTC1-1 albumen has GDP-mannose pyrophosphorylase active, and it may participate in semi-lactosi approach in vivo and to regulate and control Vc synthetic.Will osVTC1-1be building up to plant expression vector, transformation mode plant Arabidopis thaliana, further studies the function of OsVTC1-1 in plant materials.Experimental result Explicit Expression OsVTC1-1 can complementary Arabidopis thaliana VTC1 function, improves Arabidopis thaliana VTC1 mutant vtc1-1middle Vc content, shows that OsVTC1-1 has VTC1 similar functions in plant, and by catalysis GDP-seminose, synthetic regulating plant Vc is synthetic.
Summary of the invention
The object of this invention is to provide the application of a kind of OsVTC1-1 albumen in improving plant salt stress tolerance.
OsVTC1-1 albumen can catalysis mannose-1-phosphate generates GDP-seminose in vitro, shows that OsVTC1-1 albumen has GDP-mannose pyrophosphorylase active, and it may participate in semi-lactosi approach in vivo and to regulate and control Vc synthetic. osVTC1-1can improve Arabidopis thaliana vTC1mutant vtc1-1middle Vc content, has significantly increased the salt stress patience of transgenic arabidopsis.In addition, disturb in paddy rice osVTC1-1expression significantly suppressed the synthetic of paddy rice Vc, obviously reduced Under Salt Stress in Rice patience.Visible OsVTC1-1 albumen has vital role in improving plant salt stress tolerance.
Technical scheme provided by the invention is: the application of a kind of OsVTC1-1 gene in changing plant salt stress tolerance, the aminoacid sequence of described genes encoding is shown in SEQ ID NO.2.
The application of OsVTC1-1 gene in changing plant salt stress tolerance, the nucleotides sequence of described gene is classified as shown in SEQ ID NO.1.
Described application, described plant is paddy rice.
Described application, it is the tolerance that reduces plant that described change plant salt is coerced, its expression that reduces described gene by genetic engineering technique realizes.
Described application, it is the tolerance that improves plant that described change plant salt is coerced, it realizes described gene overexpression in plant by genetic engineering technique.
Meanwhile, the present invention also provides carrier, transformant or the host cell of described OsVTC1-1 gene.
The present invention also provides a kind of synthetic method of Vc in plant that improves: the encoding gene of sequence shown in SEQ ID NO.1 is imported and set out in plant, obtain transgenic plant; Compare with the plant that sets out, the synthetic raising of vitamins C of transgenic plant, salt stress patience strengthens.
Above-mentioned method, described encoding gene imports in described plant by recombinant expression vector, and described recombinant expression vector is that the multiple clone site that described encoding gene is inserted to the carrier pCAMBIA1307 that sets out obtains.
The present invention has following beneficial effect:
OsVTC1-1 albumen has the function that catalysis mannose-1-phosphate generates GDP-seminose, and it crosses expression not only can improve by semi-lactosi approach the biosynthesizing of Vc in plant, and can significantly increase the salt stress patience of plant.Vc is the nutritive element of needed by human, the invention provides a kind of raising crop (paddy rice) stress tolerance (salt tolerant is coerced), improve the effective ways of its nutritive value (high Vc content) simultaneously, significant in food crop patience and nutrition improvement.
Accompanying drawing explanation
Fig. 1 is osVTC1-1mRNA sequence.
Fig. 2 is osVTC1-1gene overexpression carrier pCAMBIA1307-OsVTC1-1 builds schematic diagram.
Fig. 3 is osVTC1-1gene interference expression vector pCAMBIA2300-RNAi-OsVTC1-1 schematic diagram.
Fig. 4 is osVTC1-1in gene overexpression material and interfering material osVTC1-1genetic expression detected result, wherein, the detected result of the Western blot that A is transgenic line, B is in transgenic line osVTC1-1the Q-PCR detected result of genetic expression.
