CN104004066B - Prevention suppresses inflammatory reaction and micromolecule polypeptide and its application of angiogenesis - Google Patents
Prevention suppresses inflammatory reaction and micromolecule polypeptide and its application of angiogenesis Download PDFInfo
- Publication number
- CN104004066B CN104004066B CN201310060727.4A CN201310060727A CN104004066B CN 104004066 B CN104004066 B CN 104004066B CN 201310060727 A CN201310060727 A CN 201310060727A CN 104004066 B CN104004066 B CN 104004066B
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- group
- inflammation
- amino acid
- eye
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
Micromolecule polypeptide and its application the present invention relates to preventing and suppressing inflammatory reaction and angiogenesis.The invention further relates to the preparation method of the micromolecule polypeptide and the pharmaceutical composition containing the polypeptide.Polypeptide of the present invention has various advantages, and such as molecular weight is small, can pass through various ocular tissue's barriers；Good water solubility, can keep concentration higher in neutral tear, aqueous humor and vitreum；Synthesis is simple, preparation cost is low.
Description
Technical field
The present invention relates to biomedicine field, in particular it relates to class prevention and/or treatment inflammatory reaction and blood
The newborn micromolecule polypeptide of pipe and its application.
Background technology
Inflammation is the body tissue with vascular system to a kind of complicated life produced by the destructive stimulus of internal and external environment
Reason and pathological reaction.It is both a kind of protectiveness defense reaction, is also the co-channel for causing the various important diseases of human body, is such as felt
Dye, tumour, cardiovascular and cerebrovascular diseases, neurodegeneration, allergic disease and autoimmune disease etc..Pathogenic infection,
The stimulus such as various interior exogenous damages are persistently present, and can stimulate panimmunity and inflammatory cell, start adaptive immunity, are situated between
Lead the generation of various proinflammatory cytokines, bioactivator and growth factor, such as TNF-α, IL-1 β, IL-6, CCL, CXCL,
COX-2, active oxygen (ROS), adhesion molecule, VEGF and TGF-β etc., so occur Cascaded amplification effect, cause tissue and carefully
The various pathological reactions such as cellular damage, propagation, migration, apoptosis, autophagy, necrosis, new vessels formation.
And pathologic neovascularization is also the pathologic basis of various whole bodies and local disease, including neovascular eye
Disease, tumor neogenetic blood vessels, rheumatic arthritis, psoriasis etc., it is related to propagation, migration, erosion and the pipe of vascular endothelial cell
Multiple processes such as chamber formation, by the strict regulation and control of angiogenic growth factor and suppression angiogenesis factor balance, this balance quilt
Start the cell signal of angiogenesis by breaking, so as to cause it to occur.
Inflammation and new vessels occur in pathogenesis and involve the aspects such as disease and have close contact as can be seen here.Together
Various diseases of sample eye, such as corneal infection, uveitis, inflammation related glaucoma, neovascular glaucoma, diabetes
Property PVR, retinopathy of prematurity, retinal periphery phlebitis, retinal vein obstruction, senile macular degeneration
Deng, inflammatory infiltration all with ocular tissue, ooze out, the pathological change such as neovascular bleeding and fibrosis it is closely related, cause to suffer from
The visual function of person is badly damaged, and then influences its quality of life.
However, the treatment method of this kind of disease is extremely limited at present, effect also owes ideal, and security still needs further to be recognized
It is fixed.Main treatment method presses down locally or systemically to use glucocorticoid, immunodepressant, anti-tnf-alpha antagonist and VEGF
Preparation etc..These medicines can generally play certain curative effect, but due to the recurrent and intractable of such disease, long-term use swashs
Element and immunodepressant can cause intraocular pressure rising, cataract, entophthamia, osteoporosis, hepatic and renal function damage, diabetes etc. serious
Complication；And there is the wind for aggravating or inducing demyelinating disease, bilateral front portion optic neuropathy, pulmonary tuberculosis etc. in TNF-α antagonist
Danger.The medicine of TNF-α and VEGF inhibitor class is large biological molecule simultaneously, by the shadow that eye is dissected and function barrier is limited
Ring, be locally or systemically administered it is difficult to reach preferable bioavilability in ocular tissue；Secondly, eyeball is that human body one is special exempts from
Epidemic disease exempts organ, and above-mentioned exogenous large biological molecule protein drug repeatedly enters eyeball, may induce antigen-antibody reaction,
Triggering aggravates inflammation of eye section damage；In addition, this kind of biological agent such as anti-tnf-alpha, VEGF is smaller compared to toxicity compared with conventional medicament,
Action target spot is clearer and more definite, but the synthesis of these biotherapeutics is complicated, high to biotechnology downstream process and production requirement, therefore
So that its is expensive, certain obstacle is formed to its wide popularization and application.
As can be seen here, find the small molecule anti-inflammatory with specific biological activities and good biocompatibility and resist new green blood
Pipe medicine, can pass through Ge Ceng ocular tissues barrier through noninvasive or minimally invasive method of administration, the local bioavilability of eye be improved, to subtract
Few side effect locally and systemically, it has also become above-mentioned various one problem demanding prompt solution in blinding illness in eye clinical treatment field.
The content of the invention
It is many it is an object of the invention to provide a kind of small molecule with preventing and treating inflammatory reaction and angiogenesis double action
Peptide and its application.
In the first aspect of the present invention, there is provided the polypeptide that a kind of following formula I is represented, or its pharmaceutically acceptable salt
[Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-
[Xaa9]-[Xaa10]-[Xaa11]-[Xaa12]-[Xaa13]-[Xaa14]-[Xaa15]-[Xaa16]-[Xaa17]-
[Xaa18]-[Xaa19]-[Xaa20]-[Xaa21]-[Xaa22]-[Xaa23]-[Xaa24](I)
In formula,
Xaa0 is nothing, or 1-3 Amino acid profile peptide fragment；
Xaa1 is the amino acid being selected from the group：Lys, Arg, Gln or Asn；
Xaa2 is the amino acid being selected from the group：Asp or Glu；
Xaa3 is the amino acid being selected from the group：Lys, Arg, Gln or Asn；
Xaa4 is the amino acid being selected from the group：Ala, Val, Leu or Ile；
Xaa5 is the amino acid being selected from the group：Met, Leu, Phe or Ile；
Xaa6 is the amino acid being selected from the group：Leu, Ile, Val, Met, Ala or Phe；
Xaa7 is the amino acid being selected from the group：Phe, Leu, Val, Ile, Ala or Tyr；
Xaa8 is the amino acid being selected from the group：Thr or Ser；
Xaa9 is the amino acid being selected from the group：Tyr, Trp, Phe, Thr or Ser；
Xaa10 is the amino acid being selected from the group：Asp or Glu；
Xaa11 is the amino acid being selected from the group：Gln or Asn；
Xaa12 is the amino acid being selected from the group：Tyr, Trp, Phe, Thr or Ser；
Xaa13 is the amino acid being selected from the group：Gln or Asn；
Xaa14 is the amino acid being selected from the group：Glu or Asp；
Xaa15 is the amino acid being selected from the group：Asn, Gln, His, Lys or Arg；
Xaa16 is the amino acid being selected from the group：Asn, Gln, His, Lys or Arg；
Xaa17 is the amino acid being selected from the group：Val, Ile, Leu, Met, Phe or Ala；
Xaa18 is the amino acid being selected from the group：Asp or Glu；
Xaa19 is the amino acid being selected from the group：Gln or Asn；
Xaa20 is the amino acid being selected from the group：Ala, Val or Leu, Ile；
Xaa21 is the amino acid being selected from the group：Ser or Thr；
Xaa22 is the amino acid being selected from the group：Gly, Pro or Ala；
Xaa23 is the amino acid being selected from the group：Ser or Thr；
Xaa24 is nothing, or 1-3 Amino acid profile peptide fragment；
And the length of described polypeptide is 23~29 amino acid.
