CN103992377B - Small peptides inhibiting new vessels and application - Google Patents
Small peptides inhibiting new vessels and application Download PDFInfo
- Publication number
- CN103992377B CN103992377B CN201310052864.3A CN201310052864A CN103992377B CN 103992377 B CN103992377 B CN 103992377B CN 201310052864 A CN201310052864 A CN 201310052864A CN 103992377 B CN103992377 B CN 103992377B
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- present
- aminoacid
- group
- peptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to novel small peptides inhibiting new vessels and application. The invention also relates to a preparation method of the polypeptide, application and pharmaceutical composition containing the polypeptide. The polypeptide possesses a plurality of advantages, such as small molecular weight, capability of permeating various ocular tissue barriers, good water solubility, capability of possessing a relatively high concentration in neutral tear, aqueous humor and vitreous humor, and the like.
Description
Technical field
The present invention relates to biomedicine field, in particular it relates to the small peptide of the new suppression new vesselses of a class, described is little
Peptide is derived from the polypeptide of people Neuropilin-1.The invention further relates to the preparation method of the polypeptide and application and containing the polypeptide
Pharmaceutical composition.
Background technology
The formation of new vesselses is an extremely complex process, and it includes：The expansion of existing blood vessels, vascular permeability
Increase, the degraded of blood vessel surrounding substrate, the activationa and proliferation of endotheliocyte, migration and the formation of new blood capillary sample tube chamber.
In eye, about 2/3 blinding disease is relevant with pathologic neovascularization, for example：Herpes simplex cornea base
The cornea rebirth blood vessel that matter inflammation causes, the choroidal neovascularization in age-related macular degeneration, and diabetic retina
Retinal neovascularization in pathological changes or retinopathy of prematurity etc..At present clinically, for eye pathologic neovascularization
It is conventional to use laser photocoagulation, photodynamic therapy (Photodynamic therapy, PDT) and Jing pupil thermotherapys
(Thermal transpupillary therapy, TTT) etc. is treated.However, these treatment meanss are not only to local group
Knit and easily cause destruction, its late result is not also highly satisfactory.Therefore, in recent years people continuously attempt to exploitation treatment eye
Pathologic neovascularization more effective way.
When effective angiogenesis inhibitors are developed, the particularity of ophthalmic remedy should be fully taken into account.
First, there is multiple anatomicals and functional barrier in eye.Formulations for systemic administration usually due to blood-aqueous barrier and
Blood-retina barrier and cannot ocular tissue local reach enough drug level；Local is administered, such as intravitreal, greatly
It is difficult to penetrate retina in theory in the macromole of 76.5kDa and acts on retina and choroidal neovascularization.For ocular
Administration, medicine has to successively penetrate lipophilic corneal epithelial cell closely connection and hydrophilic corneal stroma, therefore only
Have and possess appropriate fat-soluble, low-molecular-weight or can be with the transporter in ocular tissue (such as：Amino acid transporter, oligopeptide transporter
Deng) medicine that combines gets to anterior chamber and play a role.
Second, the degree and its effectiveness that medicine dissolves in hydrophilic tear, aqueous humor, vitreous humor is proportionate.
3rd, based on above-mentioned main cause, the bioavailability of ophthalmic remedy is very low；It is allowed to improve, administration can be increased
Concentration.It is more obvious for treating tumor neovasculature compound toxic and side effects, whole body and local cannot high dose give
Medicine.Additionally, the larger exogenous protein of molecular weight is also sensitive foreign body source, can be to part tissue of eye (such as:Tunica uvea) cause
Immunologic injury.
4th, although having had a series of comparatively safe endogenouss angiogenesis inhibitors successively to be confirmed at present, such as
Angiostatin (angiostatin), it is by plasminogen Kringle domain 1-4 (plasminogen Kringle1-4) group
Into, can substantially suppress the growth of blood vessel dependent tumors, but because its molecular weight is larger and space conformation is complicated, therefore preparing
Have that recombinant expressed purifying process is loaded down with trivial details in journey and the deficiency such as endotoxin residual.Just because of the restriction of above-mentioned a variety of conditions, mesh
The front medicine for treating ocular angiogenesis is extremely limited, such as recombinant anti human VEGF monoclonal antibodies bevacizumab
(Avastin), recombinant anti human VEGF monoclonal antibody fragments ranibizumab (Lucentis) etc., but their prices are high, and
And Jing intravitreal administrations repeatedly are needed, or even blood vessel embolism equivalent risk can be caused.
As can be seen here, the micromolecular inhibitor with specific biological activities and biocompatibility, Jing noinvasive or micro- are found
The route of administration of wound passes through various ocular tissue's barriers, improves the bioavailability of eye local, reduces dosage, reduce local and
The side effect of whole body, is of great significance to the clinical prevention tool of neovascular eye diseases.Therefore, this area in the urgent need to
A kind of small molecule neovascularization inhibitor of the effective and safe for being suitable to eyeball tissue of exploitation.
The content of the invention
It is an object of the invention to provide a class be suitable to the effective and safe of eyeball tissue can angiogenesis inhibiting small molecule
Polypeptide and its fragment, analogs and derivatives.
It is a further object of the present invention to provide the preparation method containing the polypeptide and application.
In a first aspect of the present invention, there is provided in a first aspect of the present invention, there is provided it is many that a kind of following formula I is represented
Peptide, or its pharmaceutically acceptable salt
[Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-
[Xaa9]-[Xaa10] (I)
In formula,
Xaa0 is nothing, or 1~2 Amino acid profile peptide fragment；
Xaa1 is the aminoacid being selected from the group：Cys；Or Ser；
Xaa2 is the aminoacid being selected from the group：Ser；Or Thr；
Xaa3 is the aminoacid being selected from the group：Gln；Asn；
Xaa4 is the aminoacid being selected from the group：Tyr；Trp；Phe；Thr；Or Ser；
Xaa5 is the aminoacid being selected from the group：Ser；Or Thr；
Xaa6 is the aminoacid being selected from the group：Thr；Or Ser；
Xaa7 is the aminoacid being selected from the group：Asn；Gln；His；Lys；Or Arg；
Xaa8 is the aminoacid being selected from the group：Trp；Tyr；Or Phe；
Xaa9 is the aminoacid being selected from the group：Cys；Or Ser；
Xaa10 is nothing, or 1~2 Amino acid profile peptide fragment；
And described polypeptide has the activity of angiogenesis inhibiting, and the length of the polypeptide is 9-13 aminoacid.