Fig. 5 is osVTC1-1the detected result of Vitamin C content in gene overexpression material and interfering material, in A, WT is that T3 is for turning osVTC1-1the Arabidopis thaliana of plant expression vector pCAMBIA1307 empty carrier, vtc1-1for Arabidopis thaliana vTC1simple point mutation body vtc1-1, OE7 and OE13 are that T3 is for turning osVTC1-1two independent strains of over-express vector pCAMBIA1307-OsVTC1-1 Arabidopis thaliana; In B, WT spends 17, RI-1, RI-2, RI-3 to turn in T3 generation in wild-type paddy rice osVTC1-13 strains of interference carrier pCAMBIA2300-RNAi-OsVTC1-1 paddy rice.
Fig. 6 is osVTC1-1gene overexpression Arabidopis thaliana salt stress patience, wherein, A, for to process two weeks Arabidopis thaliana seedlings after 7 days with 150 mM NaCl, crosses and expresses osVTC1-1the salt tolerant phenotype of Arabidopis thaliana under salt stress is processed; B, for to process two weeks Arabidopis thaliana seedlings after 10 days with 150 mM NaCl, crosses and expresses osVTC1-1the statistic data of Arabidopis thaliana survival rate under salt stress is processed.。
Fig. 7 is osVTC1-1gene disturbs Under Salt Stress in Rice patience, and wherein A suppresses for processing two week age with 150 mM NaCl osVTC1-1the transgenic paddy rice seedling of expressing, after 10 days, suppresses osVTC1-1the responsive phenotype of the salt of the transgenic paddy rice seedling of expressing under salt stress is processed; B suppresses for processing two week age with 150 mM NaCl osVTC1-1the transgenic paddy rice seedling of expressing is after 10 days, and under normal growth condition, renewal cultivation suppressed after 1 week osVTC1-1the statistic data of the transgenic paddy rice seedling survival rate of expressing.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
In paddy rice, spend 17 (Zhonghua 17) at document " Liu D, Chen X, Liu J, Ye J, Guo Z. (2012)
The rice ERF transcription factor OsERF922 negatively regulates resistance to Magnaporthe oryzae and salt tolerance. J Exp Bot. 63:3899-3911. " in disclosed, public Ke Cong Biological Technology institute, Chinese Academy of Agricultural Sciences obtains.
Arabidopis thaliana vitamins C synthesizes key gene vTC1simple point mutation body vtc1-1in document " Conklin PL; Saracco SA; Norris SR; Last RL. (2000) Identification of ascorbic acid-deficient Arabidopsis thaliana mutants. Genetics. 154:847-856. ", disclosed, public Ke Cong Biological Technology institute, Chinese Academy of Agricultural Sciences obtains.
PCAMBIA1307 is purchased from Ji Ran bio tech ltd, Shanghai, and catalog number is JR13080311.
Agrobacterium LBA4404 is purchased from the http://www.biomart.cn/8627/index.htm of Hang Zhi bio tech ltd, and catalog number is AABV02-03.
Inducing culture (NB substratum) is purchased from Ke Min bio tech ltd, Shanghai, and article No. is BS1309.
Subculture medium is in NB substratum, to add 2mg/L 2, and 4-D makes.
100uM AS+AA liquid nutrient medium adds 2mg/L 2 by NB substratum, and 4-D and 100uM/L AS make.
PUCCRNAi disclosed in document " Gan D; Zhang J; Jiang H; Jiang T; Zhu S; Cheng B (2010) Bacterially expressed dsRNA protects maize against SCMV infection.Plant Cell Rep. 29:1261-1268. ", and public Ke Cong Biological Technology institute, Chinese Academy of Agricultural Sciences obtains.
PCAMBIA2300 is purchased from the prosperous Bioisystech Co., Ltd of Beijing ancient cooking vessel state, and catalog number is MCV036.
embodiment 1, osVTC1-1gene overexpression carrier arabidopsis thaliana transformation
One, the structure of interference expression vector
(1) extract in paddy rice and spend 17 genomic dna.
(2) design and synthesize following primer:
Upstream primer: 5'-GC tCTAGAaCCATGAAGGCGCTCATT-3'(SEQ ID NO.4)
Downstream primer: 5'-CAGTCGACCATGACAATCTCAGGCTT-3'(SEQ ID NO.5)
(sequence shown in underscore is that enzyme is cut recognition site)
(3) take the genomic dna of step () is template, take upstream primer in step (two) and downstream primer as primer carries out pcr amplification, obtains osVTC1-1gene.
(4) use xbai with salthe PCR product that I double digestion step (three) obtains, obtains gene fragment; xbai with sali double digestion pCAMBIA1307, obtains carrier large fragment; Gene fragment is connected with carrier large fragment, obtains recombinant plasmid, by its called after pCAMBIA1307-OsVTC1-1, send sequencing result correct this plasmid, it builds schematic diagram as shown in Figure 2.