More preferably, described peptide fragment is
Xaa1 is the amino acid being selected from the group：Lys or Arg；
Xaa2 is the amino acid being selected from the group：Asp or Glu；
Xaa3 is the amino acid being selected from the group：Lys or Arg；
Xaa4 is the amino acid being selected from the group：Ala or Val；
Xaa5 is the amino acid being selected from the group：Met or Leu；
Xaa6 is the amino acid being selected from the group：Leu or Ile；
Xaa7 is the amino acid being selected from the group：Phe or Leu；
Xaa8 is the amino acid being selected from the group：Thr or Ser；
Xaa9 is the amino acid being selected from the group：Tyr or Phe；
Xaa10 is the amino acid being selected from the group：Asp or Glu；
Xaa11 is the amino acid being selected from the group：Gln or Asn；
Xaa12 is the amino acid being selected from the group：Tyr or Phe；
Xaa13 is the amino acid being selected from the group：Gln or Asn；
Xaa14 is the amino acid being selected from the group：Glu or Asp；
Xaa15 is the amino acid being selected from the group：Asn or Gln；
Xaa16 is the amino acid being selected from the group：Asn or Gln；
Xaa17 is the amino acid being selected from the group：Val or Leu；
Xaa18 is the amino acid being selected from the group：Asp or Glu；
Xaa19 is the amino acid being selected from the group：Gln or Asn；
Xaa20 is the amino acid being selected from the group：Ala or Val；
Xaa21 is the amino acid being selected from the group：Ser or Thr；
Xaa22 is the amino acid being selected from the group：Gly or Ala；
Xaa23 is the amino acid being selected from the group：Ser or Thr；
Xaa24 is nothing.
In another preference, Xaa0 is the 1-3 peptide fragment of Amino acid profile, more preferably, 1-2.
In another preference, Xaa24 is the 1-3 peptide fragment of Amino acid profile, more preferably 1-2.
In another preference, the polypeptide length is 22-29 amino acid.
In another preference, the polypeptide is selected from the group：
A () has SEQ ID NO:The polypeptide of amino acid sequence shown in 2；
B () is by SEQ ID NO:Amino acid sequence shown in 2 by 1-6 (it is preferred that 1-4, more preferably 1-3, most preferably
Ground 1-2) substitution of amino acid residue, missing or addition and formed, and with suppressing inflammatory reaction and angiogenesis function
As polypeptide derived from (a).
In another preference, described derivative polypeptide remains >=70% SEQ ID NO:The suppression of 2 shown polypeptide
Inflammatory reaction and the activity of angiogenesis inhibiting.
In another preference, described derivative polypeptide and SEQ ID NO:2 homogeny >=80%, preferably >=90%；
More preferably >=95%.
In the second aspect of the present invention, there is provided a kind of nucleic acid molecules of separation, it encodes the polypeptide described in first aspect.
In another preference, described nucleic acid molecules have SEQ ID NO:Sequence shown in 1.
In the third aspect of the present invention, there is provided a kind of pharmaceutical composition, it contains：
Polypeptide described in (a) first aspect or its pharmaceutically acceptable salt；With
(b) pharmaceutically acceptable carrier or excipient.
In another preference, the formulation of the composition is eyedrops, injection, gel for eye use or spongaion.
In another preference, described composition is alleviation formulation.
In the fourth aspect of the present invention, there is provided the purposes of polypeptide or pharmaceutically acceptable salt described in first aspect,
For preparing medicine, the medicine is used to suppress inflammatory reaction and angiogenesis, and/or the medicine is used to prevent and treat
(a) inflammation related disease；(b) new vessels relevant disease.
In another preference, described inflammation related disease is selected from the group：It is ocular inflammatory disease, pancreatitis, inflammatory
Enteropathy, lung inflammation, contact dermatitis, rheumatoid arthritis, ankylosing spondylitis；
Described relevant diseases of angiogenesis is selected from the group：Neovascular eye diseases, tumour, ischemic heart disease, non-inflammation
Disease property cardiomyopathy, coronary sclerosis, arteriosclerosis, arterial embolism, arterial thrombus, Berger's diseases, chronic inflammation,
IBD, ulcer, rheumatic arthritis, scleroderma, psoriasis, sterility and sarcoma shape disease.
In another preference, the chemoprophylaxis or be selected from the group related to inflammation for the treatment of and with new vessels phase
Related disorders：Eye cornea infection, uveitis, inflammation related glaucoma, neovascular glaucoma, diabetic retinal
Lesion, retinopathy of prematurity, retinal periphery phlebitis, senile macular degeneration, IBD, contact dermatitis,
Rheumatoid arthritis, ankylosing spondylitis
In the fifth aspect of the present invention, there is provided a kind of method of suppression inflammation in mammals, applied to the object for needing
Polypeptide of the present invention or its pharmaceutically acceptable salt.
In another preference, described couple as if people.
In another preference, described inflammatory reaction is the inflammatory reaction related to uveitis.
It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the invention and have in below (eg embodiment)
Can be combined with each other between each technical characteristic of body description, so as to constitute new or preferred technical scheme.As space is limited, exist
This no longer tires out one by one states.
Brief description of the drawings
Drawings below is used to illustrate specific embodiments of the present invention, rather than limits what is be defined by the claims
The scope of the invention.
Fig. 1 shows the photo of rat prosthomere, and anterior chamber's lesser ring of Merkel of wherein LPS groups animal has a large amount of fibrin formations, causes
Occlusion of pupil, the obvious dilatation and congestion of iris vessels；And only visible iris vessels hyperemia is bright in KS23 groups and dexamethasone intervention group
It is aobvious, but have no obvious fibrin formation film.
Fig. 2 shows the histotomy of rat eye, and wherein KS23 intervention groups are oozed out bright compared with LPS groups in the cell of anterior chamber angle
It is aobvious to reduce；And KS23 groups are also clearly better depending on cellular infiltration before nipple compared with LPS groups；And had not seen in blank control group any
Cellular infiltration.
Fig. 3 shows the measurement result that aqueous humor total protein and cell ooze out, and after Fig. 3 (a) was for LPS modelings 24 hours, gives
Protein level is substantially reduced in KS23 or dexamethasone intervention group aqueous humor.Fig. 3 (b) shows KS23 groups and Dexamethasone group aqueous humor
Middle cell oozes out quantity and is significantly reduced compared with LPS groups.
Fig. 4 shows MTS cell viability testing results, under various concentrations, MTS absorbances and control group indifference.
Fig. 5 shows the inflammatory factor detection that LPS induces after stimulating, and wherein Fig. 5 (a) is shown in terms of IL-6,10 μM
KS23 groups and 50 μM of KS23 groups are significantly reduced compared with LPS groups, and 1 μM of KS23 group and LPS groups are without significant difference；Fig. 5 (b) shows
For TNF-α, 10 μM and 50 μM of KS23 intervention group TNF-α levels are substantially reduced compared with LPS groups, 1 μM of KS23 groups TNF-α and LPS
Group is without significant difference.
Fig. 6 (a) and (b) respectively illustrate KS23 has dose-dependent suppression to the transcript and expression of IL-6 and TNF-α
Effect.