More preferably, in described polypeptide：
Xaa0 is nothing；
Xaa1 is the aminoacid being selected from the group：Cys；Or Ser；
Xaa2 is the aminoacid being selected from the group：Ser；Or Thr；
Xaa3 is the aminoacid being selected from the group：Gln；Or Asn；
Xaa4 is the aminoacid being selected from the group：Tyr；Or Phe；
Xaa5 is the aminoacid being selected from the group：Ser；Or Thr；
Xaa6 is the aminoacid being selected from the group：Thr；Or Ser；
Xaa7 is the aminoacid being selected from the group：Asn；Or Gln；
Xaa8 is the aminoacid being selected from the group：Trp；Or Tyr；
Xaa9 is the aminoacid being selected from the group：Cys；Or Ser；
Xaa10 is nothing；
In another preference, the length of the polypeptide is 9 aminoacid.
In another preference, the length of the polypeptide is 8 aminoacid.
In another preference, the polypeptide is selected from the group：
A () has SEQ IDNO:The polypeptide of aminoacid sequence shown in 2；
B () is by SEQ ID NO:Aminoacid sequence shown in 2 is through 1-3 (preferably 1-2, more preferably 1) aminoacid
The replacement of residue, disappearance are added and are formed, and with angiogenesis inhibiting function by polypeptide derived from (a).
In another preference, described derivative polypeptide remains >=70% SEQ ID NO:The suppression of 2 shown polypeptide
Angiogenesiss activity.
In another preference, described derivative polypeptide and SEQ ID NO:2 homogeny >=80%, preferably >=90%；
More preferably >=95%.
Present invention also offers with angiogenesis inhibiting function, compound of formula I dimer and multimeric forms.
In a second aspect of the present invention, there is provided a kind of detached nucleic acid molecules, it encodes the above-mentioned polypeptide of the present invention.
In a third aspect of the present invention, there is provided a kind of pharmaceutical composition, it contains：
The above-mentioned polypeptide of (a) present invention or its pharmaceutically acceptable salt；With
(b) pharmaceutically acceptable carrier or excipient.
In another preference, the dosage form of the compositionss be collyrium, injection (as near the eyes and intraocular injection), it is ophthalmically acceptable
Gel or spongaion.
In another preference, described compositionss are slow release formulation.
In a fourth aspect of the present invention, there is provided the purposes of a kind of polypeptide of the present invention or pharmaceutically acceptable salt,
They be used to prepare the medicine of angiogenesis inhibiting or preventing and treating and relevant diseases of angiogenesis.
In another preference, described being selected from the group with relevant diseases of angiogenesis：It is neovascular eye diseases, swollen
Tumor, ischemic heart desease, non-inflammation cardiomyopathy, coronary atherosclerosis, atherosclerosis obliterans, arterial thrombosiss, arterial thrombus,
Berger's diseases, chronic inflammatory disease, inflammatory bowel, ulcer, rheumatic arthritis, scleroderma, psoriasises, infertility or sarcoma shape
Disease etc..
In another preference, described neovascular eye diseases include involving choroid, retina, cornea or iris,
Including senile degeneration of macula, proliferative diabetic retinopathy, retinal vessel barrier disease, retinopathy of prematurity
Change, corneal infection, neovascular glaucoma etc..
In a fifth aspect of the present invention, there is provided a kind of method of suppression mammal angiogenesiss, including step：Give
The object of needs applies polypeptide of the present invention or its pharmaceutically acceptable salt.
In another preference, described couple as if people.
In another preference, described angiogenesiss are the angiogenesiss related to neovascular eye diseases.
It should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and have in below (eg embodiment)
Can be combined with each other between each technical characteristic of body description, so as to constitute new or preferred technical scheme.As space is limited, exist
This no longer tires out one by one states.
Description of the drawings
Drawings below is used to illustrate specific embodiments of the present invention, rather than limits what is be defined by the claims
The scope of the invention.
Fig. 1 shows the impact that small peptide ZY7 is bred to human umbilical vein endothelial cell HUVECs, and small peptide ZY7 has aobvious
Write the effect of inhibition of endothelial cell proliferation.Relative to VEGF groups, (1 μM~100 μM) of VEGF+ small peptide ZY7 groups have and significantly inhibit
The effect of HUVECs propagation, * P<0.05, * * P<0.01, difference has statistical significance.
Fig. 2 shows impact of small peptide ZY7 to human umbilical vein endothelial cell HUVECs segment dislocations, it is seen that small peptide ZY7
With the effect for significantly inhibiting the formation of endotheliocyte tube chamber.
Fig. 2 a-2c show inhibitory action of small peptide ZY7 to HUVECs segment dislocations.
Fig. 2 a are VEGF groups；Fig. 2 b are VEGF+ZY7 (100 μM) group；Fig. 2 c are relative to VEGF groups, VEGF+ small peptides ZY7
(1 μM~100 μM) of group has the effect for significantly inhibiting HUVECs segment dislocations, * P<0.05, * * P<0.01, difference has statistics
Learn meaning.
Fig. 3 shows impact of small peptide ZY7 to new vesselses on chick chorioallantoic membrane：Small peptide ZY7 have significantly inhibit new hemopoietic
The effect of pipe.
Fig. 3 a-3c show 3-5 level Microvessel Counts in the range of filter paper week 2.5mm.
Fig. 3 a are PBS groups；Fig. 3 b are ZY7 (10 μ l/ pieces) group；Fig. 3 c are ZY7 (50 μ l/ pieces) group；Fig. 3 d are relative to PBS
Group, the small peptide ZY7 group of each concentration substantially suppresses chick chorioallantoic membrane new vesselses number, and inhibitory action in concentration dependent, * P<
0.05, * * P<0.01, difference has statistical significance.