Two, pCAMBIA1307-OsVTC1-1 is imported in Agrobacterium LBA4404 by electric method for transformation, obtain the Agrobacterium of recombinating, by its called after LBA4404/pCAMBIA1307-OsVTC1-1.
Three, over-express vector arabidopsis thaliana transformation
(1) get the synthetic key gene of upgrowth situation Arabidopis thaliana vitamins C good, that have more petal vTC1simple point mutation body vtc1-1, transform and water the day before yesterday.
(2) will recombinate Agrobacterium LBA4404/pCAMBIA1307-OsVTC1-1 in 28 ℃ of overnight incubation, to OD 600the centrifugal 6min of=0.8,6000rpm, collects thalline.
(3) bacterial sediment is suspended in freshly prepared conversion damping fluid, to final concentration 0D 600=0.4, make suspension.
(4) while transforming, cut off flower or the existing fruit pod having bloomed, topple over little basin, guarantee that the whole petals of Arabidopis thaliana are all submerged in suspension prepared by step (three), soak about 40s.
(5) suck plant unnecessary liquid around, plant is lain against in the capsule of a sealing to keep humidity, lucifuge is spent the night.
(6) second day takes out plant, vertically, transfers to 20 ℃, under 16h illumination/8h dark condition, grows, and obtains T1 for seed.
(7) T1 is laid in the screening culture medium containing 40ug/mL Totomycin for seed, 4 ℃ of vernalization 48h-72h, move on to phytotron, under 16h illumination/8h dark condition, grow two weeks.
(8) (transgenic plant are that green seedling and root is longer to wait to grow green transgenosis resistance seedling; Non-transgenic plant is etiolated seedling or green unrooted seedling substantially) transplant afterwards the continued growth of burying, obtain T1 for transfer-gen plant (detected result of the Western blot that Fig. 4 A is transgenic line).
(9) screening T1 has transfer-gen plant the adding generation of the separated ratio of 3:1 for the hygromycin resistance of seedling and non-resistance seed, obtains T3 for transgenic arabidopsis, is applied to the functional analysis of OsVTC1-1 albumen in plant.
embodiment 2, osVTC1-1gene interference carrier rice transformation
One, the structure of over-express vector
(1) extract in paddy rice and spend 17 genomic dna.
(2) design and synthesize following primer:
Upstream primer: 5'-CT cTCGAGcCTCCTTTTATGTTATGGTA-3(SEQ ID NO.6)
Downstream primer: 5'-CC aGATCTaAGAACAAAGTACAAGGCTG-3'(SEQ ID NO.7)
(sequence shown in underscore is that enzyme is cut recognition site)
(3) take the genomic dna of step () is template, take the upstream primer of step (two) and downstream primer as primer carries out pcr amplification, obtains pcr amplification product, and the nucleotide sequence of this DNA molecular is as shown in SEQ ID No.3.(ACCESSION NUMBER is NM_001051330; Sequence is
Cctccttttatgttatggtatactcaagttcttttaatgcagtatctttagtttat acctgtgatccttccaagatgttgacctagcatgtgtgttactcacattctgaaaa ctgcttctcaatgagaattcagtgtgccatatttgattgtaccttcatttggacca tccagtaaagttctcaaccctgcaccaagaggaccagaagaaactctttttcctat aaaagaagaggatcagccttgtactttgttctt) (this fragment does not comprise osVTC1-1gene cDNA fragment, is positioned at osVTC1-13 ' UTR district of gene)
(4) xhoi with bglthe PCR product that II double digestion step (three) obtains, obtains osVTC1-13 ' UTR fragment of gene; xhoi with bgliI double digestion pUCCRNAi, obtains carrier large fragment 1; This fragment is connected with carrier large fragment 1, obtains intermediate carrier 1.
sali with bamHi double digestion intermediate carrier 1, obtains carrier large fragment 2; xhoi with bglthe PCR product that II double digestion step (three) obtains, obtains gene fragment; Carrier large fragment 2 is connected with gene fragment, obtains intermediate carrier 2( xhoi with bamh I, bgliI with sali is isocaudarner).
psti enzyme cuts intermediate carrier 2, obtains two-way complementation osVTC1-13 ' UTR fragment of gene; psti enzyme is cut pCAMBIA2300, obtains carrier large fragment 3; By two-way complementation osVTC1-1gene fragment is connected with carrier large fragment 3, obtains recombinant plasmid, and by its called after pCAMBIA2300-RNAi-OsVTC1-1, it builds schematic diagram as shown in Figure 3.