Fig. 7 shows that the filter paper (outstanding 50 μM of groups) of KS23 treatment substantially inhibits subtracting for chick chorioallantoic membrane vessel branch number
Few, MVC is significantly reduced compared with PBS groups.
Fig. 8 shows that KS23 intervention groups (50 μM) non-area coverage of cut area cell substantially increases compared with VEGF stimulation groups, carries
Show that KS23 intervenes the migration of the endothelial cell for considerably reducing VEGF inductions.
Specific embodiment
The present inventor is prepared for a kind of with suppression inflammatory reaction and angiogenesis first by in-depth study extensively
Dual-use function, micromolecule polypeptide of the molecular weight less than 3KD (about 2652D).Specifically, the present inventor applies bioinformatics
Method, based on homology analysis and biological characteristics etc. analysis, have selected several candidate sequences, synthesized using solid phase method
Afterwards, then through the uveitis model and chick chorioallantoic membrane model discrimination of experimental endotaxin induction, a kind of new, tool is obtained
There are the micromolecule polypeptide for suppressing inflammation of eye section immune response and angiogenesis function, i.e. KS23.
The molecular weight of small peptide KS23 of the invention is small, can pass through various ocular tissue's barriers；Good water solubility, can be in neutral tear
Concentration higher is kept in liquid, aqueous humor and vitreous humor；It is safe, it is small to biological tissue's toxic and side effect；The life of eye local application
Thing availability is high, is conducive to reducing systemic side effects.The present invention is completed on this basis.
Active peptides
In the present invention, term " polypeptide of the present invention ", " KS23 polypeptides ", " KS23 small peptides " or " peptide KS23 " is interchangeable makes
With all referring to peptide KS23 amino acid sequences (the SEQID NO with inflammatory reaction and neovascularization inhibiting activity:2,
KDKAMLFTYDQYQENNVDQASGS albumen or polypeptide).Additionally, the term also includes having suppressing inflammatory reaction and blood
Pipe new life function, SEQ ID NO：The variant form of 2 sequences.These variant forms include (but being not limited to)：1-6 (logical
Often be 1-5, preferably 1-3, more preferably 1-2, most preferably 1) missing of amino acid, insertion and/or replace, at C ends
End and/or N-terminal add one or several (usually 5 within, within preferably 3, more preferably within 2) amino
Acid.For example, in the art, when being replaced with similar nature or similar amino acid, will not generally change the work(of protein
Energy.Adding one or several amino acid in C-terminal and/or N-terminal will not generally also change the 26S Proteasome Structure and Function of protein.This
Outward, the term also includes the polypeptide of the present invention of monomer and multimeric forms.
Active fragment, derivative and analog present invention additionally comprises KS23 albumen.As used herein, term " fragment ",
" derivative " and " analog " refers to be kept substantially the polypeptide for suppressing inflammatory reaction and angiogenesis function or activity.The present invention
Polypeptide fragment, derivative or the like can be that (i) has one or more conservative or non-conservative amino acid residues (preferably to protect
Keep acidic amino acid residue) substituted polypeptide, or (ii) polypeptide with substituted radical in one or more amino acid residues,
Or (iii) KS23 polypeptides and another compound (such as extending the compound of polypeptide half-life period, such as polyethylene glycol) fusion institute
The polypeptide of formation, or the polypeptide that (iv) additional amino acid sequence is blended in this polypeptide sequence and is formed is (with targeting sequencing, secretion
The sequence label such as sequence or 6His is merged and formed and then albumen).According to teaching herein, these fragments, derivative and class
The scope like known to thing belongs to those skilled in the art.
The preferred reactive derivative of one class refers to compared with the amino acid sequence of Formulas I there is at most 5, preferably at most 3,
More preferably at most 2, most preferably 1 amino acid is replaced by the similar or close amino acid of property and forms polypeptide.These are protected
Keeping property Variant polypeptides carry out amino acid substitution and produce preferably based on table 1.
Table 1
| Initial residue | Representational substitution | Preferred substitution |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Invention also provides the analog of KS23 polypeptides.These analogs can be amino acid with the difference of natural KS23 polypeptides
Difference in sequence, or the difference for not influenceing on the modified forms of sequence, or have both at the same time.Analog also includes tool
There is the analog of the residue (such as D- amino acid) different from natural L-amino acids, and with non-naturally occurring or synthesis ammonia
The analog of base acid (such as β, gamma-amino acid).It should be understood that polypeptide of the invention be not limited to it is above-mentioned enumerate it is representational many
Peptide.
Modification (not changing primary structure generally) form includes：The chemically derived form such as acetyl of inner or in vitro polypeptide
Change or carboxylated.Modification also includes glycosylation, and such as those are carried out in the synthesis and processing of polypeptide or in further processing step
It is glycosylation modified and produce polypeptide.This modification can by by polypeptide exposed to carrying out glycosylated enzyme (such as mammal
Glycosylase or deglycosylating enzyme) and complete.Modified forms also include thering is phosphorylated amino acid residue (such as phosphoric acid junket ammonia
Acid, phosphoserine, phosphothreonine) sequence.Also include being modified so as to improve its anti-proteolysis performance or optimization
The polypeptide of solubility property (such as all SEQ IDNO：What 2 amino acid sequences were combined with D- types amino acid and inverted order
Retro-inverso peptides).
Polypeptide of the present invention can also with as pharmaceutically or physiology it is acceptable acid or alkali derived from salt form use.These
Salt includes but is not limited to the salt formed with following acid：Hydrochloric acid, hydrobromic acid, sulfuric acid, citric acid, tartaric acid, phosphoric acid, lactic acid,
Pyruvic acid, acetic acid, butanedioic acid, oxalic acid, fumaric acid, maleic acid, oxaloacetic acid, methanesulfonic acid, ethyl sulfonic acid, benzene sulfonic acid or hydroxyl second sulphur
Acid.Other salt include：The salt formed with alkali metal or alkaline-earth metal (such as sodium, potassium, calcium or magnesium), and with ester, carbamate
Or the form of " pro-drug " of other routines.
Coded sequence
The invention further relates to the polynucleotides of encoded K S23 polypeptides.A kind of preferred coded sequence is
AAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGT GGACCAGGCCTCCGGCTCT(SEQ ID
NO:1)。
Polynucleotides of the invention can be DNA form or rna form.DNA can be coding strand or noncoding strand.Coding
The coding region sequence of mature polypeptide can be with SEQ ID NO:Coding region sequence shown in 1 is identical or variant of degeneracy.
As used herein, " variant of degeneracy " refers in the present invention that coding has SEQ ID NO:2 protein, but with SEQ ID
NO:The differentiated nucleotide sequence of corresponding encoded region sequence in 1.
KS23 nucleotides full length sequence of the invention or its fragment can generally use PCR TRAPs, recombination method or artificial conjunction
Into method obtain.At present, it is already possible to obtain encoding completely by chemical synthesis polypeptide of the present invention (or its fragment, or its
Derivative) DNA sequence dna.Then the DNA sequence dna can be introduced various existing DNA moleculars as known in the art (or as carried
Body) and cell in.
The present invention also relates to the carrier comprising polynucleotides of the invention, and compiled with carrier of the invention or KS23 albumen
The host cell that code sequence is produced through genetic engineering.
On the other hand, have present invention additionally comprises the polypeptide to KS23DNA or its fragment coding specific polyclonal
Antibody and monoclonal antibody, especially monoclonal antibody.