Fig. 4 shows impact of small peptide ZY7 to Mouse Retina new vesselses：Small peptide ZY7 have significantly inhibit mice view
The effect of film new vesselses.
Fig. 4 a are PBS groups；Fig. 4 b are ZY7 (2 μ g/ μ l) group；Fig. 4 c are relative to hyperoxia+PBS groups, hyperoxia+small peptide ZY7 group
(1 μ g/ μ l~2 μ g/ μ l) substantially suppresses Mouse Retina new vesselses number, and inhibitory action in concentration dependent, * P<
0.05, * * P<0.01, difference has statistical significance.
Specific embodiment
The present inventor is prepared for first with angiogenesis inhibiting function, molecular weight through extensively in-depth study
Micromolecule polypeptide less than 3kD.Specifically, the method that the present inventor applies bioinformatics, based on homology analysis and life
Thing characteristic etc. is analyzed, and devises several candidate sequences, is synthesized using solid phase method, isolates and purifies the highly purified small peptide of acquisition
ZY7, and it is identified with HPLC and MS, then Jing chick chorioallantoic membrane vascular patterns, the new hemopoietic of oxygen inducing mouse retina
Tube model, the cell proliferation of human umbilical vein model of VEGF inductions and Human umbilical vein endothelial cells tube chamber model discrimination, obtain
One class is new, the micromolecule polypeptide with prevention and treatment relevant diseases of angiogenesis.
The molecular weight of the small peptide of the present invention is little, can pass through various ocular tissue's barriers；Good water solubility, can be in neutral tear, room
Higher concentration is kept in water and vitreous humor；It is safe, it is little to biological tissue's toxic and side effects；Eye local application biological utilisation
Degree is high, dosage can be reduced, so as to reduce systemic side effects.The present invention is completed on this basis.
People Neuropilin-1
Neuropilin is a kind of transmembrane glycoprotein of nineteen ninety-five Satoda et al. reported first.According to neuropilin bases
The alternative splicing of cause, can form two isomers：Neuropilin-1 and Neuropilin-2, have between the two 44% it is same
Source property.As other highly conserved structures of Neuropilin family members, Neuropilin-1 is transmembrane protein, and its is extracellular to have
3 different domains, are referred to as a1/a2, FV/FV III (b1/b2) and MAM (c), and its transmembrane region and endochylema inner region are returned
Enter d domains.Neuropilin-1 genes wide expression in tissue, for example：Nervous system, endotheliocyte, some swell
Oncocyte, the heart, lung, Placenta Hominiss etc..In new vesselses generating process, VEGF-165, PlGF-2, VEGF-B, VEGF-E can be with
Neuropilin-1 is combined, and activates the signal transduction pathway in downstream, plays important biological effect.
Active polypeptide
In the present invention, term " polypeptide of the present invention ", " ZY7 polypeptides ", " ZY7 small peptides ", " small peptide ZY7 " or " peptide ZY7 " can
Used interchangeably, all refers to peptide ZY7 aminoacid sequences (CSQYSTNWC, such as SEQ ID NO with neovascularization inhibiting activity:1 institute
Show) albumen or polypeptide.Additionally, the term also includes with angiogenesis inhibiting function, SEQ IDNO：The change of 2 sequences
Special-shaped formula.These variant forms include (but being not limited to)：The disappearance of 1-2 (being more preferably 1) aminoacid, insertion and/or
Replace, and in C-terminal and/or N-terminal addition or lack one or several (usually 2 within, preferably 1) amino
Acid.For example, in the art, when being replaced with similar nature or similar aminoacid, the work(of protein will not generally be changed
Energy.Again such as, adding or lack one or several aminoacid in C-terminal and/or N-terminal will not generally also change the knot of protein
Structure and function.Additionally, the term also includes monomer and multimeric forms polypeptide of the present invention.The term also includes linear and non-
Linear polypeptide (such as cyclic peptide).A kind of typical polypeptide is that C-terminal and/or N-terminal lack an aminoacid, that is, constitute 8 ammonia
The polypeptide of base acid.
Present invention additionally comprises the active fragment of ZY7 polypeptides, derivant and analog.As used herein, term " fragment ",
" derivant " and " analog " refers to the polypeptide for being kept substantially angiogenesis inhibiting function or activity.The polypeptide piece of the present invention
Section, derivant or the like can be that (i) has one or more conservative or non-conservative amino acid residue (preferred conservative amino
Sour residue) substituted polypeptide, or (ii) polypeptide with substituted radical in one or more amino acid residues, or (iii)
ZY7 polypeptides are more with what another compound (such as extending the compound of polypeptide half-life, such as Polyethylene Glycol) fusion was formed
Peptide, or polypeptide that (iv) additional aminoacid sequence is blended in this peptide sequence and is formed (with targeting sequencing, secretion sequence or
The sequence labels such as 6His merge and formed and then albumen).According to teaching herein, these fragments, derivant and analog category
In scope known to those skilled in the art.
The preferred reactive derivative of one class refers to compared with the aminoacid sequence of Formulas I there is at most 3, preferably at most 1,
More preferably at most 1 aminoacid is replaced by the similar or close aminoacid of property and forms polypeptide.These conservative variations are more
Peptide carries out amino acid substitution and produces preferably based on table 1.
Table 1
| Initial residue | Representational replacement | It is preferred to replace |
| Ala(A) | Val;Leu;Il e | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Invention also provides the analog of ZY7 polypeptides.These analog can be aminoacid sequence with the difference of natural ZY7 polypeptides
Difference on row, or the difference for not affecting on the modified forms of sequence, or have both at the same time.Analog also includes having
Different from the analog of the residue (such as D- aminoacid) of natural L-amino acids, and with non-naturally occurring or synthesis amino
The analog of sour (such as β, gamma-amino acid).It should be understood that the polypeptide of the present invention is not limited to the above-mentioned representational polypeptide for enumerating.