Two, pCAMBIA2300-RNAi-OsVTC1-1 is imported in Agrobacterium LBA4404 with electric method for transformation, obtain the Agrobacterium of recombinating, by its called after LBA4404/pCAMBIA2300-RNAi-OsVTC1-1.
Three, interference expression vector rice transformation
(1) will in the paddy rice with after volumn concentration 75% ethanol sterilizing, spend 17 seed on inducing culture, 28 ℃ of dark culturing.After two weeks, callus is proceeded to new inducing culture, 28 ℃ of subcultures are secretly cultivated, and subculture is dark altogether cultivated for 2 generations.
(2) the embryo callus subculture particle naturally disperseing in third generation subculture callus, color is yellowish is placed on subculture medium, 28 ℃ of dark cultivations 3 days, the callus obtaining is for the conversion of the Agrobacterium of recombinating.
(3) Agrobacterium LBA4404/pCAMBIA2300-RNAi-OsVTC1-1 that will recombinate is suspended in (OD in 100uM AS+AA liquid nutrient medium 600be 0.3), the callus then step (two) being obtained is placed in bacterium suspension and soaks 10-20 minute, shakes gently therebetween, in 28 ℃ of overnight incubation, to OD 600the centrifugal 6min of=0.8,6000rpm, collects thalline.Bacterial sediment is suspended in freshly prepared conversion damping fluid, to final concentration 0D 600=0.3-0.6.
(4) outwell bacterium liquid, carefully take out callus and blot unnecessary bacterium liquid with filter paper, callus is transferred in common culture medium, 21 ℃-22 ℃ dark cultivations 3 days.
(5) select the callus after common cultivation, filter paper is laid in screening culture medium (containing 50mg/L Totomycin) after being filtered dry surperficial steam, secretly cultivates for 28 ℃.In the time of 2 weeks, once, subculture is 2 times altogether for subculture.
(6) growth step (five) being obtained is vigorous, is creamy white or yellowish fresh callus goes to pre-division culture medium, and 28 ℃ of dark cultivations about 1 week, 28 ℃ of illumination cultivation then, two weeks left and right subcultures once, obtain breaking up seedling.
(7) the good seedling differentiation of growing way is moved on root media (bottled).Cultivation 1-2 intermediate house after week, obtains T0 for the seed of transfer-gen plant and T0 transfer-gen plant.
Use Totomycin to select dull and stereotyped sprouting in the seed of T0 transfer-gen plant, confirm that hygromycin resistance has the strain of the separated ratio of 3:1, then T1 transfer-gen plant therefrom is gone to soil incubation until ripe.By the transgenic line adding generation obtaining, utilize the T3 obtaining to analyze the function of OsVTC1-1 albumen in plant for transgenic paddy rice.
(Fig. 4 B is in transgenic line osVTC1-1the Q-PCR detected result of genetic expression)
vitamin C content in embodiment 3, transfer-gen plant detects
One, choose 3 week age T3 for root and transgenic arabidopsis, wild-type Arabidopis thaliana and the Arabidopis thaliana of spending 17 in transgenic paddy rice and wild-type paddy rice vTC1mutant vtc1-1blade, water is rinsed well, and blots unnecessary moisture with thieving paper, then freezing rapidly with liquid nitrogen respectively, in-80 ℃ of preservations.
Two, accurately take 0.175g AsA, be dissolved in 1ml volumn concentration and be 6% perchloric acid (HClO 4) in the aqueous solution, obtain the AsA solution of 1mmol/ml.
Three, the perchloric acid solution that is 6% by the AsA solution of 1mmol/ml with volumn concentration is the AsA solution that concentration is respectively 1000nmol/ml, 800nmol/ml, 600nmol/ml, 400nmol/ml, 200nmol/ml, 100nmol/ml by its final dilution.
Four, the AsA solution of getting respectively the different concns that 300 μ l step 3 obtain, adds in 2700 μ l pH=12.7 Soduxin damping fluids, mixes, and pH=5.8 left and right now, the concentration of AsA is corresponding has reduced 10 times.At 265nm place, survey the absorption value of the AsA of different concns.The absorption value (OD) of take is X-coordinate, and AsA concentration is ordinate zou mapping, and drawing standard curve, obtains equation of linear regression.