Preparation method
Polypeptide of the present invention can be recombinant polypeptide or synthesis polypeptide.Polypeptide of the invention can be chemical synthesis, or weight
Group.Correspondingly, polypeptide of the present invention can be artificial synthesized with conventional method, it is also possible to which recombination method is produced.
It is a kind of it is preferable that with liquid phase synthesis techniques or solid phase synthesis technique, such as Boc solid phase methods, Fmoc solid phase methods
Or two methods are used in combination.Synthesis in solid state can quickly obtain sample, can be according to the sequence signature of purpose peptide from appropriate
Resin carrier and synthesis system.For example, preferred solid phase carrier is such as connected with the Wang trees of C-terminal amino acid in peptide in Fmoc systems
Fat, Wang resin structures are 4- alkoxy benzylalcohols for the arm between polystyrene, with amino acid；With 25% hexahydropyridine/dimethyl
Formamide room temperature treatment 20 minutes, to remove Fmoc blocking groups, and according to given amino acid sequence from C-terminal one by one to N-terminal
Extend.After the completion of synthesis, the proinsulin related peptide for synthesizing is cut from resin with the trifluoroacetic acid containing 4% p-methyl phenol
Get off and remove protection group, may filter that except ether precipitate and separate obtains thick peptide after resin.After the solution of products therefrom is freezed, use
Peptide needed for gel filtration and the purifying of reverse phase HPLC method.When synthesis in solid state is carried out using Boc systems, preferred resin
To be connected with the PAM resins of C-terminal amino acid in peptide, PAM resin structures are 4- hydroxyl first for the arm between polystyrene, with amino acid
Base phenyl acetamide；In Boc synthesis systems, in deprotection, the circulation for neutralizing, being coupled, removed with TFA/ dichloromethane (DCM)
Blocking group Boc and with diisopropylethylamine (DIEA/ dichloromethane neutralize.After the completion of peptide chain condensation, with containing p-cresol (5-
10%) hydrogen fluoride (HF), is processed 1 hour at 0 DEG C, and peptide chain is cut from resin, while removing blocking group.With 50-
80% acetic acid (containing a small amount of mercaptoethanol) extracting peptide, further with molecular sieve Sephadex G10 or Tsk-40f point after solution is lyophilized
From purifying, then required peptide is obtained through the purifying of high pressure liquid phase again.Known various coupling agents in chemistry of peptides field can be used
Each amino acid residue is coupled with coupling method, for example, dicyclohexylcarbodiimide (DCC), hydroxyl benzotriazole can be used
Or urea hexafluorophosphoric acids ester (HBTU) of 1,1,3,3- tetra- are directly coupled (HOBt).For the small peptide that obtains of synthesis, its purity with
Structure can be confirmed with RP-HPLC and mass spectral analysis.
In a preference, polypeptide KS23 of the present invention by its sequence, is prepared, the efficient liquid of row using the method for synthesis in solid state
Phase chromatogram purification, obtains high-purity purpose peptide freeze-dried powder, -20 DEG C of storages.
Another method is to produce polypeptide of the present invention with recombinant technique.By conventional recombinant DNA technology, using this hair
Bright polynucleotides are used for expressing or producing the KS23 polypeptides of restructuring.In general there are following steps：
(1) with the polynucleotides (or variant) of encoded K S23 polypeptides of the invention, or with the weight containing the polynucleotides
The conversion of group expression vector or suitable host cell of transduceing；
(2) host cell cultivated in suitable culture medium；
(3) separation, protein purification from culture medium or cell.
Recombinant polypeptide can be expressed or be secreted into extracellular in the cell or on cell membrane.If desired, it can be utilized
Physics, chemistry and other characteristics separated by various separation methods and purification of Recombinant albumen.These methods are this areas
Known to technical staff.The example of these methods is included but is not limited to：Conventional renaturation process, processed with protein precipitant
(salting-out method), centrifugation, the broken bacterium of infiltration, super treatment, ultracentrifugation, sieve chromatography (gel filtration), adsorption chromatography, ion exchange
The combination of chromatography, high performance liquid chroma- tography (HPLC) and other various LC technologies and these methods.
Because polypeptide of the present invention is shorter, it can be considered to multiple polypeptides are cascaded, table is obtained after recombination expression
Up to product, required small peptide is then formed by methods such as digestions.
Pharmaceutical composition and application process
On the other hand, present invention also offers a kind of pharmaceutical composition, it contains the polypeptide of the present invention of (a) safe and effective amount
Or its pharmaceutically acceptable salt；And (b) pharmaceutically acceptable carrier or excipient.The quantity of polypeptide of the present invention is usually
10-100 milligrams of micrograms/agent, preferably 100-1000 micrograms/agent.
For the purposes of the present invention, effective dosage is to give individual about 0.01 mg/kg to 50 mg/kgs, compared with
The polypeptide of the present invention of good ground 0.05 mg/kg to 10 mg/kg body weight.Additionally, polypeptide of the invention can also may be used with alone
It is used together (as prepared in same pharmaceutical composition) with other therapeutic agents.
Pharmaceutical composition can also contain pharmaceutically acceptable carrier.Term " pharmaceutically acceptable carrier " refers to for controlling
Treat the carrier of agent administration.The term refers to such some medicament carriers：Themselves do not induce and produce to receiving the individual of said composition
The harmful antibody of body, and there is no undue toxicity after administration.These carriers are well known to those of ordinary skill in the art.
Can be found on pharmaceutically in Remington's Pharmaceutical Sciences (Mack Pub.Co., N.J.1991)
Acceptable excipient is discussed fully.This kind of carrier includes (but being not limited to)：Salt solution, buffer solution, glucose, water, glycerine,
Ethanol, adjuvant, and combinations thereof.
Acceptable carrier can contain liquid, such as water, salt solution, glycerine and ethanol in therapeutic composition Chinese pharmacology.In addition,
Complementary material, such as wetting agent or emulsifying agent, pH buffer substance are there is likely to be in these carriers.
Generally, therapeutic composition can be made injectable agent, such as liquid solution or suspension；May also be fabricated which before the injection
In being adapted to allocate into solution or suspension, the solid form of liquid-carrier.
Once being made into composition of the invention, conventional route can be passed through and be administered, including (but do not limit
In)：Intraocular, intramuscular, intravenous, subcutaneous, intracutaneous or local administration.Wait that the object for preventing or treating can be animal；Especially
People.
When pharmaceutical composition of the invention is used for actual therapeutic, various different dosage forms can be used according to service condition
Pharmaceutical composition.It is preferred that what can be enumerated has eye drops, injection, gel for eye use and spongaion.
These pharmaceutical compositions can be prepared by mixing, dilution or dissolving according to conventional methods, and be added once in a while
Plus suitable medicated premix, such as excipient, disintegrant, adhesive, lubricant, diluent, buffer, isotonic agent
(isotonicities), preservative, wetting agent, emulsifying agent, dispersant, stabilizer and cosolvent, and the process for preparation can root
Carried out with usual way according to formulation.
For example, the preparation of eye eye drops can be carried out so：By small peptide KS23 or its pharmaceutically acceptable salt with it is basic
Material is dissolved in sterilized water (being dissolved with surfactant in sterilized water) together, adjusts osmotic pressure and acid-base value to physiology shape
State, and can arbitrarily add suitable medicated premix such as preservative, stabilizer, buffer, isotonic agent, antioxidant and thickening
Agent, is then completely dissolved it.