Modification (generally not changing primary structure) form includes：The chemically derived form such as acetyl of inner or in vitro polypeptide
Change or carboxylated.Modification also includes glycosylation, and such as those are carried out in the synthesis and processing of polypeptide or in further processing step
It is glycosylation modified and produce polypeptide.This modification can carry out glycosylated enzyme (such as mammal by the way that polypeptide is exposed to
Glycosylase or deglycosylating enzyme) and complete.Modified forms are also included with phosphorylated amino acid residue (such as phosphoric acid cheese ammonia
Acid, phosphoserine, phosphothreonine) sequence.Also include being modified so as to improve its anti-Proteolytic enzyme performance or optimization
The polypeptide of solubility property.
Polypeptide of the present invention can with by pharmaceutically or physiology it is acceptable acid or alkali derived from salt form use.This
The salt that a little salt are including but not limited to formed with following acid：Hydrochloric acid, hydrobromic acid, sulphuric acid, citric acid, tartaric acid, phosphoric acid, breast
Acid, acetone acid, acetic acid, succinic acid, oxalic acid, fumaric acid, maleic acid, oxaloacetic acid, methanesulfonic acid, ethyl sulfonic acid, benzenesulfonic acid or hydroxyl second
Sulfonic acid.Other salt include：The salt formed with alkali metal or alkaline-earth metal (such as sodium, potassium, calcium or magnesium), and with ester, carbamic acid
The form of " prodrug " of ester or other routines.
Coded sequence
The invention further relates to encode the polynucleotide of ZY7 polypeptides.A kind of preferred coded sequence is (SEQ IDNO:1, compile
Code sequence:TGCTCCCAGTATAGCACCAACTGGTGC), it encodes SEQ ID NO:Small peptide ZY7 shown in 2.
The polynucleotide of the present invention can be DNA form or rna form.DNA can be coding strand or noncoding strand.Coding
The coding region sequence of mature polypeptide can be with SEQ ID NO:Coding region sequence shown in 1 is identical or variant of degeneracy.
As used herein, with SEQ ID NO:As a example by 1, " variant of degeneracy " refers to that in the present invention coding has SEQ ID NO:2
The polypeptide of sequence, but with SEQ ID NO:The differentiated nucleotide sequence of corresponding encoded region sequence in 1.
The ZY7 nucleotide full length sequence or its fragment of the present invention can generally use PCR TRAP, recombination method or synthetic
Method obtain.At present, it is already possible to obtain encoding polypeptide of the present invention (or its fragment, or it spreads out by chemosynthesis completely
It is biological) DNA sequence.Then the DNA sequence can be introduced various existing DNA moleculars (or such as carrier) as known in the art
In cell.
The present invention also relates to include the carrier of the polynucleotide of the present invention, and with of the invention carrier or ZY peptide codings
The host cell that sequence Jing genetic engineering is produced.
On the other hand, present invention additionally comprises having the polyclonal antibody and monoclonal antibody of specificity to ZY7 polypeptides, especially
It is monoclonal antibody.
Preparation method
Polypeptide of the present invention can be recombinant polypeptide or synthesis polypeptide.The polypeptide of the present invention can be chemosynthesis, or weight
Group.Correspondingly, polypeptide of the present invention can use conventional method synthetic, it is also possible to which recombination method is produced.
It is a kind of it is preferable that with liquid phase synthesis techniques or solid phase synthesis technique, such as Boc solid phase methods, Fmoc solid phase methods
Or two methods are used in combination.Solid phase synthesis can quickly obtain sample, can be according to the sequence signature of purpose peptide from appropriate
Resin carrier and synthesis system.For example, preferred solid phase carrier is such as connected with the Wang trees of C-terminal aminoacid in peptide in Fmoc systems
Fat, Wang resin structures are 4- alkoxyl benzylalcohols for the arm between polystyrene, with aminoacid；With 25% hexahydropyridine/dimethyl
Methanamide room temperature treatment 20 minutes, to remove Fmoc blocking groups, and according to given aminoacid sequence from C-terminal one by one to N-terminal
Extend.After the completion of synthesis, the proinsulin related peptides for synthesizing are cut from resin with the trifluoroacetic acid containing 4% p-methyl phenol
Get off and remove protection group, may filter that except ether precipitate and separate obtains thick peptide after resin.After the solution lyophilizing of products therefrom, use
Peptide needed for gel filtration and reverse phase HPLC method purification.When solid phase synthesis are carried out using Boc systems, preferred resin
The PAM resins of C-terminal aminoacid in be connected with peptide, PAM resin structures are 4- hydroxyl first for the arm between polystyrene, with aminoacid
Base phenyl acetamide；In Boc synthesis systems, in deprotection, neutralization, the circulation being coupled, removed with TFA/ dichloromethane (DCM)
Blocking group Boc and with diisopropylethylamine (DIEA/ dichloromethane neutralize.After the completion of peptide chain condensation, (the 5- containing p-cresol is used
10%) fluohydric acid gas (HF), is processed 1 hour at 0 DEG C, and peptide chain is cut from resin, while removing blocking group.With 50-
80% acetic acid (containing a small amount of mercaptoethanol) extracting peptide, further with molecular sieve SephadexG10 or Tsk-40f point after solution lyophilizing
From purification, then again Jing high-pressure liquid phase purification obtains required peptide.Can be using known various coupling agents in chemistry of peptides field
Each amino acid residue is coupled with coupling method, for example, can use dicyclohexylcarbodiimide (DCC), hydroxyl benzotriazole
Or ureas hexafluorophosphoric acid ester (HBTU) of 1,1,3,3- tetra- are directly coupled (HOBt).For the small peptide that obtains of synthesis, its purity with
Structure can be confirmed with RP-HPLC and mass spectral analyses.
In a preference, polypeptide ZY7 of the present invention, by its sequence, is prepared, row efficient liquid phase using the method for solid phase synthesis
Chromatogram purification, obtains high-purity purpose peptide freeze-dried powder, -20 DEG C of storages.
Another kind of method is to produce polypeptide of the present invention with recombinant technique.By conventional recombinant DNA technology, using this
Bright polynucleotide can be used to express or produce the ZY7 polypeptides of restructuring.In general there are following steps：
(1). with the polynucleotide (or variant) of the coding ZY7 polypeptides of the present invention, or with the weight containing the polynucleotide
The conversion of group expression vector or suitable host cell of transduceing；
(2). the host cell cultivated in suitable culture medium；
(3). separation, protein purification from culture medium or cell.