Five, the material of getting respectively each plant of the 0.5g that step 1 obtains grinds under liquid nitrogen, and adding respectively 1ml volumn concentration is 6% HClO 4the aqueous solution, mixes, and places 5min on ice, and 4 ℃, 12000g, centrifugal 10min.Get supernatant, extract AsA wherein.
Six, the supernatant liquor 200 μ l that step 5 extracted add in 1800 μ l pH=12.7 Soduxin damping fluids, then add the Vitamin C oxidase (purchased from Sigma) of 4U, after reaction 10min, record 265nm ultraviolet absorption value, are denoted as OD1; The supernatant liquor 200 μ l that get step 5 extraction add in 1800 μ l pH=12.7 Soduxin damping fluids, and adding DTT is 30mM to final concentration, and room temperature reaction 30min, records 265nm ultraviolet absorption value, is denoted as OD2.
Seven, equation of linear regression OD2-OD1 value substitution step 4 being obtained, calculates the concentration of AsA.
Vitamin C content detected result in each plant as shown in Figure 5.
embodiment 4, transfer-gen plant salt stress patience detect
By wild-type and osVTC1-1cross expression Arabidopis thaliana T3 seed and sprout on MS minimum medium, and grow two weeks.The Arabidopis thaliana seedling in two week age is proceeded to containing on the MS minimum medium of 150 mM NaCl, and 14 hours illumination/10 dark,, grow 7 days by 22 ℃.Observe under condition of salt stress wild-type and osVTC1-1cross expression Arabidopis thaliana seedling growing state, record experimental result.Experiment repeats 3 times, analyzes and improves osVTC1-1the effect of expression in improving Arabidopis thaliana salt stress patience.By wild-type and inhibition osVTC1-1express 37 ℃ of vernalization of paddy rice T3 seed after 24 hours, in water, 30 ℃ germinate and the 3-4 days that grows, and plant in soil in then, cultivate 2 weeks for 28-32 ℃.Then with watering 150 mM NaCl solution-treated rice seedlings 10 days.Observe wild-type and inhibition under condition of salt stress osVTC1-1express rice seedlings growing state, record experimental result.At 150 mM NaCl solution-treated rice seedlings, after 10 days, recover pouring and do not add the NaCl aqueous solution, renewal cultivation 1 week, then adds up wild-type and inhibition osVTC1-1the transgenic paddy rice seedling survival rate of expressing.Experiment repeats 3 times, analyzes and suppresses osVTC1-1the impact of expression on Under Salt Stress in Rice patience.
Fig. 6 shows raising osVTC1-1the effect of expression in improving Arabidopis thaliana salt stress patience.Fig. 6 A, for to process two weeks Arabidopis thaliana seedlings after 7 days with 150 mM NaCl, crosses and expresses osVTC1-1the salt tolerant phenotype of Arabidopis thaliana under salt stress is processed; Fig. 6 B, for to process two weeks Arabidopis thaliana seedlings after 10 days with 150 mM NaCl, crosses and expresses osVTC1-1the statistic data of Arabidopis thaliana survival rate under salt stress is processed.Above-mentioned research is found to improve OsVTC1-1 and is expressed the salt stress patience that can increase Arabidopis thaliana, shows that OsVTC1-1 albumen can be synthetic by improving plant Vc in plant, increases plant salt stress tolerance.
Fig. 7 shows inhibition osVTC1-1expression has reduced Under Salt Stress in Rice patience.When processing and suppress in paddy rice with NaCl osVTC1-1express transgenic line time find to process and suppress in paddy rice with NaCl osVTC1-1after the transgenic paddy rice seedling of expressing, transgenic paddy rice shows brine sensitivity.Fig. 7 A suppresses for processing two week age with 150 mM NaCl osVTC1-1the transgenic paddy rice seedling of expressing, after 10 days, suppresses osVTC1-1the responsive phenotype of the salt of the transgenic paddy rice seedling of expressing under salt stress is processed; Fig. 6 B suppresses for processing two week age with 150 mM NaCl osVTC1-1the transgenic paddy rice seedling of expressing is after 10 days, and under normal growth condition, renewal cultivation suppressed after 1 week osVTC1-1the statistic data of the transgenic paddy rice seedling survival rate of expressing.Above-mentioned research is found to suppress osVTC1-1express the salt stress patience that has significantly reduced transgenic paddy rice, show osVTC1-1can be by regulating the salt stress patience of the synthetic adjusting and controlling rice of paddy rice Vc.
In sum, osVTC1-1in plant salt stress response, there is vital role (Fig. 6, Fig. 7).
<110> Biological Technology institute, Chinese Academy of Agricultural Sciences
The application of <120>OsVTC1-1 albumen in improving plant salt stress tolerance
<160> 7
<210> 1
<211>1706
<212> DNA
<400> 1
GAATTCTGAAAGCCTGAACCTCTCGTCGTGTCTCGTACTCTCGTTCCCCTCCCCTCGCGTCGCCTCTCCACTTCGTCTCTATAAAGTCCCACCCAATTCTCGATTCCCAATCCAGCGCAGCACAAAGCCCTCCTCCTTCCACCGCAGCTGCGCTACCTACCTCCAAGAGGGCTGGTCCGCTGGTCGTGGAGAAGGAAGAGAGATCTTCCAGGCTGATCCCTCCTATTGCTTTCTCCTTCCCGAGCCCGCTTGAGGATCCCCGCCGGAGTAGGGATTAGGGAGGGGAGAACAGGAGGCGGCGATTCACCATGAAGGCGCTCATTCTTGTTGGAGGCTTCGGCACTCGCCTTCGGCCTTTGACGCTCAGTTTCCCAAAGCCTCTTGTTGATTTCGCGAACAAGCCCATGATTCTGCATCAGATTGAGGCCTTGAAAGAAGTTGGAGTAACAGAAGTTGTTTTAGCCATCAACTACCGACCGGAGGTAATGCTCAATTTCCTGAAGGACTTTGAGGATAAGCTTGGCATCACAATCACGTGTTCCCAAGAGACTGAGCCCTTGGGAACTGCTGGCCCTCTTGCTCTAGCAAGGGACAAGCTTGTGGATGGATCTGGTGAGCCATTCTTTGTCCTCAACAGTGACGTCATAAGTGAATACCCTTTTGCTGAGCTCATAAAATTTCACAAGAGCCATGGTGGTGAGGCAACGATTATGGTCACCAAGGTGGACGAACCATCAAAATATGGTGTTGTGGTTATGGAGGAGGTCACTGGAATGGTGGAAAAATTTGTTGAGAAACCAAAAATATTTGTAGGCAACAAGATCAATGCGGGAATTTACTTGTTGAATCCATCTGTCCTGGACCGCATCGAGCTGAAGCCAACTTCAATTGAGAAAGAGGTCTTTCCTCGAATTGCATCTGATGCAAAGCTCTTTGCTCTGGTCCTTCCAGGTTTTTGGATGGATGTTGGCCAACCAAGGGATTACATTACAGGCTTGCGCCTTTATCTGGATTCACTTAGGAAGAGATCAACCAACAGGTTAGCCACTGGAGCACACATTGTTGGGAATGTGCTAGTTCACGAGAGTGCCAAGATTGGCGAAGGCTGTCTGATTGGTCCTGATGTTGCTATCGGTCCTGGATGCGTCGTGGAGGATGGTGTGAGGCTTTCCCGTTGCACGGTGATGCGTGGCGTGCACATTAAGAAGCATGCTTGCATATCAAACAGCATTATTGGATGGCACTCAACTGTTGGACAATGGGCACGGATAGAAAATATGACTATCCTGGGAGAGGACGTACATGTAGGTGATGAGGTCTATACCAACGGCGGTGTTGTTCTCCCGCACAAAGAGATCAAGTCAAGCATCCTGAAGCCTGAGATTGTCATGTGAACTAACCCTCCTTTTATGTTATGGTATACTCAAGTTCTTTTAATGCAGTATCTTTAGTTTATACCTGTGATCCTTCCAAGATGTTGACCTAGCATGTGTGTTACTCACATTCTGAAAACTGCTTCTCAATGAGAATTCAGTGTGCCATATTTGATTGTACCTTCATTTGGACCATCCAGTAAAGTTCTCAACCCTGCACCAAGAGGACCAGAAGAAACTCTTTTTCCTATAAAAGAAGAGGATCAGCCTTGTACTTTGTTCTTTTTGAAACAAATATATACTGCTATATGGAACAGACCCATGATGTATTGC
<210> 2
<211> 361
<212> amino acid
<400> 2
Met Lys Ala Leu Ile Leu Val Gly Gly Phe Gly Thr Arg Leu Arg Pro Leu Thr Leu Ser Phe Pro Lys Pro Leu Val Asp Phe Ala Asn Lys Pro MET Ile Leu His Gln Ile Glu Ala Leu Lys Glu Val Gly Val Thr Glu Val Val Leu Ala Ile Asn Tyr Arg Pro Glu Val Met Leu Asn Phe Leu Lys Asp Phe Glu Asp Lys Leu Gly Ile Thr Ile Thr Cys Ser Gln Glu Thr Glu Pro Leu Gly Thr Ala Gly Pro Leu Ala Leu Ala Arg Asp Lys Leu Val Asp Gly Ser Gly Glu Pro Phe Phe Val Leu Asn Ser Asp Val Ile Ser Glu Tyr Pro Phe Ala Glu Leu Ile Lys Phe His Lys Ser His Gly Gly Glu Ala Thr Ile Met Val Thr Lys Val Asp Glu Pro Ser Lys Tyr Gly Val Val Val Met Glu Glu Val Thr Gly Met Val Glu Lys Phe Val Glu Lys Pro Lys Ile Phe Val Gly Asn Lys Ile Asn Ala Gly Ile Tyr Leu Leu Asn Pro Ser Val Leu Asp Arg Ile Glu Leu Lys Pro Thr Ser Ile Glu Lys Glu Val Phe Pro Arg Ile Ala Ser Asp Ala Lys Leu Phe Ala Leu Val Leu Pro Gly Phe Trp Met Asp Val Gly Gln Pro Arg Asp Tyr Ile Thr Gly Leu Arg Leu Tyr Leu Asp Ser Leu Arg Lys Arg Ser Thr Asn Arg Leu Ala Thr Gly Ala His Ile Val Gly Asn Val Leu Val His Glu Ser Ala Lys Ile Gly Glu Gly Cys Leu Ile Gly Pro Asp Val Ala Ile Gly Pro Gly Cys Val Val Glu Asp Gly Val Arg Leu Ser Arg Cys Thr Val Met Arg Gly Val His Ile Lys Lys His Ala Cys Ile Ser Asn Ser Ile Ile Gly Trp His Ser Thr Val Gly Gln Trp Ala Arg Ile Glu Asn Met Thr Ile Leu Gly Glu Asp Val His Val Gly Asp Glu Val Tyr Thr Asn Gly Gly Val Val Leu Pro His Lys Glu Ile Lys Ser Ser Ile Leu Lys Pro Glu Ile Val Met
<210> 3
<211>257
<212> DNA
<400> 3
cctccttttatgttatggtatactcaagttcttttaatgcagtatctttagtttatacctgtgatccttccaagatgttgacctagcatgtgtgttactcacattctgaaaactgcttctcaatgagaattcagtgtgccatatttgattgtaccttcatttggaccatccagtaaagttctcaaccctgcaccaagaggaccagaagaaactctttttcctataaaagaagaggatcagccttgtactttgttctt
<210> 4
<211>26
<212> DNA
<400> 4
GC TCTAGAACCATGAAGGCGCTCATT
<210> 5
<211>26
<212> DNA
<400> 5
CAGTCGACCATGACAATCTCAGGCTT
<210> 6
<211>28
<212> DNA
<400> 6
CT CTCGAGCCTCCTTTTATGTTATGGTA
<210> 7
<211>28
<212> DNA
<400>7
CC AGATCTAAGAACAAAGTACAAGGCTG

Claims (8)

1. the application of OsVTC1-1 gene in changing plant salt stress tolerance, is characterized in that: the aminoacid sequence of described genes encoding is shown in SEQ ID NO.2.
2. the application of OsVTC1-1 gene in changing plant salt stress tolerance, is characterized in that: the nucleotides sequence of described gene is classified as shown in SEQ ID NO.1.
3. application as claimed in claim 1 or 2, is characterized in that: described plant is paddy rice.
4. the application as described in claims 1 to 3 any one, is characterized in that: it is the tolerance that reduces plant that described change plant salt is coerced, and its expression that reduces described gene by genetic engineering technique realizes.
5. the application as described in claims 1 to 3 any one, is characterized in that: it is the tolerance that improves plant that described change plant salt is coerced, and it realizes described gene overexpression in plant by genetic engineering technique.
6. contain carrier, transformant or the host cell of the OsVTC1-1 gene described in claim 1.
7. improve the synthetic method of Vc in plant, it is characterized in that: the encoding gene of sequence shown in SEQ ID NO.1 is imported and set out in plant, obtain transgenic plant; Compare with the plant that sets out, the synthetic raising of vitamins C of transgenic plant, salt stress patience strengthens.
8. method according to claim 7, is characterized in that: described encoding gene imports in described plant by recombinant expression vector, and described recombinant expression vector is that the multiple clone site that described encoding gene is inserted to the carrier pCAMBIA1307 that sets out obtains.
CN201410269067.5A 2014-06-17 2014-06-17 Application of OsVTC1-1 in improvement of plant salt stress tolerance Pending CN104004078A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201410269067.5A CN104004078A (en) 2014-06-17 2014-06-17 Application of OsVTC1-1 in improvement of plant salt stress tolerance

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201410269067.5A CN104004078A (en) 2014-06-17 2014-06-17 Application of OsVTC1-1 in improvement of plant salt stress tolerance

Publications (1)

Publication Number Publication Date
CN104004078A true CN104004078A (en) 2014-08-27

Family

ID=51365006

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201410269067.5A Pending CN104004078A (en) 2014-06-17 2014-06-17 Application of OsVTC1-1 in improvement of plant salt stress tolerance

Country Status (1)

Country Link
CN (1) CN104004078A (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113604449A (en) * 2021-07-30 2021-11-05 天津市农业科学院 Mannose-1-phosphate guanylyltransferase, coding gene and application
CN115851760A (en) * 2022-09-01 2023-03-28 广东省农业科学院农业质量标准与监测技术研究所 Rice high-salt-sensitivity mutant gene SS3, mutant SS3 and application

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHENGHONG HUANG等: "Increased sensitivity to salt stress in an ascorbate-deficient arabidopsis mutant", 《JOURANL OF EXPERIMENTAL BOTANY》 *
JELLI VENKATESH等: "Role of L-ascorbate in alleviating abiotic stresses in crop plants", 《BOTANICAL STUDIES》 *
KATHERINE A.LISKO等: "Ontogenetic changes in vitamin C in selected rice varieties", 《PLANT PHYSIOL BIOCHEM.》 *
刘如如: "转基因水稻过表达维生素C代谢相关基因的研究", 《中国优秀硕士学位论文全文数据库 农业科技辑》 *
邓载安: "水稻OsVTC1基因的表达特性与功能分析", 《中国优秀硕士学位论文全文数据库 农业科技辑》 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113604449A (en) * 2021-07-30 2021-11-05 天津市农业科学院 Mannose-1-phosphate guanylyltransferase, coding gene and application
CN115851760A (en) * 2022-09-01 2023-03-28 广东省农业科学院农业质量标准与监测技术研究所 Rice high-salt-sensitivity mutant gene SS3, mutant SS3 and application

Similar Documents

Publication Publication Date Title
ES2243997T3 (en) METABOLISM REGULATION BY MODIFICATION OF THE TREHALOSA-6-PHOSPHATE LEVEL.
Yue et al. SOS1 gene overexpression increased salt tolerance in transgenic tobacco by maintaining a higher K+/Na+ ratio
CN109456982B (en) Application of rice OsMYB6 gene and encoding protein thereof in drought resistance and salt resistance
CN104877993A (en) Two plant eIF4A genes and application thereof in preparation of transgenic rice stripe virus resistant plant body
CN101631867A (en) Compositions and methods using RNA interference of CDPK-like for control of nematodes
CN103555740A (en) Wheat CBL-CIPK (CBL-interacting protein kinase) stress tolerance regulatory factor as well as encoding gene and application thereof
CN107299103B (en) Thick boisiana IpASR gene and its coding albumen and application
CN110643630A (en) Application of KNAT1 gene in improving salt stress resistance of plants
CN104388448B (en) A kind of corn phospholipase A_2 gene ZmsPLA2-1 and its application
CN112111510B (en) Application of Oscpy and encoded protein thereof in improving rice quality
CN102242118B (en) Method for improving characters of gossypol in cotton, and use thereof
CN104004078A (en) Application of OsVTC1-1 in improvement of plant salt stress tolerance
CN103183731B (en) Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof
CN108707594B (en) 1 gene family of -1 related protein kinase of maize sucrose non-fermented and its application
CN102010864B (en) Maize pollen tissue specific promoter and expression vector thereof
Seng et al. ADP-glucose pyrophosphorylase gene plays a key role in the quality of corm and yield of cormels in gladiolus
CN114085854B (en) Drought-resistant and salt-tolerant gene OsSKL2 for rice and application thereof
CN113957085B (en) Application of clematis isoprenoyl transferase PT1 gene, and overexpression Arabidopsis thaliana strain and construction method thereof
CN105349574A (en) Method for inhibiting corn ZmDAR1 family gene expression to increase yield of core grains
CN103911386A (en) Artificial fusion gene for improving stress tolerance of plants
JPWO2006057306A1 (en) Gramineae plant with improved stress tolerance and / or productivity, and method for producing the same
CN103088056A (en) Application of gene PHYB in controlling paddy rice low temperature stress tolerance
CN103710380B (en) The application in promoting plant vitamin C synthesis of the OsVTC1-3 albumen
CN102154320B (en) Chrysanthemum anti-retroelement DgZFP1, plant expression vector thereof, construction method thereof and application thereof
CN105255914A (en) Lycium barbarum mitogen activated protein kinase kinase and application in improving saline-alkaline tolerance of plant

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication

Application publication date: 20140827

RJ01 Rejection of invention patent application after publication