Pharmaceutical composition of the invention can be administered with sustained release formulation.For example, small peptide KS23 or its salt can be impregnated in
During release polymer is for the pill or micro-capsule of carrier, then by the pill or micro-capsule by implantation tissue to be treated of performing the operation.This
Outward, small peptide KS23 or its salt can also be pre-coated with the intraocular lens of medicine and be applied by insertion.As release polymer
Example, what can be enumerated has ethylene-vinylacetate copolymer, poly- hydroxyl-metacrylate
(polyhydrometaacrylate), polyacrylamide, polyvinylpyrrolidone, methylcellulose, lactic acid polymer, lactic acid-
Ethanol copolymer etc., what can preferably be enumerated is that biodegradable polymer such as lactic acid polymer and lactic acid-ethanol are total to
Polymers.
When pharmaceutical composition of the invention is used for actual therapeutic, as the small peptide KS23 of active component or its pharmaceutically
The dosage of acceptable salt, can according to the body weight of each patient to be treated, the age, sex, symptom degree and be reasonably subject to
It is determined that.For example, when Local eye drop, usual its concentration is about 0.1~10wt%, and preferably 1~5wt%, can give for 2~6 times daily
Medicine, 1~5 drips every time.
Inflammation related disease
As used herein, term " inflammation related disease " include it is various infection or non-infection reason caused by local inflammation because
Son aggregation simultaneously causes the damage of local organization, oozes out and proliferative disease.
TNF-α and IL-6, be otherwise known as Pro-inflammatory mediator, is the crucial cell factor of inflammatory reaction, mainly by living
Macrophage and monocyte of change etc. are produced, and be can induce inflammatory cell recruitment, are promoted cell factor, arachidonic acid-type and
The synthesis of nitrogen oxide etc., early stage the infection such as host's nonspecific defense bacterium, virus, stress with maintain inflammatory reaction in
Play vital effect
Polypeptide KS23 of the invention has the activity of obvious anti-inflammatory immune response, is mainly manifested in：KS23 polypeptides can
Suppress the endotoxin-induced uveitis of rats reaction of endotoxin (LPS) induction, reduce the infiltration of inflammatory cell in anterior chamber, vitreum and retina
With oozing out for albumen, RAW264.7 mouse macrophages release TNF-α and the IL-6 inflammatory factors of LPS activation can be suppressed in vitro.
Therefore, the polypeptide of the present invention diseases associated with inflammation related to TNF-α, IL-6, VEGF has therapeutic action, such as eye angle
The related glaucoma of film infection, uveitis, inflammation, neovascular glaucoma, BDR, premature regard
Retinopathy, retinal periphery phlebitis, senile macular degeneration, IBD, contact dermatitis, rheumatoid joint
Inflammation, ankylosing spondylitis etc..
Relevant diseases of angiogenesis
VEGF is the center induction medium of angiogenesis cascade reaction, its inducible endothelial cell proliferation, migration and tube chamber
Formed, important work is played in various diseases such as tumor neogenetic blood vessels, neovascular eye diseases, rheumatic arthritis develop
With.
In the present invention, relevant diseases of angiogenesis is not particularly limited, including as known in the art various and blood vessel
Newborn related disease.The representational exemplary disorders related to angiogenesis include (but being not limited to)：Neovascular eye
Disease, tumour, ischemic heart disease, non-inflammation cardiomyopathy, coronary sclerosis, arteriosclerosis, arterial embolism, artery
Thrombus, Berger's diseases, chronic inflammation, IBD, ulcer, rheumatic arthritis, scleroderma, psoriasis, sterility or
Sarcoma shape disease etc..
Preferably, described neovascular eye diseases include (but being not limited to)：Involve choroid, retina, cornea or
Iris, including senile macular degeneration, proliferative diabetic retinopathy, retinal vessel blocking property disease, premature are regarded
Retinopathy, corneal infection, neovascular glaucoma etc..
KS23 polypeptides of the present invention can also hinder the endothelial cell of the new life of chick chorioallantoic membrane blood vessel, antagonism VEGF inductions to move
Move, therefore, polypeptide of the present invention can be used for angiogenesis inhibiting so as to treat relevant diseases of angiogenesis.
Industrial applicability
Containing peptide of the present invention or its pharmaceutically-acceptable salts as active component pharmaceutical composition, to inflammatory and immune response
There is significant inhibitory activity.Confirmed through in body animal experiment, polypeptide of the present invention can suppress the experimental grape of endotaxin induction
The scorching ocular inflammatory response of film.
Main advantages of the present invention include：
A the molecular weight of () polypeptide of the present invention is small, can pass through various ocular tissue's barriers；
B () good water solubility, can keep concentration higher in neutral tear, aqueous humor and vitreous humor；
C () is safe, small to biological tissue's toxic and side effect；
D () can be prepared by the method for synthesis in solid state, purity is high, and yield is big, low cost.
Therefore polypeptide of the present invention is expected to develop into medicine, for treating and inflammation and new vessels relevant disease.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than limitation the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to conventional strip
Part such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory
Press, 1989) described in condition, or according to the condition proposed by manufacturer.
Embodiment 1
The synthesis of polypeptide
It is SEQ ID NO to use commercially available SYMPHONY Peptide synthesizers composition sequence:2 KS23 polypeptides.Step is as follows：
1. the protected amino acid solution required for preparing, and condensation reagent, cutting reagent, in instrument phase are calculated according to software
Enough DMF, DCM are added in the bottle answered
2. 100umol FMOC-Ala-Wang-Resin are added in the reactor,
3. the centrifuge tube such as 15mg is put on the pipeline for collecting cutting liquid.
4. edit routine, swelling time of general resin is 30min, the deprotection time be 5min, 15min twice, condensation
Time is 30 minutes, and cutting process is 2h.
5. start synthesizes according to program.
6. last to precipitate cutting liquid ether, centrifugation, drying is purified with HPLC.
120mg polypeptide KS23 are obtained, are white powder (good water solubility), purity：>95%.Sealing, -20 degree are saved backup.
Embodiment 2
The effect of the experimental uveitis of KS23 induced by endotoxin induction
1. materials and methods：
1.1 materials and key instrument equipment：Wistar rats are purchased from the western pul-Bi Kai experimental animals Co., Ltd in Shanghai；
Endotoxin (LPS, E.coli055：B5 Sigma companies) are purchased from.
1.2 modellings and Intervention trial：Rat is randomly divided into 4 groups (n=6)：
Blank control group；
LPS modeling groups；
50 μ g KS23 intravitreal injection intervention groups；
10ug dexamethasone vitreous body injects intervention group.
After rat gives the amobarbital 0.4ml/100g body weight general anesthesias of intraperitoneal injection 5%, compound support bicalutamide and Ding Ka
Expand pupil and table fiber crops because local.50ug/10uL KS23 solution is extracted with insulin injection syringe, under surgical operation microscope, from angle Gong Yuan
After nearby avoiding clearly getting a glimpse of injection needle in blood vessel inserting needle, vitreous chamber, small peptide solution is slowly injected into, after stopping 10 seconds, delayed
It is slow to extract syringe needle.After 30min, rat hindleg vola is wiped with cotton ball soaked in alcohol, with insulin needle injection 200ug/100uL LPS
Solution.
1.3 aqueous humors are gathered and detected：After 24 hours, after anesthetized animal, surgical operation microscope photograph is given.Then use micro note
Emitter central area by cornea is punctured, slow to extract eyes aqueous humor, is put into storage in EP pipe trash ices, and it is dense that the same day gives aqueous humor protein
Degree detection and inflammatory cell count.Protein concentration application Coomassie brilliant blue (Bradford) method is determined；Cell count is blue with placenta
After dye liquor dilutes 5 times, counted with cell counting count board under the microscope.
1.4 histologic analysis：After animal lps injection 24 hours, intact eye, simple separation ball wall manadesma are won in anesthesia
Afterwards, room temperature fixes 48 hours in being immediately placed in special fixer, is dyeed by paraffin section and HE afterwards, analysis corpus ciliare choroideae and
Retina (at especially depending on nipple) inflammatory cell oozes out situation.
1.5 statistical analyses：Experimental data withRepresent, statistical analysis are carried out using SPSS16.0 statistical packages.
Inflammatory cell and albumen in each group aqueous humor are respectively compared using one-way analysis of variance (one-way ANOVA) and ooze out situation.P<
0.05 is that difference is statistically significant.
2. result
2.1 substantially and Histological section：Anterior chamber's lesser ring of Merkel of rat prosthomere photo display LPS group animals has a large amount of fibers to ooze
Go out, cause occlusion of pupil, the obvious dilatation and congestion of iris vessels；And only visible iris vessels in KS23 groups and dexamethasone intervention group
It is congested obvious, but have no obvious fibrin formation film (Fig. 1).
Histotomy is shown at corpus ciliare choroideae, and KS23 intervention groups are oozed out in the cell of anterior chamber angle and significantly reduced compared with LPS groups；
And KS23 groups are also clearly better (Fig. 2) depending on cellular infiltration before nipple compared with LPS groups；And had not seen in blank control group any thin
Born of the same parents infiltrate.
2.2 aqueous humor total proteins and raji cell assay Raji：After Fig. 3 (a) shows LPS modelings 24 hours, LPS group aqueous humor protein contents
It is 19.66 ± 1.76mg/ml.After KS23 is given or dexamethasone is intervened, protein level is substantially reduced in aqueous humor, respectively
11.21 ± 2.15mg/ml and 7.72 ± 1.14mg/ml, compared with LPS groups there were significant differences (P<0.01).Similarly, Fig. 3 (b) displays
Cell oozes out quantity (20.25 ± 4.99 × 10 in KS23 groups and Dexamethasone group aqueous humor5/ ml and 11.00 ± 2.94 × 105/
Ml) compared with LPS groups (38.33 ± 5.13 × 105/ ml) significantly reduce (P<0.01).And it is more to give intravitreal injection KS23 merely
Peptide group aqueous humor is detected with control group without any difference.
3. conclusion：This example shows that KS23 small peptides have from clinical manifestation, aqueous humor inflammation index and histological examination
Significantly mitigate the performance of experimental uveitis rat anterior ocular segment, oozing out for albumen and inflammatory cell in aqueous humor is reduced, while also may be used
The infiltration of inflammatory cell in anterior chamber angle and retinal tissue is reduced, effectively alleviates inflammation of eye section reaction.Although KS23 small peptides is anti-
Scorching effect be weaker than classics anti-inflammatory hormone (dexamethasone), but due to the latter's long-term use may result in corticosteroid glaucoma,
Medicamentous cataract, or even the serious systemic side effects such as osteoporosis, diabetes.Give small peptide injection merely in our current research
Group aqueous humor inflammation index detection does not show any abnormalities, it is seen that with special anti-inflammatory activity, good biocompatibility, be easy to group
Knit penetrating micromolecule polypeptide (KS23) has the advantage and prospect of uniqueness in terms of inflammation of eye section is controlled.
Embodiment 3
Antiinflammatory actions of the KS23 to RAW264.7 mouse macrophages
1. materials and methods：
1.1 materials and key instrument equipment：The strain of RAW264.7 mouse macrophages is purchased from Shanghai life section of the Chinese Academy of Sciences
Learn icm cell institute；Endotoxin (LPS, E.coli055:B5, purchased from Sigma companies)；CellTiterAQueous
One Solution Cell Proliferation Assay (MTS, purchased from Promega companies).
1.2 experimental techniques：The DMEM in high glucose culture of RAW264.7 cells is incubated in 37 degree of incubators；Cell is dense with difference
After degree inoculation, it is incubated 24 hours with the culture medium containing 10% hyclone, it is long to density about 70~80%；Then give serum-free training
Base starvation is supported after 24 hours, each group cell is processed with 100ng/ml LPS and various concentrations KS23.
1.3MTS cell viabilities are detected：Cell is with 1 × 105/ hole is inoculated in 96 orifice plates, is divided into PBS groups, LPS100ng/ml
Group, KS230.1 μM of group, KS231 μM of group, KS2310 μM of group, KS2350 μM of group and DXM10 μM of group, every group is done 6 multiple holes, is incubated
After 24 hours, after adding 20 μ L MTS solution, 37 DEG C of lucifuges to be incubated per hole 3 hours, detected at automatic ELIASA 490nm wavelength
Absorbance；
1.4 cell culture medium ELISA are detected：Cell is with 5 × 105/ hole is inoculated in 24 orifice plates, point PBS groups, LPS groups, LPS+
KS231 μM of group, LPS+KS2310 μM of group, LPS+KS2350 μM of group and LPS+DXM10 μM of group, every group is done 3 multiple holes.24 hours
Afterwards, after collecting culture medium with 16,000g × 10min × 4 DEG C high speed centrifugation, supernatant, -80 DEG C of preservations, for TNF-α, IL- are collected
6 detections.
1.5 cell real time PCR are detected：Cell is with 5 × 105/ hole is inoculated in 6 orifice plates, and packet is the same, and every group is done 3
Individual multiple holes.After 6 hours, cell culture medium is removed, thoroughly blotted after being washed with the PBS of precooling, add 500 μ L Invitrogen
Trizol is cracked, row RT-PCT detections TNF-α, IL-6 and GAPDH mRNA level in-sites.
1.6 statistical analyses：Experimental data withRepresent, statistical analysis are carried out using SPSS16.0 statistical packages.
The difference of each group inflammatory factor protein level and mRNA level in-site is respectively compared using one-way analysis of variance (one-way ANOVA)
It is different.P<0.05 is that difference is statistically significant.
2. result
2.1MTS cell viabilities are detected：Experiment display KS23 (0.1 μM~50 μM) MTS absorbances are respectively 0.58 ±
0.02nd, 0.57 ± 0.03,0.57 ± 0.02,0.56 ± 0.02, with control group (0.55 ± 0.02) indifference (P>0.05),
100ng/mL LPS (0.58 ± 0.03) and 10 μM of DXM (0.55 ± 0.03) also have no significant effect to RAW264.7 cell viabilities
(P>0.05).(Fig. 4).
2.2 inflammatory factors are detected：TNF-α and IL-6 are the important inflammatory factors induced after LPS stimulates.10 μM and 50 μM
KS23 intervention group TNF-α levels (4742 ± 693.3pg/ml；3352 ± 454.4pg/ml) compared with LPS groups (6413 ± 483.9pg/
ML (* P) are substantially reduced<0.05, * * P<0.01), 1 μM of KS23 group TNF-α (5973 ± 283.8pg/ml) is notable with LPS groups nothing
Difference (P>0.05).In terms of IL-6,10 μM of KS23 groups (5223 ± 456.1pg/ml) and 50 μM of KS23 groups (3343 ±
973.7pg/ml) also significantly reduce (* P compared with LPS groups (7403 ± 1061pg/mL)<0.05, * * P<0.01), 1 μM of KS23 group
(6387 ± 592.1pg/ml) is with LPS groups without significant difference (P>0.05) (Fig. 5).
The further influence of TNF-α and IL-6mRNA levels that detection KS23 is induced LPS.After LPS is induced 6 hours, 10 μ
M groups and 50 μM of groups TNF-α mRNA POWER values (23.47 ± 2.08 and 17.76 ± 1.54) are bright compared with LPS groups (32.15 ± 2.74)
It is aobvious to reduce (P<0.01), 1 μM of group (28.60 ± 1.42) is without the effect (P for substantially suppressing TNF-α transcription>0.05).Similarly, 10 μ
M (8.30 ± 0.36) and 50 μM of groups (6.28 ± 0.48) can substantially suppress IL-6 inflammatory factors transcription (P<0.01), 1 μM of group
(9.87 ± 0.46) and LPS groups (11.39 ± 1.17) no significant difference (P>0.05) (Fig. 6).The studies above shows 50 μM
KS23 intervention groups are to the inhibitory action of TNF-α and IL-6 inflammatory factors with 10 μM of DXM groups without significant difference (P>0.05).
3. conclusion：Found from Vitro Experimental Results, KS23 can suppress important pro-inflammatory cytokine (TNF-α and IL-6) and exist
Transcription, synthesis in the macrophage of endotoxin activation, and in good dose dependent.
Embodiment 4
Effects of the KS23 to chick chorioallantoic membrane angiogenesis
1. materials and methods：
1.1 materials：Whatman filter paper is purchased from Sigma Co., USA.
1.2 modellings and Intervention trial：The hatching egg of a chicken of 1-2 days after life is randomly divided into 3 groups, control group, 10 μ are followed successively by
G KS23 intervention groups, 50 μ g KS23 intervention groups, every group of 9-15 is only.Hatching egg surface is cleaned with running water, the new clean that 0.2% is molten
5-10min is soaked in liquid, blunt end is 37 degree of temperature in condition upward, is cultivated in the incubator of humidity 60%-70%, daily at least
Upset 2 times, is one day with 24h, is hatched 5 days.Under aseptic condition, an about 1cm is opened in its blunt end (air chamber end) with tweezers2-
2cm2Aperture, membrana putaminis and air chamber are opened successively, exposing length has the chorioallantoic membrane of blood vessel.Used with the Whatman filter paper of 5mm diameters
Make sample carrier, each filter paper absorbs the μ l of PBS solution 5 containing 0 μ g, 10 μ g or 50 μ g KS23, is put into chorioallantoic membrane after drying
Centre.Small window is sealed with plastic adhesive tape.Continue to hatch 2 days under above-mentioned similarity condition.
1.3 count chorioallantoic membrane MVC：Adhesive tape is opened, the capilary of kainogenesis on observation chorioallantoic membrane, stereoscopic micro-
Capilary (diameter the is not more than 10 μm) quantity around each group hatching egg filter paper in 5mm is measured under mirror.
1.4 statistical analyses：Experimental data withRepresent.Using one-way analysis of variance (one-way ANOVA) respectively
Compare each group chick chorioallantoic membrane MVC.P<0.05 is that difference is statistically significant.
2. result
On hatching egg chick chorioallantoic membrane around filter paper in the range of 5mm, the blood vessel of PBS control group breeder chick chorioallantoic membrane, from
Its big blood vessel branch step by step, forms a plurality of capilary, and the MVC of KS23 treatment groups is considerably less than normal group (Fig. 7).
Embodiment 5
The effect that KS23 is migrated to VEGF inducing endothelial cells
1. materials and methods：
1.1 materials：People recombinates VEGF, purchased from Sigma Co., USA.Human umbilical vein endothelial cells (HUVECs) are purchased from
ScienCell laboratories.
1.2 cell migration scratch experiments：Cell is with 3 × 105/ hole is inoculated in six orifice plate culture dishes, treats cell growth area
Up to after 90%, changing the RPMI1640 nutrient solutions of serum-free makes cell starvation 24h (make cell basic synchronization, during this period in non-
Metabolism state, cell is mostly in G0~G1 phases).One straight width is made about for Tip to cell in hole center using 200 μ L
It is the cut of 0.8mm or so.The cell that serum-free medium will be wiped off is rinsed well.By packet PBS groups, VEGF50ng/ml groups,
VEGF+KS231 μM of group, VEGF+KS2310 μM of group, VEGF+KS2350 μM of group adds experiment reagent, is placed in 37 DEG C of incubator relayings
Continuous culture.Cultivate Taking Pictures recording under the inverted microscope of rearmounted 10 × 5 times of 0h and 24h.It is soft using Image-Pro Plus images
Part calculates the unlapped scratch area of cell after 0h and 24h, and cell does not cover during scratch area/0h unlapped with cell after 24h
The ratio of the scratch area of lid, represents the transfer ability of cell.
1.3 statistical procedures：Experimental data withRepresent.Using one-way analysis of variance (one-way ANOVA) point
Do not compare the migration situation of cell between each group.P<0.05 is that difference is statistically significant.
2. result
VEGF inductions group after 24 hours cell migration substantially, the cut area non-area coverage of cell is only the 21.75% of 0h, and
50 μM of non-area coverages of small peptide intervention group cut area's cell are the 52.75% of 0h, hence it is evident that inhibit the endothelial cell of VEGF inductions
Migration (P<0.01, Fig. 8).
Embodiment 6
The preparation of eyedrops
Using routine techniques, mix following components, 1% eye eye drops is obtained, its formula is as follows：
One week on probation through 3 moderate acute uveitis volunteers, 4 times a day (or every 2 hours once), 2 drip every time/
Eye.
Wherein, acute uveitis grade scale is as follows：
1. it is slight：Ciliary congestion, KP+~++, anterior chamber inflammation cell 0~++, anterior chamber's scintillation 0~++.2. moderate:Ciliary fills
Blood, KP++~+++, anterior chamber inflammation cell ++~+++, anterior chamber's scintillation ++~+++.3. severe：Mixed congestion, KP+++~++++,
Anterior chamber inflammation cell +++~++++, anterior chamber's scintillation +++~++++, anterior chamber's cellulosic oozes out, hypopyon.
Curative effect judging standard is as follows：
It is main Judging index with vision condition, eye subjective symptoms, anterior chamber inflammation cell, aqueous flare.Treatment
It is divided into recovery from illness, effective, effective and invalid four grades, scores respectively.
Recovery from illness：1. vision restoration more than 1.0；2. eye subjective symptoms disappears；3. anterior chamber inflammation cell (-), aqueous flare
(-)。
It is effective：1. eyesight is improved more than 4 rows；2. eye subjective symptoms mitigates；3. anterior chamber inflammation Leukopenia, ++++→+
+/+++ →+, aqueous flare weakens, ++++→ ++/+++ →+.
Effectively：1. eyesight is improved more than 2 rows；2. eye subjective symptoms mitigates；3. anterior chamber inflammation Leukopenia, ++++→ ++
+/+++ → ++, aqueous flare weakens, ++++→ +++/+++ → ++.
It is invalid：1. eyesight is without improve；2. eye subjective symptoms is without improvement；3. anterior chamber inflammation cell is not reduced or increased, room
Water scintillation is unchanged.
As a result：Three patients suffer from eye vision and improve 2 rows or more after one week treats, and eye subjective symptoms takes a turn for the better,
Keratic precipitates reduction, anterior chamber's scintillation and Leukopenia.This shows that the eye drops can effectively suppress inflammation of eye section and react and new
The related disease of angiogenic.
Embodiment 7
The preparation of derivative polypeptide and the test to suppressing inflammatory reaction effect
Following several derivative polypeptides, and the method as shown in embodiment 3 are prepared for, each KS23 are determined and is derived polypeptide (50 μM)
To inflammatory factor TNF-α and the inhibitory action of IL-6, as shown in table 2：
Table 2
Result shows in the treatment group (50 μM) of above-mentioned derivative polypeptide K23-1-6, have significantly to TNF-α and IL-6
Inhibitory action.As can be seen here, polypeptide of the present invention and its derivative polypeptide, there is good inhibitory action to inflammatory reaction.
Embodiment 8
The test that derivative polypeptide is acted on angiogenesis inhibiting
Test to new vessels inhibitory action is carried out to above-mentioned derivative polypeptide using the method in embodiment 5.
Result is as shown in table 3：
Table 3
The all documents referred in the present invention are all incorporated as reference in this application, independent just as each document
It is incorporated as with reference to such.In addition, it is to be understood that after above-mentioned instruction content of the invention has been read, those skilled in the art can
Made various changes or modifications with to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited
Enclose.
Claims (7)
1. a kind of polypeptide, or its pharmaceutically acceptable salt, the polypeptide is such as SEQ ID NO:Any shown amino acid in 2-8
The polypeptide of sequence.
2. a kind of nucleic acid molecules of separation, it is characterised in that it encodes the polypeptide described in claim 1.
3. a kind of pharmaceutical composition, it is characterised in that it contains：
Polypeptide described in (a) claim 1 or its pharmaceutically acceptable salt；With
(b) pharmaceutically acceptable carrier or excipient.
4. pharmaceutical composition as claimed in claim 3, it is characterised in that the formulation of the composition is injection, eyedrops, eye
With gel or spongaion.
5. polypeptide described in claim 1 or the purposes of pharmaceutically acceptable salt, it is characterised in that for preparing medicine, institute
Medicine is stated for suppressing inflammatory reaction and angiogenesis, and/or the medicine for preventing and treating (a) inflammation related disease；
(b) new vessels relevant disease.
6. purposes as claimed in claim 5, it is characterised in that wherein, described inflammation related disease is selected from the group：Eye is scorching
Property disease, pancreatitis, IBD, lung inflammation, contact dermatitis, rheumatoid arthritis, ankylosing spondylitis；
Described relevant diseases of angiogenesis is selected from the group：Neovascular eye diseases, tumour, ischemic heart disease, non-inflammation
Cardiomyopathy, coronary sclerosis, arteriosclerosis, arterial embolism, arterial thrombus, Berger's diseases, chronic inflammation, inflammation
Property enteropathy, ulcer, rheumatic arthritis, scleroderma, psoriasis, sterility and sarcoma shape disease.
7. purposes as claimed in claim 5, it is characterised in that the chemoprophylaxis or treatment be selected from the group with inflammation phase
Close and with new vessels relevant disease：Eye cornea infection, uveitis, inflammation related glaucoma, neovascular glaucoma
It is eye, BDR, retinopathy of prematurity, retinal periphery phlebitis, senile macular degeneration, inflammatory
Enteropathy, contact dermatitis, rheumatoid arthritis, ankylosing spondylitis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310060727.4A CN104004066B (en) | 2013-02-26 | 2013-02-26 | Prevention suppresses inflammatory reaction and micromolecule polypeptide and its application of angiogenesis |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310060727.4A CN104004066B (en) | 2013-02-26 | 2013-02-26 | Prevention suppresses inflammatory reaction and micromolecule polypeptide and its application of angiogenesis |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104004066A CN104004066A (en) | 2014-08-27 |
| CN104004066B true CN104004066B (en) | 2017-05-31 |
Family
ID=51364994
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310060727.4A Expired - Fee Related CN104004066B (en) | 2013-02-26 | 2013-02-26 | Prevention suppresses inflammatory reaction and micromolecule polypeptide and its application of angiogenesis |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104004066B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117285611B (en) * | 2023-11-24 | 2024-02-09 | 中国海洋大学 | Anti-inflammatory oligopeptide from sea squirt and application of anti-inflammatory oligopeptide in preparation of medicines |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6946444B2 (en) * | 1997-08-06 | 2005-09-20 | Genset | Lipoprotein-regulating medicaments |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1458758A2 (en) * | 2001-12-21 | 2004-09-22 | Maxygen Aps | Adiponectin fragments and conjugates |
-
2013
- 2013-02-26 CN CN201310060727.4A patent/CN104004066B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6946444B2 (en) * | 1997-08-06 | 2005-09-20 | Genset | Lipoprotein-regulating medicaments |
Non-Patent Citations (2)
| Title |
|---|
| Adiponectin specifically increased tissue inhibitor of metalloproteinase-1 trough interleukin-10 expression in human macrophages;Kumada等;《Circulation》;20041231;第109卷;2046-49 * |
| Obesity,adiponectin and vascular inflammatory disease.;Ouchi N等;《Curr opin lipidol.》;20031231;第14卷(第6期);561-6 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104004066A (en) | 2014-08-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102827253B (en) | A kind of micromolecule polypeptide for suppressing inflammatory reaction and its application | |
| CN104341486A (en) | Novel polypeptide capable of inhibiting new vessels and application thereof | |
| US9023795B2 (en) | Angiogenesis-inhibiting peptide and application thereof | |
| CN106552260A (en) | Interleukin-13 7 generates the application in disease in modulating vascular | |
| CN104004066B (en) | Prevention suppresses inflammatory reaction and micromolecule polypeptide and its application of angiogenesis | |
| CN102336812B (en) | A kind of polypeptide with inhibiting angiogenesis activity | |
| US10501511B2 (en) | Low molecular polypeptide for preventing and treating inflammation and use thereof | |
| CN104341489B (en) | Novel polypeptide for inhibiting new blood vessel and application thereof | |
| US20150266926A1 (en) | Small molecule polypeptide for preventing and restraining inflammation and application of same | |
| CN103897034B (en) | The micromolecule polypeptide and its application of a kind of prevention and/or treatment inflammatory reaction | |
| US9266933B2 (en) | Polypeptides inhibiting neovascularization and uses thereof | |
| CN103159851B (en) | The micromolecule polypeptide of prevention and suppression inflammation and application thereof | |
| WO2016115732A1 (en) | Polypeptide for inhibiting angiogenesis or growth and application thereof | |
| CN104004057B (en) | The little peptide of one class suppression new vessels and application thereof | |
| CN103992376B (en) | Small peptides inhibiting new vessels and application | |
| CN101942012A (en) | Polypeptide for preventing and treating angiogenesis and application thereof | |
| CN104861058B (en) | A new class of polypeptide with neuroprotective function | |
| CN105017406B (en) | Novel polypeptide with neuroprotective function | |
| CN109970847B (en) | Novel polypeptide for inhibiting new blood vessel and application thereof | |
| US8933031B2 (en) | Polypeptide inhibiting angiogenesis and application thereof | |
| CN103992377B (en) | Small peptides inhibiting new vessels and application | |
| WO2013060020A1 (en) | Novel small peptide capable of inhibiting new vessels and application thereof | |
| CN110092816A (en) | Prevent and treat micromolecule polypeptide and its application of fibrosis | |
| CN117205299A (en) | Application of recombinant apolipoprotein J in preparation of medicine for treating ophthalmic diseases | |
| CN116966272A (en) | Application of sgp130 protein in preparation of product for treating keratitis and keratitis indication |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170531 Termination date: 20200226 |