Recombinant polypeptide can be expressed or be secreted into extracellular in the cell or on cell membrane.If desired, it can be utilized
Physics, chemistry and other characteristics separated by various separation methods and purification of Recombinant albumen.These methods are this areas
Known to technical staff.The example of these methods is included but is not limited to：Conventional renaturation process, processed with protein precipitant
(salting-out method), centrifugation, the broken bacterium of infiltration, super process, ultracentrifugation, sieve chromatography (gel filtration), adsorption chromatography, ion exchange
The combination of chromatography, high performance liquid chroma- tography (HPLC) and other various liquid chromatography (LC) technologies and these methods.
Because polypeptide of the present invention is shorter, it can be considered to multiple polypeptides are cascaded, recombinant expressed rear acquisition is more
The expression product of dimer form, then forms required small peptide by methods such as enzyme action.
Relevant diseases of angiogenesis
In the present invention, relevant diseases of angiogenesis is not particularly limited, including as known in the art various and blood vessel
Newborn related disease.The representational exemplary disorders related to angiogenesiss include (but being not limited to)：Neovascular eye
Disease, tumor, ischemic heart desease, non-inflammation cardiomyopathy, coronary atherosclerosis, atherosclerosis obliterans, arterial thrombosiss, tremulous pulse
Thrombosis, Berger's diseases, chronic inflammatory disease, inflammatory bowel, ulcer, rheumatic arthritis, scleroderma, psoriasises, infertility or
Sarcoma shape disease etc..
Preferably, described neovascular eye diseases include (but being not limited to)：Involve choroid, retina, cornea or
Iris, including senile degeneration of macula, proliferative diabetic retinopathy, retinal vessel barrier disease, premature infant regard
Retinopathy, corneal infection, neovascular glaucoma etc..
Pharmaceutical composition and application process
On the other hand, present invention also offers a kind of pharmaceutical composition, it contains the polypeptide of the present invention of (a) safe and effective amount
Or its pharmaceutically acceptable salt；And (b) pharmaceutically acceptable carrier or excipient.The quantity of polypeptide of the present invention is usually
10-100 milligrams of micrograms/agent, preferably 100-1000 micrograms/agent.
For the purposes of the present invention, effective dosage is to give individual about 0.01 mg/kg to 50 mg/kgs, compared with
The polypeptide of the present invention of good ground 0.05 mg/kg to 10 mg/kg body weight.Additionally, the polypeptide of the present invention can also may be used with alone
It is used together (be such as formulated in same pharmaceutical composition) with other therapeutic agents.
Pharmaceutical composition can also contain pharmaceutically acceptable carrier.Term " pharmaceutically acceptable carrier " refers to for controlling
Treat the carrier of agent administration.The term refers to such some medicament carriers：Themselves do not induce and produce to receiving the individual of said composition
The harmful antibody of body, and without undue toxicity after being administered.These carriers are well known to those of ordinary skill in the art.
Can find with regard to pharmaceutically in Remington's Pharmaceutical Sciences (Mack Pub.Co., N.J.1991)
Acceptable excipient is discussed fully.This kind of carrier includes (but being not limited to)：Saline, buffer, glucose, water, glycerol,
Ethanol, adjuvant and combinations thereof.
Acceptable carrier can contain liquid, such as water, saline, glycerol and ethanol on therapeutic composition Chinese materia medica.In addition,
Complementary material, such as wetting agent or emulsifying agent, pH buffer substance are there is likely to be in these carriers.
Generally, therapeutic composition can be made injectable agent, such as liquid solution or suspension；May also be fabricated which before the injection
Be adapted to allocate in solution or suspension, the solid form of liquid-carrier.
Once being made into the compositionss of the present invention, conventional route can be passed through and be administered, including (but do not limit
In)：Ocular, near the eyes, ophthalmic, intramuscular, intravenouss, subcutaneous, Intradermal or local be administered.Wait that the object for preventing or treating can be
Thing；Especially people.
When the pharmaceutical composition of the present invention is used for actual therapeutic, various different dosage forms can be adopted according to service condition
Pharmaceutical composition.It is preferred that what is can enumerated has collyrium, injection, gel for eye use and spongaion.
These pharmaceutical compositions can be prepared according to conventional methods by mixing, dilution or dissolving, and be added once in a while
Plus suitable medicated premix, such as excipient, disintegrating agent, binding agent, lubricant, diluent, buffer agent, isotonic agent
(isotonicities), preservative, wetting agent, emulsifying agent, dispersant, stabilizer and cosolvent, and the process for preparation can root
Carried out with usual way according to dosage form.
For example, the preparation of collyrium can be carried out so：By small peptide ZY7 or its pharmaceutically acceptable salt and base substance one
Rise and be dissolved in sterilized water (being dissolved with surfactant in sterilized water), adjust osmotic pressure and acid-base value to physiological statuss, and
Suitable medicated premix such as preservative, stabilizer, buffer agent, isotonic agent, antioxidant and viscosifier can be arbitrarily added, so
After be completely dissolved it.
The pharmaceutical composition of the present invention can be administered with sustained release formulation.For example, small peptide ZY7 or its salt can be impregnated in slow
In releasing the pill or microcapsule that polymer is carrier, then by the pill or microcapsule by operation implantation tissue to be treated.Additionally,
Small peptide ZY7 or its salt can also be pre-coated with the intraocular lenss of medicine and be applied by insertion.As the example of release polymer
Son, what is can enumerated has ethylene-vinylacetate copolymer, poly- hydroxyl-metacrylate
(polyhydrometaacrylate), polyacrylamide, polyvinylpyrrolidone, methylcellulose, lactic acid polymer, lactic acid-
Ethanol copolymer etc., what is preferably can enumerated is that biodegradable polymer such as lactic acid polymer and lactic acid-ethanol are total to
Polymers.
When the pharmaceutical composition of the present invention is used for actual therapeutic, small peptide ZY7 as active component or its pharmaceutically
The dosage of acceptable salt, can according to the body weight of each patient to be treated, the age, sex, symptom degree and reasonably in addition
It is determined that.For example, when Local eye drop, generally its concentration is about 0.1-10wt%, and preferably 1-5wt%, can be administered for 2-6 time daily,
Each 1-2 drops.
Industrial applicability
Containing peptide of the present invention or its pharmaceutically-acceptable salts as the pharmaceutical composition of active component, have aobvious to angiogenesiss
The inhibitory activity of work.Jing animal experiments confirm that polypeptide of the present invention not only can suppress the angiogenesiss and oxygen of chick chorioallantoic membrane to lure
The Mouse Retina new vesselses led, and the propagation and segment dislocation of human umbilical vein endothelial cell can be suppressed.
Main advantages of the present invention include：
A the molecular weight of () polypeptide ZY7 of the present invention is little, can pass through ocular tissue's barrier；
B () good water solubility, can keep higher concentration in neutral tear, aqueous humor and vitreous humor；
C () is safe, little to biological tissue's toxic and side effects；And eye local application bioavailability is high, can reduce agent
Amount, so as to reduce systemic side effects；
D () can be prepared by the method for solid phase synthesis, purity is high, and yield is big, low cost；
The good stability of (e) polypeptide of the present invention.
Therefore polypeptide of the present invention is expected to develop into medicine, for treating the neovascular of neovascular eye diseases and correlation
Disease, such as tumor neogenetic blood vessels.
With reference to specific embodiment, the present invention is expanded on further.It should be understood that these embodiments are merely to illustrate the present invention
Rather than restriction the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to conventional strip
Part such as Sambrook et al., molecular cloning：Laboratory manual (New York:Cold Spring Harbor Laboratory
Press, 1989) described in condition, or according to the condition proposed by manufacturer.
Preparation example
The synthesis of small peptide ZY7 and derivative polypeptide
Using the commercially available channel polypeptide synthesizer of SYMPHONY types 12 (Protein Technologies companies of the U.S.), press
The workbook of synthesizer, using Fmoc solid phase methods, is respectively synthesized sequence such as SEQ ID NO:ZY7 polypeptides shown in 2, Yi Jiru
SEQ ID NO.:Derivative polypeptide ZY7-1 to ZY7-6 shown in 3-6.
After the completion of synthesis, polypeptide (cutting liquid (10/g) is cut from resin：TFA (J.T.Baker) 94.5%, water 2.5%,
EDT (ALDRICH) 2.5%, TIS (ALDRICH) 1%；Clipping time：120min).By lysate, with nitrogen, (Shanghai is than Europe gas
Industrial group) dry up as far as possible, washed six times with ether (trying a chemical reagent company limited in Shanghai), then room temperature is volatilized.
With HPLC (SHIMADZU high performance liquid chromatograph models：Preparative, analytical type, software：Class-VP.Sevial
System, manufacturer：SHIMADZU) purified polypeptide, by thick peptide pure water or adds the dissolving of a small amount of acetonitrile (Fisher), according to following
Condition distinguishes purification small peptide ZY7 and its derivative polypeptide.
Pump A:0.1% trifluoroacetic acid+ultra-pure water
Pump B:0.1% trifluoroacetic acid+acetonitrile
Flow velocity:1.0ml/min
Detection volume:30ul
Wavelength:220nm
Detection post：Column:Venusi MRC-ODS C18 posts (30x250mm)
Detection process is shown in Table 2.
Table 2
Finally by solution lyophilizing after purification, obtain high-purity (>95%) small peptide ZY7 and derivative polypeptide ZY7-1 are extremely
ZY7-6。
A small amount of finished product small peptide ZY7 is taken, the Purity of HPLC analyses and the molecular weight identification of ESI-MS is carried out.
As a result show, the purity of Purity small peptide ZY7 is more than 99%, and small peptide ZY7 has 9 aminoacid, and molecular weight is
1KD, is consistent with predictive value.
By the small peptide of white powder, pack, be placed in -20 DEG C long-term and preserve.
Embodiment 1
Impact of small peptide ZY7 to human umbilical vein endothelial cell proliferation activity
Using MTS methods, concrete grammar is as follows：
During Primary human umbilical vein cord vascular endothelial cell HUVECs (being purchased from ScienCell companies) is inoculated in into 96 orifice plates, connect
It is 2 × 10 to plant concentration4/ml；ECM37 DEG C of serum-free culture agent is added to cultivate after cell attachment 24 hours；Afterwards in each Kong Zhongfen
Not Jia Ru serum-free culture agent ECM as negative control, VEGF (100ng/ml) (be purchased from Sigma companies) as positive control,
Small peptide ZY7 of VEGF (100ng/ holes)+variable concentrations is used as treatment group；After continuing to cultivate 24 hours, 20 μ l are added in each hole
MTS solution (be purchased from Promega companies)；After 37 DEG C are incubated 4 hours, 490nm is determined using microplate reader (Bio-Rad companies) each
The absorbance in hole, according to OD490 the proliferation activity of cell is judged, finally carries out statistical analysiss with SPSS11.0.1.
As a result Fig. 1 is seen, it is seen that small peptide ZY7 has the effect for substantially suppressing human umbilical vein endothelial cell HUVECs propagation,
And in concentration dependent, relative to VEGF groups, (1 μM~100 μM) of VEGF+ small peptide ZY7 groups have and substantially suppress HUVECs propagation
Effect, * P<0.05, * * P<0.01, difference has statistical significance.
Embodiment 2
Impact of small peptide ZY7 to human umbilical vein endothelial cell segment dislocation activity
Using Matrigel substrate gluing methods, concrete grammar is as follows：
Matrigel matrigels (being purchased from BD companies) 50 μ l/ holes are added in 96 orifice plates, 37 DEG C are incubated 30 minutes.Treat its knot
Into after solid, shaped, Primary human umbilical vein cord vascular endothelial cell HUVECs is inoculated in into matrigel surface, inoculum density is 8 × 106/
ml；And it is (public purchased from Sigma as negative control, VEGF (100ng/ml) that serum-free culture agent ECM is separately added in each hole
Department) as positive control, VEGF (100ng/ml)+variable concentrations small peptide ZY7 as treatment group, 37 DEG C continue cultivate.In place
After reason 6 hours under 200 times of mirrors to orifice plate in cell take 3 visuals field at random and take pictures, and using software I mage-Pro
Plus Program5.1 (Media Cybernetics, Inc.) calculate the summation of the tube chamber maximum gauge for wherein being formed, finally
Statistical analysiss are carried out with SPSS11.0.1.
As a result Fig. 2 is seen, small peptide ZY7 had in 6 hours substantially suppress human umbilical vein endothelial cell HUVECs tube chamber shapes
Into effect, and in concentration dependent.Fig. 2 a-2c show inhibitory action of small peptide ZY7 to HUVECs segment dislocations.Fig. 2 a are
VEGF groups；Fig. 2 b are VEGF+ZY7 (100 μM) group；Fig. 2 c are relative to VEGF groups, VEGF+ small peptide ZY7 groups (1 μM~100 μM)
With the effect for substantially suppressing HUVECs segment dislocations, * P<0.05, * * P<0.01, difference has statistical significance.
Embodiment 3
The measure of the anti-chick chorioallantoic membrane new vesselses effect of small peptide ZY7
Using chick embryo allantois membrane modle, concrete grammar is as follows：
It is incubated (T=37 DEG C, humidity H=60-70%) of climatic chamber is loaded after the kind egg sterilization of 1-2 days after life 5 days
(counting one day within 24 hours), daily sooner or later each egg-turning is once；Afterwards will be containing the filter paper of cortisone acetate (5 μ g/ μ l, 5 μ l/ pieces)
(Whatman quantitative filter papers, Sigma, ashless, Grade42, Cat No1442-042,
42.5mm Φ × 100circles) respectively Deca PBS (5 μ l/ pieces) or low concentration (2 μ g/ μ l), high concentration (10 μ g/ μ l) it is little
Peptide ZY7 (5 μ l/ pieces), filter paper is placed between kind of the big blood vessel of egg chorioallantoic membrane and seals kind of an egg after air-drying；Continuation will plant egg
It is placed in climatic chamber (temperature T=37 DEG C, humidity H=60-70%) and is incubated 2 days (counting one day within 24 hours), not egg-turning；It is complete afterwards
Exposure chick chorioallantoic membrane, takes pictures (scope is filter paper week 5mm) and (scope is filter paper week to 3-5 level Microvessel Counts
2.5mm), statistical analysiss are carried out with SPSS11.0.1.
As a result Fig. 3 is seen, it is seen that compare PBS groups, small peptide ZY7 is equal in low concentration (10 μ g/ pieces) and high concentration (50 μ g/ pieces)
Play the role of substantially to suppress chick chorioallantoic membrane new vesselses.Fig. 3 a-3c show the micro- blood of 3-5 levels in the range of filter paper week 2.5mm
Pipe is counted.Fig. 3 a are PBS groups；Fig. 3 b are ZY7 (10 μ g/ pieces) group；Fig. 3 c are ZY7 (50 μ g/ pieces) group；Fig. 3 d are relative to PBS
Group, the small peptide ZY7 group of each concentration substantially suppresses chick chorioallantoic membrane new vesselses number, and inhibitory action in concentration dependent, * P<
0.05,**P<0.01, difference has statistical significance.
Embodiment 4
The measure of small peptide ZY7 anti-mouse retina pathologic neovascularization effect
Using hypoxia inducible Mouse Retina neuropathy model, concrete grammar is as follows：
The C57BL/6 of 7 days after birth is placed in into oxygen concentration simultaneously together with suckling dams and is about feeding in 75% ± 2% environment
Support.Take out mice after 5 days, and the same day and the low concentration of 0.5 μ l is injected within the 3rd day respectively in mice glass body after taking-up
(0.5 μ g/ μ l), middle concentration (1 μ g/ μ l), small peptide ZY7 of high concentration (2 μ g/ μ l) and control sample PBS, it is postoperative to be placed in mice
Continue to raise to set up hypoxia inducible Mouse Retina neuropathy model in normal air, after 5 days eyeball of mouse is taken out, be fixed on 4%
In paraformaldehyde, cut into slices after paraffin embedding, and HE dyeing is carried out to it.Under 200 times of light microscopics, to retinal neovascularization
Endotheliocyte core counted, and carry out statistical analysiss with SPSS11.0.1.
As a result Fig. 4 is seen, small peptide ZY7 substantially suppresses mice to regard in middle concentration (1 μ g/ μ l) and high concentration (2 μ g/ μ l) Shi Junyou
The effect of nethike embrane pathologic neovascularization, * P<0.05, * * P<0.01, with statistical significance.
Embodiment 5
The active testing of derivative polypeptide
Method as shown in embodiment 3, determines the anti-chick chorioallantoic membrane new vesselses effect of the derivative polypeptides of each ZY7.As a result
As shown in table 3：
Table 3
| Sample | Sequence | SEQ ID NO.: | Microvessel Count |
| Derivative polypeptide 1 (ZY7-1) | CSQYGTNWC | 3 | 47 |
| Derivative polypeptide 2 (ZY7-2) | CSQYSNSWC | 4 | 44 |
| Derivative polypeptide 3 (ZY7-3) | SSQYGTNWC | 5 | 49 |
| Derivative polypeptide 4 (ZY7-4) | CSQYSTNYC | 6 | 45 |
| Derivative polypeptide 5 (ZY7-5) | ASCSQYSTNWCSA | 7 | 47 |
| Derivative polypeptide 6 (ZY7-6) | CSQYSTNW | 8 | 52 |
| Control (PBS) | 66 |
As a result show, compared with matched group, derivative polypeptide 1-6 has in low concentration (10 μ g/ pieces) and significantly inhibits Embryo Gallus domesticus
The effect of chorioallantoic membrane new vesselses.
Embodiment 6
The preparation of collyrium
Using routine techniquess, mix following components, 1% collyrium is obtained, its formula is as follows：
5 volunteers of Jing are on probation one week, and 3 times a day, every time 1 drop/eye.As a result show that the collyrium can suppress eye
Angiogenesiss.
The all documents referred in the present invention are all incorporated as in this application reference, independent just as each document
It is incorporated as with reference to such.In addition, it is to be understood that after the above-mentioned teachings for having read the present invention, those skilled in the art can
To make various changes or modifications to the present invention, these equivalent form of values equally fall within the model that the application appended claims are limited
Enclose.
Claims (6)
1. a kind of polypeptide, or its pharmaceutically acceptable salt, described polypeptide has the activity of angiogenesis inhibiting, and described many
Peptide is such as SEQ ID NO.:The polypeptide of arbitrary shown aminoacid sequence in 2-8.
2. a kind of detached nucleic acid molecules, it is characterised in that the polypeptide described in the nucleic acid molecule encoding claim 1.
3. a kind of pharmaceutical composition, it is characterised in that described pharmaceutical composition contains：
Polypeptide described in (a) claim 1, or its pharmaceutically acceptable salt；With
(b) pharmaceutically acceptable carrier or excipient.
4. pharmaceutical composition as claimed in claim 3, it is characterised in that the dosage form of described pharmaceutical composition is injection, medicament for the eyes
Water or gel for eye use.
5. the purposes of polypeptide as claimed in claim 1, it is characterised in that for preparing angiogenesis inhibiting or preventing and treating and blood vessel
The medicine of newborn relevant disease.
6. purposes as claimed in claim 5, it is characterised in that described is selected from the group with relevant diseases of angiogenesis：It is newborn
Vascular eye and tumor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310052864.3A CN103992377B (en) | 2013-02-18 | 2013-02-18 | Small peptides inhibiting new vessels and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310052864.3A CN103992377B (en) | 2013-02-18 | 2013-02-18 | Small peptides inhibiting new vessels and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103992377A CN103992377A (en) | 2014-08-20 |
| CN103992377B true CN103992377B (en) | 2017-05-17 |
Family
ID=51306741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310052864.3A Expired - Fee Related CN103992377B (en) | 2013-02-18 | 2013-02-18 | Small peptides inhibiting new vessels and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103992377B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101434648A (en) * | 2008-09-28 | 2009-05-20 | 华东师范大学 | Peptide for inhibiting angiogenesis, and use thereof in angiogenesis medicament preparation |
| CN101597324A (en) * | 2009-03-02 | 2009-12-09 | 华东师范大学 | A kind of decapeptide inhibiting angiogenesis and application thereof |
| CN102336811A (en) * | 2010-07-26 | 2012-02-01 | 上海市第一人民医院 | Novel small peptide capable of inhibiting new vessels and application thereof |
| US8318163B2 (en) * | 2007-05-17 | 2012-11-27 | Genentech, Inc. | Anti-pan neuropilin antibody and binding fragments thereof |
-
2013
- 2013-02-18 CN CN201310052864.3A patent/CN103992377B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8318163B2 (en) * | 2007-05-17 | 2012-11-27 | Genentech, Inc. | Anti-pan neuropilin antibody and binding fragments thereof |
| CN101434648A (en) * | 2008-09-28 | 2009-05-20 | 华东师范大学 | Peptide for inhibiting angiogenesis, and use thereof in angiogenesis medicament preparation |
| CN101597324A (en) * | 2009-03-02 | 2009-12-09 | 华东师范大学 | A kind of decapeptide inhibiting angiogenesis and application thereof |
| CN102336811A (en) * | 2010-07-26 | 2012-02-01 | 上海市第一人民医院 | Novel small peptide capable of inhibiting new vessels and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103992377A (en) | 2014-08-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104341486B (en) | Novel polypeptide for inhibiting new blood vessel and application thereof | |
| EP2599788B1 (en) | Angiogenesis-inhibiting peptide and application thereof | |
| CN105859833B (en) | Polypeptide and its application of a kind of angiogenesis inhibiting or growth | |
| CN106552260A (en) | Interleukin-13 7 generates the application in disease in modulating vascular | |
| CN103992376B (en) | Small peptides inhibiting new vessels and application | |
| CN106220714B (en) | A kind of polypeptide, the drug containing the polypeptide and its application inhibiting new vessels | |
| WO2016115732A1 (en) | Polypeptide for inhibiting angiogenesis or growth and application thereof | |
| EP2853537B1 (en) | Small molecule polypeptide for preventing and restraining inflammation and application of same | |
| CN103992377B (en) | Small peptides inhibiting new vessels and application | |
| CN104341489B (en) | Novel polypeptide for inhibiting new blood vessel and application thereof | |
| CN102336812A (en) | Polypeptide possessing angiogenesis inhibitory activity | |
| CN104004057B (en) | The little peptide of one class suppression new vessels and application thereof | |
| CN102311485B (en) | Polypeptide with neovascularization suppression effect and application thereof | |
| CN103897034B (en) | The micromolecule polypeptide and its application of a kind of prevention and/or treatment inflammatory reaction | |
| CN103087153B (en) | New neovessel inhibition small peptides and applications thereof | |
| CN104371003A (en) | Micromolecule polypeptide for preventing and treating inflammation and use thereof | |
| CN101503458B (en) | Small molecule polypeptide for preventing and treating angiogenesis and use thereof | |
| CN104004066B (en) | Prevention suppresses inflammatory reaction and micromolecule polypeptide and its application of angiogenesis | |
| CN104861058B (en) | A new class of polypeptide with neuroprotective function | |
| CN101942012A (en) | Polypeptide for preventing and treating angiogenesis and application thereof | |
| US8933031B2 (en) | Polypeptide inhibiting angiogenesis and application thereof | |
| WO2013060020A1 (en) | Novel small peptide capable of inhibiting new vessels and application thereof | |
| CN105017406A (en) | Novel polypeptide with nerve protection function | |
| CN110092816A (en) | Prevent and treat micromolecule polypeptide and its application of fibrosis | |
| CN109970847A (en) | A new class of polypeptide for inhibiting new vessels and its application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170517 Termination date: 20190218 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |