CN101942012A - Polypeptide for preventing and treating angiogenesis and application thereof - Google Patents
Polypeptide for preventing and treating angiogenesis and application thereof Download PDFInfo
- Publication number
- CN101942012A CN101942012A CN 200910054509 CN200910054509A CN101942012A CN 101942012 A CN101942012 A CN 101942012A CN 200910054509 CN200910054509 CN 200910054509 CN 200910054509 A CN200910054509 A CN 200910054509A CN 101942012 A CN101942012 A CN 101942012A
- Authority
- CN
- China
- Prior art keywords
- amino acid
- polypeptide
- down group
- group
- asn
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to polypeptide for preventing and treating angiogenesis and application thereof. The invention also relates to the preparation and the application of the polypeptide and a medicinal composition containing the polypeptide. The polypeptide has a plurality of types of advantages, such as small molecular weight for permeating various eye tissue barriers, high water solubility for keeping high concentration in neutral tear, aqueous humor and vitreous humor, and the like.
Description
Technical field
The present invention relates to biomedicine field, more specifically, relate to a kind of micromolecule polypeptide novel, that prevent and treat angiogenesis, be referred to as QY.The invention still further relates to the method for making and the application of described polypeptide and the pharmaceutical composition that contains described polypeptide.
Background technology
Angiogenesis promptly grows the process of new capillary vessel in existing vascular system, it is the necessary physiological change of fetal development, wound healing, tissue regeneration and reparation, but also be the pathologic basis of multiple whole body and local disease simultaneously, comprise neovascular illness in eye, tumor neogenetic blood vessels, rheumatic arthritis, psoriatic etc.
Angiogenesis relates to the rapid process of multistep of a complexity, comprises propagation, migration, erosion and the tube chamber formation etc. of vascular endothelial cell.Angiogenesis is subjected to the short blood vessel factor and presses down the strict regulation and control of blood vessel factor equilibrated, and this balance is broken the cell signal that can start vasculogenesis, thereby causes the pathologic new vessel to take place.(vascular endothelial growth factor be that medium is induced at the center of this complicated angiogenesis cascade reaction VEGF), and specific effect is in vascular endothelial cell for vascular endothelial growth factor.
The blinding eye illness that neovascular illness in eye is that a class has is extensively destructive, can involve whole eyeball, the sickness rate height comprises senile macular degeneration SMD, diabetic retinopathy, corneal infection and neovascular glaucoma etc.Be secondary to the eye new vessel hemorrhage, ooze out the visual quality and the quality of life that have also had a strong impact on diseased individuals with pathologies such as fibrosiss.Yet the method for such disease treatment at present is still very limited, and it is desirable that effect is owed, and security still remains further to be assert.
When the effective angiogenesis inhibitors of exploitation, should fully take into account the singularity of ophthalmic remedy.
The first, eye exists a plurality of anatomical and functional barrier.The whole body administration is usually because blood aqueous barrier and blood-retina barrier and can't reach enough drug levels in the ocular tissue part; Topical as vitreous space injection, is difficult to penetrate retina in theory greater than the macromole of 76.5kDa and acts on retina and choroidal neovascularization.For the administration of eye table, medicine must successively penetrate lipophilic corneal epithelial cell and closely connect and hydrophilic corneal stroma, so only possesses suitably fat-soluble, lower molecular weight or can could arrive the anterior chamber and play a role with transporter (as: amino acid transport body, oligopeptides transporter etc.) the bonded medicine in the eye table organization.
The second, medicine dissolved degree and its validity in hydrophilic tear, aqueous humor, vitreous humor are proportionate.
The 3rd, based on above-mentioned major cause, the bioavailability of ophthalmic remedy is very low; Make it to improve, can strengthen the concentration of administration.It is comparatively obvious to be used for the treatment of tumor neovasculature compound toxic side effect, and whole body and part all can't the high dosage administrations.
The 4th, though had a series of comparatively safe endogenous angiogenesis inhibitors successively to be confirmed at present, as angiostatin (angiostatin), it is made up of plasminogen Kringle structural domain 1-4 (plasminogenKringle 1-4), can obviously suppress the growth of blood vessel dependent tumors, but because its molecular weight is big and space conformation is complicated, so in preparation process, there is the loaded down with trivial details and residual deficiency that waits of intracellular toxin of recombinant expressed purifying process.
Therefore, this area presses for a kind of small molecules neovascularization inhibitor that is suitable for the effective and safe of eyeball tissue of exploitation.
Summary of the invention
But the purpose of this invention is to provide a class be suitable for eyeball tissue effective and safe angiogenesis inhibiting micromolecule polypeptide-QY polypeptide with and fragment, analogue and derivative.
Another object of the present invention provides method for making and the application that contains described polypeptide.
In a first aspect of the present invention, the polypeptide that provides a kind of following formula I to represent, or its pharmacy acceptable salt
[Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa?7]-[Xaa8]-[Xaa9]-[Xaa10]-[Xaa11]-[Xaa12]-[Xaa13]-[Xaa14]-[Xaa15]-[Xaa16]-[Xaa17]-[Xaa18]-[Xaa19]-[Xaa20]-[Xaa21]-[Xaa22]-[Xaa23]-[Xaa24]-[Xaa25]-[Xaa26]-[Xaa27]-[Xaa28](I)
In the formula,
Xaa0 does not have, or 1-3 amino acid constitutes the peptide section;
Xaa1 is the amino acid that is selected from down group: Gln or Asn;
Xaa2 is the amino acid that is selected from down group: His or Arg;
Xaa3 is the amino acid that is selected from down group: Trp or Tyr;
Xaa4 is the amino acid that is selected from down group: Ser or Thr;
Xaa5 is the amino acid that is selected from down group: Ala, Val, Leu or Ile;
Xaa6 is the amino acid that is selected from down group: Gln or Asn;
Xaa7 is the amino acid that is selected from down group: Thr or Ser;
Xaa8 is the amino acid that is selected from down group: Pro or Ala;
Xaa9 is the amino acid that is selected from down group: His or Arg;
Xaa10 is the amino acid that is selected from down group: Thr or Ser;
Xaa11 is the amino acid that is selected from down group: His or Arg;
Xaa12 is the amino acid that is selected from down group: Asn or Gln;
Xaa13 is the amino acid that is selected from down group: Arg or Lys;
Xaa14 is the amino acid that is selected from down group: Thr or Ser;
Xaa15 is the amino acid that is selected from down group: Pro or Ala;
Xaa16 is the amino acid that is selected from down group: Glu or Asp;
Xaa17 is the amino acid that is selected from down group: Asn or Gln;
Xaa18 is the amino acid that is selected from down group: Phe or Leu;
Xaa19 is the amino acid that is selected from down group: Pro or Ala;
Xaa20 is the amino acid that is selected from down group: Cys or Ser;
Xaa21 is the amino acid that is selected from down group: Lys or Arg;
Xaa22 is the amino acid that is selected from down group: Asn or Gln;
Xaa23 is the amino acid that is selected from down group: Leu, Ile, Val, Met, Ala or Phe;
Xaa24 is the amino acid that is selected from down group: Asp or Glu;
Xaa25 is the amino acid that is selected from down group: Glu or Asp;
Xaa26 is the amino acid that is selected from down group: Asn or Gln;
Xaa27 is the amino acid that is selected from down group: Tyr or Phe;
Xaa28 does not have, or 1-3 amino acid constitutes the peptide section;
And described polypeptide has the activity of angiogenesis inhibiting, and the length of described polypeptide is 27-33 amino acid.
In another preference, described polypeptide is a cyclic peptide.
In another preference, Xaa0 is that Cys and Xaa28 are Cys, and described polypeptide is linear; Perhaps Xaa0 is that Cys and Xaa28 are two halfcystines formation disulfide linkage of Cys and Xaa0 and Xaa28 position.
In another preference, Xaa0 and Xaa28 be not for having.
In another preference, described polypeptide is selected from down group:
(a) has the polypeptide of aminoacid sequence shown in the SEQ ID NO:1,2 or 3;
(b) replacement, disappearance or the interpolation of aminoacid sequence shown in the SEQ ID NO:1,2 or 3 through 1-5 (preferably 1-3, more preferably 1-2) amino-acid residue formed, and have the angiogenesis inhibiting function by (a) polypeptides derived.
In another preference, the described polypeptide of deriving kept 〉=70% SEQ ID NO:1 shown in the angiogenesis inhibiting activity of polypeptide.
In another preference, homogeny 〉=80% of described derive polypeptide and SEQ ID NO:1, preferably 〉=90%.
The present invention also provides the dimer angiogenesis inhibiting function, formula I compound and polymer form.
In a second aspect of the present invention, provide a kind of isolated nucleic acid molecule, the polypeptide that the invention of its code book is above-mentioned.
In a third aspect of the present invention, a kind of pharmaceutical composition is provided, it contains:
(a) above-mentioned polypeptide or its pharmacy acceptable salt of the present invention; With
(b) pharmaceutically acceptable carrier or vehicle.
In another preference, the formulation of described composition be collyrium, injection (as near the eyes and intraocular injection), gel for eye use or spongaion.
In another preference, described composition is a slow release formulation.
In a fourth aspect of the present invention, the purposes of a kind of polypeptide of the present invention or pharmacy acceptable salt is provided, they are used to prepare the medicine that is used for angiogenesis inhibiting or control and relevant diseases of angiogenesis.
In another preference, being selected from of described and relevant diseases of angiogenesis organized down: neovascular illness in eye, tumour, ischemic heart disease, non-inflammation myocardosis, coronary sclerosis, atherosclerosis obliterans, arterial thrombosis, arterial thrombus, Berger ' s disease, chronic inflammatory diseases, inflammatory bowel, ulcer, rheumatic arthritis, scleroderma, psoriatic, infertility or sarcoma shape disease etc.
In another preference, described neovascular illness in eye comprises involves choroid, retina, cornea or iris, comprises senile macular degeneration SMD, proliferative diabetic retinopathy, retinal vessel barrier disease, retinopathy of prematurity, corneal infection, neovascular glaucoma etc.
In a fifth aspect of the present invention, a kind of method that suppresses Mammals blood vessel new life is provided, comprise step: use polypeptide of the present invention or its pharmacy acceptable salt for the object of needs.
In another preference, described to liking the people.
In another preference, described angiogenesis is the angiogenesis relevant with neovascular illness in eye.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1 has shown the influence of QY polypeptide group to the chick chorioallantoic membrane angiogenesis.A.PBS control group chorioallantoic membrane angiogenesis situation.B.50 μ g QY-1 intervention group chorioallantoic membrane angiogenesis situation.C.50 μ g QY-2 intervention group chorioallantoic membrane angiogenesis situation.D.50 μ g QY-3 intervention group chorioallantoic membrane angiogenesis situation.E. respectively organize the chick chorioallantoic membrane microvessel count, n=9-13, * * P＜0.01 vs PBS control group.
Fig. 2 has shown that QY polypeptide group induces the influence of RF/6A cell proliferation to VEGF.##P＜0.05vs substratum group (low serologic group).* P＜0.05, the single treatment group of * * P＜0.01 vs VEGF.
Fig. 3 has shown the influence of QY polypeptide group to hypoxia inducible mouse retinal vessel new life.The retina paraffin section, HE dyeing.A. oxygen supply+PBS organizes.B. oxygen supply+QY-1 organizes.C. oxygen supply+QY-2 organizes.D. oxygen supply+QY-3 organizes.E. the different treatment group breaks through layer of retina,limiting,internal vascular endothelial cell check figure, n=8-10, ##P＜0.05 vs air+PBS group.* P＜0.01 vs oxygen supply+PBS group.
Embodiment
The inventor is through extensive and deep research, prepared a kind of angiogenesis inhibiting function that has first, and molecular weight is less than the 5kD micromolecule polypeptide of (as about 3kD only).Particularly, the method of inventor's applying biological information science, based on analyses such as homology analysis and biological characteristicses, several candidate sequences have been designed, after adopting solid phase method that it is synthesized, through chick chorioallantoic membrane vascular pattern, VEGF inductive RF/6A cell strain multiplicative model and hypoxia inducible mouse retinal neovascularization model discrimination, obtained class micromolecule polypeptide novel, that have prevention and treatment angiogenesis function, i.e. QY again.
Particularly, the inventor has prepared the little peptide QY-1 of the novel annular of being made up of 29 amino-acid residues (SEQ ID NO:2) earlier, and it has the activity of angiogenesis inhibiting; Subsequently, the disulfide linkage in the little peptide of annular is taken apart, and is kept the cysteine residues at its two ends, make it to become a linear little peptide QY-2 (SEQ IDNO:3) after, this little peptide still has this type of activity; Then, leave out the cysteine residues at QY-2 two ends, find that the new linear little peptide QY-3 (SEQ ID NO:1) that makes up also has the activity of anti-new vessel.
The molecular weight of little peptide QY of the present invention is little, can see through various ocular tissues barrier; Good water solubility can keep higher concentration in neutral tear, aqueous humor and vitreous humor; Safe, little to biological tissue's toxic side effect; Eye local application bioavailability height can reduce dosage, thereby reduce systemic side effects.Finished the present invention on this basis.
Active polypeptide
In the present invention, term " polypeptide of the present invention ", " QY polypeptide ", " the little peptide of QY ", " small peptide QY " or " peptide QY " are used interchangeably, and all refer to have the albumen or the polypeptide of the peptide QY aminoacid sequence (SEQ ID NO:1) of neovascularization inhibiting activity.In addition, described term also comprises having the variant form angiogenesis inhibiting function, SEQ ID NO:1 sequence.These variant forms comprise that (but being not limited to): 1-5 (is generally 1-4, preferably 1-3, more preferably 1-2,1 best) amino acid whose disappearance, insertion and/or replacement, and add or lack one or several at C-terminal and/or N-terminal and (be generally in 5, preferably being in 3, more preferably is in 2) amino acid.For example, in the art, when replacing, can not change proteinic function usually with the close or similar amino acid of performance.Again such as, add or lack one or several amino acid at C-terminal and/or N-terminal and also can not change proteinic 26S Proteasome Structure and Function usually.In addition, described term also comprises monomer and polymer form polypeptide of the present invention.This term also comprises linear and nonlinear polypeptide (as cyclic peptide).
The present invention also comprises active fragments, derivative and the analogue of QY polypeptide.As used herein, term " fragment ", " derivative " and " analogue " are meant and keep angiogenesis inhibiting function or active polypeptide basically.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferred conservative amino acid residue), or (ii) in one or more amino-acid residues, has a polypeptide of substituted radical, or (iii) QY polypeptide and another compound (such as the compound that prolongs the polypeptide transformation period, polyoxyethylene glycol for example) merge formed polypeptide, or (iv) additional aminoacid sequence be blended in this peptide sequence and the polypeptide that forms (with leader sequence, sequence label such as secretion sequence or 6His merges and the albumen then of formation).According to the instruction of this paper, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
The preferred reactive derivative of one class refers to compare with the aminoacid sequence of formula I, has 5 at the most, and preferably at the most 3, more preferably at the most 2,1 amino acid is replaced by similar performance or close amino acid and formed polypeptide best.These conservative property variation polypeptide preferably carry out the amino acid replacement according to Table I and produce.The sequence of the particularly preferred polypeptide of deriving of one class is shown in SEQ ID NO:3.
Table I
| Initial residue | Representational replacement | The preferred replacement |
| Ala(A) | Val；Leu；Ile | Val |
| Arg(R) | Lys；Gln；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Ile |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
Invention also provides the analogue of QY polypeptide.The difference of these analogues and natural QY polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not influence on the modified forms of sequence, perhaps haves both at the same time.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has non-natural analogue that exist or synthetic amino acid (as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.
(the not changing primary structure usually) form of modification comprises: the chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
Polypeptide of the present invention can also with by pharmaceutically or the acceptable acid of physiology or alkali deutero-salt form use.These salt include, but is not limited to the salt with following acid formation: spirit of salt, Hydrogen bromide, sulfuric acid, citric acid, tartrate, phosphoric acid, lactic acid, pyruvic acid, acetate, succsinic acid, oxalic acid, fumaric acid, toxilic acid, oxaloacetic acid, methylsulfonic acid, ethyl sulfonic acid, Phenylsulfonic acid or isethionic acid.Other salt comprise: the salt that forms with basic metal or alkaline-earth metal (as sodium, potassium, calcium or magnesium), and with the form of " prodrug " of ester, carbamate or other routines.
Encoding sequence
The invention still further relates to the polynucleotide of coding QY polypeptide.A kind of preferred encoding sequence is GTTGTGACCTCACGCGTCTGTGGCGTGTGTGTGTTAGCCTGTGGCCTTTTGAAAGG CACGTTTTTAGAGCTGCTCTTAATG (SEQ ID NO:4).
Polynucleotide of the present invention can be dna form or rna form.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:4 or the varient of degeneracy.As used herein, " varient of degeneracy " be meant in the present invention the coding have SEQ ID NO:1 sequence protein, but with SEQ ID NO:4 in the differentiated nucleotide sequence of corresponding encoded region sequence.
QY Nucleotide full length sequence of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.At present, can be fully obtain the dna sequence dna of code book invention polypeptide (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.
The present invention also relates to comprise the carrier of polynucleotide of the present invention, and the host cell that produces through genetically engineered with carrier of the present invention or QY polypeptid coding sequence.
On the other hand, the present invention also comprises QY DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.
The preparation method
Polypeptide of the present invention can be recombinant polypeptide or synthetic polypeptide.Polypeptide of the present invention can be chemosynthesis, or reorganization.Correspondingly, polypeptide of the present invention can be used the ordinary method synthetic, also available recombination method production.
A kind of preferable methods is to use liquid phase synthetic technology or solid phase synthesis technique, unites use as Boc solid phase method, Fmoc solid phase method or two kinds of methods.Solid phase synthesis can obtain sample fast, can select suitable resin carrier and synthesis system for use according to the sequence signature of purpose peptide.For example, preferred solid phase carrier is as being connected with the Wang resin of C terminal amino acid in the peptide in the Fmoc system, and the Wang resin structure is a polystyrene, and the arm between amino acid is a 4-alkoxyl group benzylalcohol; With 25% hexahydropyridine/dimethyl formamide room temperature treatment 20 minutes, removing the Fmoc blocking group, and extend to the N end one by one by the C end according to given aminoacid sequence.After synthetic the finishing, synthetic proinsulin related peptides is cut down and remove protecting group from resin, can cross behind the filtering resin ether sedimentation and separate and obtain thick peptide with the trifluoroacetic acid that contains 4% p-methyl phenol.After the solution freeze-drying with products therefrom, with gel-filtration and the required peptide of reverse phase HPLC method purifying.When using the Boc system to carry out solid phase synthesis, preferred resin is the PAM resin that is connected with C terminal amino acid in the peptide, and the PAM resin structure is a polystyrene, and the arm between amino acid is a 4-methylol phenylacetamide; In the Boc synthesis system, in going protection, neutralization, link coupled circulation, remove blocking group Boc and use diisopropylethylamine (DIEA/ methylene dichloride neutralization with TFA/ methylene dichloride (DCM).After the peptide chain condensation is finished,, handled 1 hour down, peptide chain is downcut from resin, remove blocking group simultaneously at 0 ℃ with the hydrogen fluoride (HF) that contains p-cresol (5-10%).With 50-80% acetate (containing a small amount of mercaptoethanol) extracting peptide, further use molecular sieve Sephadex G10 or Tsk-40f separation and purification after the solution freeze-drying, and then obtain required peptide through the high-pressure liquid phase purifying.Can use known various coupling agents and each amino-acid residue of coupling method coupling in the chemistry of peptides field, for example can use dicyclohexylcarbodiimide (DCC), hydroxyl benzotriazole (HOBt) or 1,1,3,3-four urea phosphofluoric acid esters (HBTU) carry out direct coupling.For the synthetic small peptide that obtains, its purity and structure can be proved conclusively with reversed phase high efficiency liquid phase and mass spectroscopy.
In a preference, polypeptide QY of the present invention by its sequence, adopts the method preparation of solid phase synthesis, and the row high-efficient liquid phase chromatogram purification obtains high purity purpose peptide freeze-dried powder ,-20 ℃ of storages.
Another kind method is to produce polypeptide of the present invention with recombinant technology.By the recombinant DNA technology of routine, can utilize polynucleotide of the present invention to can be used to express or produce the QY polypeptide of reorganization.In general following steps are arranged:
(1). with the polynucleotide (or varient) of coding of the present invention QY polypeptide, or with the recombinant expression vector that contains these polynucleotide proper host cell that transforms or transduce;
(2). the host cell of in suitable medium, cultivating;
(3). separation, protein purification from substratum or cell.
The extracellular can be expressed or be secreted into to recombinant polypeptide in cell or on cytolemma.If desired, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation handles, with protein precipitant handle (salt analysis method), centrifugal, the broken bacterium of infiltration, superly handle, the combination of super centrifugal, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
Because polypeptide of the present invention is shorter, therefore can consider a plurality of polypeptide are cascaded, recombinant expressed back obtains the expression product of polymer form, forms required little peptide by enzyme method such as cut then.
Pharmaceutical composition and application process
On the other hand, the present invention also provides a kind of pharmaceutical composition, and it contains polypeptide of the present invention or its pharmacy acceptable salt of (a) safe and effective amount; And (b) pharmaceutically acceptable carrier or vehicle.The quantity of polypeptide of the present invention is generally 10 micrograms-100 milligram/agent, preferably is 100-1000 microgram/agent.
For the purposes of the present invention, effective dosage is for giving individual about 0.01 mg/kg to 50 mg/kg, the preferably polypeptide of the present invention of 0.05 mg/kg to 10 mg/kg body weight.In addition, polypeptide of the present invention can singly be used, and also can use (as being formulated in the same pharmaceutical composition) with the other treatment agent.
Pharmaceutical composition also can contain pharmaceutically acceptable carrier.Term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration.This term refers to like this some medicament carriers: they itself do not induce generation to accepting the individual deleterious antibody of said composition, and do not have undue toxicity after the administration.These carriers are well known to those of ordinary skill in the art.(Mack Pub.Co. can find discussing fully about pharmaceutically acceptable vehicle in N.J.1991) at Remington ' s Pharmaceutical Sciences.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol, adjuvant and combination thereof.
Acceptable carrier can contain liquid on the therapeutic composition Chinese materia medica, as water, salt solution, glycerine and ethanol.In addition, also may there be complementary material in these carriers, as wetting agent or emulsifying agent, pH buffer substance etc.
Usually, therapeutic composition can be made injectable agent, for example liquor or suspension; Also can be made into before injection, be fit to allocate in solution or the suspension, the solid form of liquid vehicle.
In case be made into composition of the present invention, it can be carried out administration by conventional route, comprising (but being not limited to): the eye table, near the eyes, intraocular, intramuscular, intravenously, subcutaneous, intracutaneous or topical.The object of waiting to prevent or treating can be an animal; Especially people.
When pharmaceutical composition of the present invention is used to actual therapeutic, can adopt the pharmaceutical composition of various different dosage forms according to service condition.What preferably, can exemplify has collyrium, injection, gel for eye use and a spongaion.
These pharmaceutical compositions can be prepared by mixing, dilute or dissolving according to conventional methods, and add suitable medicated premix once in a while, as vehicle, disintegrating agent, tackiness agent, lubricant, thinner, buffer reagent, isotonic agent (isotonicities), sanitas, wetting agent, emulsifying agent, dispersion agent, stablizer and solubility promoter, and this process for preparation can carry out with usual way according to formulation.
For example, the preparation of collyrium can be carried out like this: small peptide QY or its pharmacy acceptable salt are dissolved in the sterilized water (being dissolved with tensio-active agent in sterilized water) with base substance, regulate osmotic pressure and potential of hydrogen to physiological status, and can at random add suitable medicated premix such as sanitas, stablizer, buffer reagent, isotonic agent, antioxidant and tackifier, it is dissolved fully.
Pharmaceutical composition of the present invention can also the sustained release formulation administration.For example, it is in the pill or micro-capsule of carrier that small peptide QY or its salt can be impregnated in the release polymer, then this pill or micro-capsule is implanted tissue to be treated by operation.In addition, small peptide QY or its salt also can be used by inserting the ophthalmic lens that scribbles medicine in advance.Example as release polymer, what can exemplify has vinyl-vinyl acetate copolymer, poly-hydroxyl-metacrylate (polyhydrometaacrylate), polyacrylamide, polyvinylpyrrolidone, methylcellulose gum, lactic acid polymer, a lactic acid-ethanol copolymer etc., and what preferably can exemplify is biodegradable polymkeric substance such as lactic acid polymer and lactic acid-ethanol copolymer.
When pharmaceutical composition of the present invention is used to actual therapeutic, as the small peptide QY of activeconstituents or the dosage of its pharmacy acceptable salt, can be according to each patient's to be treated body weight, age, sex, symptom degree and reasonably determined.For example, when local eye drip, its concentration is about 0.1-10wt% usually, 1-5wt% preferably, but 2-6 administration every day, and each 1-2 drips.
Industrial applicability
Contain peptide of the present invention or its pharmaceutically-acceptable salts pharmaceutical composition, have significant inhibition active angiogenesis as activeconstituents.Through confirming that at the body animal experiment polypeptide of the present invention not only can suppress the angiogenesis of chick chorioallantoic membrane, and can suppress the propagation of VEGF inductive RF/6A cell strain and the mouse retinal neovascularization of hypoxia inducible.
Major advantage of the present invention comprises:
(a) molecular weight of polypeptide of the present invention is little, can see through ocular tissue's barrier;
(b) good water solubility can keep higher concentration in neutral tear, aqueous humor and vitreous humor;
(c) safe, little to biological tissue's toxic side effect; And eye local application bioavailability height can reduce dosage, thereby reduce systemic side effects;
(d) can be by the method preparation of solid phase synthesis, the purity height, output is big, and cost is low;
(e) can there be good stability in polypeptide of the present invention with the cyclic peptide form.
Therefore polypeptide of the present invention is expected to be developed to medicine, is used for the treatment of neovascular illness in eye and relevant neovascular diseases, as tumor neogenetic blood vessels etc.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Synthesizing of polypeptide
Adopt commercially available SYMPHONY Peptide synthesizer composition sequence be shown in the SEQ ID NO:1-3 three kinds of QY polypeptide.
QY-1:CQHWSAQTPHTHNRTPENFPCKNLDENYC (SEQ ID NO:2); The two ends cysteine residues constitutes a disulfide linkage from beginning to end, and little peptide is conformation ringwise.
QY-2:CQHWSAQTPHTHNRTPENFPCKNLDENYC (SEQ ID NO:3); Be linear conformation.
QY-3:QHWSAQTPHTHNRTPENFPCKNLDENY (SEQ ID NO:1); Be linear conformation.
Step is as follows:
1. prepare needed protection amino acid solution according to computed in software, and condensation reagent, cutting reagent, DMF, the DCM of adding capacity in the corresponding bottle of instrument
2. in reactor, add 100 μ mol FMOC-Ala-Wang-Resin,
3. on the pipeline of collecting cutting liquid, put into centrifuge tube.
4. editor, the swelling time of general resin is 30min, and the deprotection time is that twice of 5min, 15min, condensation time are 30 minutes, and cutting process is 2h.
5. start is synthetic according to program.
6. will cut the liquid ether sedimentation at last, centrifugal, dry up, use the HPLC purifying.
For every kind of QY polypeptide, respectively make 120mg, be white powder (good water solubility), purity:＞95%.Sealing ,-20 degree are preserved standby.
QY is to the effect of chick chorioallantoic membrane angiogenesis
1. materials and methods:
1.1 material: Whatman filter paper is available from U.S. SIGMA company.
1.2 Modelling and intervention test: the chicken kind egg that will give birth to back 1-2d is divided into 3 groups at random, is followed successively by control group, 50 μ g QY intervention group (being respectively QY1, QY2 and QY3 polypeptide), every group of 9-13 only.Clean kind of an egg surface with tap water, soak 5-10min in 0.2% bromogeramine solution, blunt end is 37 ℃ of temperature in condition up, cultivates in the incubator of humidity 60%-70%, overturn at least every day 2 times, and be one day with 24h, hatched 5 days.Under the aseptic condition, open an about 1cm at its blunt end (air chamber end) with tweezers
2-2cm
2Aperture, open shell membrane and air chamber successively, expose the long chorioallantoic membrane that blood vessel is arranged.Whatman filter paper with the 5mm diameter is used as sample carrier, and each filter paper absorbs the PBS solution 5 μ l that contain 50 μ g polypeptide (arbitrary above-mentioned three kinds of QY polypeptide), the central authorities that put into chorioallantoic membrane after drying.Seal fenestella with plastic adhesive tape.Continuation was hatched 2 days under above-mentioned similarity condition.
1.3 counting chorioallantoic membrane microvessel count: open adhesive tape, observe de novo capillary blood vessel on the chorioallantoic membrane, capillary blood vessel (diameter the is not more than 10 microns) quantity in the 5mm around each group of metering kind of egg filter paper under stereoscopic microscope.
1.4 statistical study: experimental data with
Expression.Adopt one-way analysis of variance (one-wayANOVA) respectively to organize the chick chorioallantoic membrane microvessel count respectively.With P＜0.05 is that difference has statistical significance.
2. result
On kind of the laying hen embryo chorioallantoic membrane around the filter paper in the 5mm scope, the blood vessel of PBS control group fertilization chick chorioallantoic membrane from its great vessels branch step by step, forms many capillary blood vesseies, and the microvessel count of QY treatment group obviously is less than normal group.Do not find the toxic action (Figure 1A, 1B, 1C, 1D and 1E) of QY to the chicken embryo.
QY is to the inhibition of proliferation effect of VEGF inductive RF/6A cell strain
1. material and method
Monkey choroid-retina (endothelium) cell strain RF/6A purchases Shanghai Inst. of Life Science, CAS cell resource center.
Cell proliferation test: CellTiter 96 Aqueous One SolutionCell Proliferation Assay (MTS) test kits detect are adopted in cell proliferation, and (Promega, Madison USA), and operate according to producer's explanation.Specifically, the cell that covers with trysinization after, be resuspended in 96 orifice plates with the density of 100000/mL, treat that cell grows to be paved with at the bottom of the hole at 90% o'clock, change fresh low blood serum medium, and add the little peptide of different concns.After 30 minutes, adding final concentration is the VEGF of 10ng/mL.After hatching 24 hours, add 20uL MTS in each hole, and change fresh culture.Under the absorbancy of 490nm, (Model 1420 to adopt Wallac Victor 2 counter plate reader; PerkinElmer Wallac, Turku Finland) reads the light absorption value of respectively organizing the hole.
Statistical study: experimental data is represented with mean ± SEM, uses SPSS 17.0 statistical packages to carry out statistical analysis.Adopt one-way analysis of variance (one-way ANOVA), be considered to difference with P＜0.05 and have significance.
2. result
After handling 24 hours, the single control group of handling of 10ng/mL VEGF is significantly increased than low serologic group cell proliferation.Each little peptide treatment group (0-100 μ M) is compared with the single control group of handling of 10ng/mL VEGF, and the cell proliferation in QY-1, QY-2 and the QY-3 treatment group significantly is suppressed.Show that QY polypeptide group can suppress VEGF and induce RF/6A cell strain propagation (Fig. 2).
QY is to the effect of the retinal neovascularization of hypoxia inducible
1. materials and methods
1.1 material and major equipment: healthy newborn C57B1/6 mouse, male and female are not limit, and 7d age, the about 4g of body weight is available from Chinese Academy of Sciences's Experimental Animal Center.
1.2 Modelling and intervention experiment: newborn rat is divided into 6 groups at random, is followed successively by air+PBS group, air+QY-1 group, air+QY-2 group, air+QY-3 group, oxygen supply+PBS group, oxygen supply+QY-1 group, oxygen supply+QY-2 group, oxygen supply+QY-3 group., every group of 10-11 mouse.Give birth to back 7d, except that control group, respectively organize mouse and it places airtight loft drier together with the female mouse of cage surplus.Feed moistening pure oxygen in the loft drier, the oxysome volume concentrations of keeping in the oxygen case is 75% ± 5%, and every 3-6h with the oxygen measuring instrument monitoring once.The control group normal air is raised.In giving birth to back 12d, under the aseptic condition, to each group mouse oozy glass body cavity injection, volume injected is 0.5 μ l, and three kinds of little peptides are the PBS solution of 10mM concentration.Air+PBS and oxygen supply+PBS treatment group is all injected the PBS solution with volume.。
1.3 the quantitative assay of retinal neovascularization: each treated animal is put to death with excessive anesthesia in giving birth to back 17d, gets eyeball, and 10% neutral formalin is fixed, the row histopathological examination.Sample is with paraffin embedding, 6 μ m serial section, and slice direction is a sagittal plain, promptly by cornea, and parallel with optic nerve, HE dyeing.Randomly draw 4-6 the tangent plane tangent plane of optic nerve section (have except) for every, light microscopic counting is down broken through the vascular endothelial cell check figure of layer of retina,limiting,internal.
1.4 statistical analysis: experimental data with
Expression.Adopt non-paired t test method relatively oxygen supply group and control group, adopt the cell nuclei of the breakthrough layer of retina,limiting,internal of one-way analysis of variance (one-way ANOVA) difference QY treatment group and oxygen supply group.With P＜0.05 is that difference has statistical significance.
2. result
Shown in Fig. 3 E, each air handling group mouse retina rarely seen minute quantity of cutting into slices has the vascular endothelial cell nuclear of breaking through internal limiting membrane, shows that QY-1, QY-2 and QY-3 grow the retinal vessel of normal mouse and do not have obviously influence.
Oxygen supply+PBS group retina section shows the vascular endothelial cell check figure of breaking through internal limiting membrane obviously more than air+PBS group, and three oxygen supply+visible vascular endothelial cell check figures of breaking through internal limiting membrane of little peptide group retina section obviously reduce than the models treated group.This shows that this group polypeptide can suppress hypoxia inducible mouse pathologic retinal vessel new life (Fig. 3).
Do not find the toxicity or the Inflammatory response of above-mentioned arbitrary little peptide processing back each layer tissue of retina.
Embodiment 6
The preparation of collyrium
Utilize routine techniques, mix following component, make 1% collyrium, its prescription is as follows:
QY peptide (QY-1) 10mg
Vltra tears 0.03g
Sterilized water adds to 10ml
Regulate osmotic pressure to 300Osm, potential of hydrogen (pH) is to 6.8-7.1.
Through 3 volunteers week on probation, every day 3 times, each 1 droplet/.The result shows that this collyrium can suppress the angiogenesis of eye.
Embodiment 7
The derive preparation and the activity of polypeptide
Prepared following several polypeptide of deriving, and pressed the method shown in the embodiment 3, measured each QY inhibition of proliferation effect of polypeptide of deriving VEGF inductive RF/6A cell strain.
The polypeptide 1 of deriving: sequence is with SEQ ID NO:1, and wherein the 5th Ala replaced by Val;
The polypeptide 2 of deriving: sequence is with SEQ ID NO:2, and wherein the 6th Ala replaced by Val;
The polypeptide 3 of deriving: sequence is with SEQ ID NO:1, and wherein the 1st Gln replaced by Asn;
The polypeptide 4 of deriving: sequence is with SEQ ID NO:2, and wherein the 24th Leu replaced by Ile;
The polypeptide 5 of deriving: sequence wherein lacks the 1st Gln with SEQ ID NO:1.
The result shows, compares with the single control group of handling of 10ng/mL VEGF, and in the treatment group of the above-mentioned polypeptide 1-5 that derives, cell proliferation significantly is suppressed, and they all can suppress VEGF and induce RF/6A cell strain propagation.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
＜110〉No.1 People's Hospital Shanghai City
＜120〉polypeptide and the application thereof of prevention and treatment angiogenesis
<130>092454
<160>5
<170>PatentIn?version?3.5
<210>1
<211>27
<212>PRT
＜213〉artificial sequence
<220>
<221>misc_feature
<222>(1)..(27)
＜223〉peptide for inhibiting angiogenesis QY
<400>1
Gln?His?Trp?Ser?Ala?Gln?Thr?Pro?His?Thr?His?Asn?Arg?Thr?Pro?Glu
1 5 10 15
Asn?Phe?Pro?Cys?Lys?Asn?Leu?Asp?Glu?Asn?Tyr
20 25
<210>2
<211>29
<212>PRT
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉peptide for inhibiting angiogenesis QY
<220>
<221>misc_feature
＜223〉Cys at two ends forms disulfide linkage, and little peptide is conformation ringwise
<400>2
Cys?Gln?His?Trp?Ser?Ala?Gln?Thr?Pro?His?Thr?His?Asn?Arg?Thr?Pro
1 5 10 15
Glu?Asn?Phe?Pro?Cys?Lys?Asn?Leu?Asp?Glu?Asn?Tyr?Cys
20 25
<210>3
<211>29
<212>PRT
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉peptide for inhibiting angiogenesis QY
<400>3
Cys?Gln?His?Trp?Ser?Ala?Gln?Thr?Pro?His?Thr?His?Asn?Arg?Thr?Pro
1 5 10 15
Glu?Asn?Phe?Pro?Cys?Lys?Asn?Leu?Asp?Glu?Asn?Tyr?Cys
20 25
<210>4
<211>81
<212>DNA
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉encoding sequence of QY polypeptide
<400>4
gttgtgacct?cacgcgtctg?tggcgtgtgt?gtgttagcct?gtggcctttt?gaaaggcacg 60
tttttagagc?tgctcttaat?g 81
<210>5
<211>27
<212>PRT
＜213〉artificial sequence
<220>
<221>misc_feature
＜223〉the QY polypeptide of deriving
<220>
<221>misc_feature
<222>(1)..(1)
＜223〉Xaa=Gln or Asn
<220>
<221>misc_feature
<222>(2)..(2)
＜223〉Xaa=His or Arg
<220>
<221>misc_feature
<222>(3)..(3)
＜223〉Xaa=Trp or Tyr
<220>
<221>misc_feature
<222>(4)..(4)
＜223〉Xaa=Ser or Thr
<220>
<221>misc_feature
<222>(5)..(5)
＜223〉Xaa=Ala, Val, Leu or Ile
<220>
<221>misc_feature
<222>(6)..(6)
＜223〉Xaa=Gln or Asn
<220>
<221>misc_feature
<222>(7)..(7)
＜223〉Xaa=Thr or Ser
<220>
<221>misc_feature
<222>(8)..(8)
＜223〉Xaa=Pro or Ala
<220>
<221>misc_feature
<222>(9)..(9)
＜223〉Xaa=His or Arg
<220>
<221>misc_feature
<222>(10)..(10)
＜223〉Xaa=Thr or Ser
<220>
<221>misc_feature
<222>(11)..(11)
＜223〉Xaa=His or Arg
<220>
<221>misc_feature
<222>(12)..(12)
＜223〉Xaa=Asn or Gln
<220>
<221>misc_feature
<222>(13)..(13)
＜223〉Xaa=Arg or Lys
<220>
<221>misc_feature
<222>(14)..(14)
＜223〉Xaa=Thr or Ser
<220>
<221>misc_feature
<222>(15)..(15)
＜223〉Xaa=Pro or Ala
<220>
<221>misc_feature
<222>(16)..(16)
＜223〉Xaa=Glu or Asp
<220>
<221>misc_feature
<222>(17)..(17)
＜223〉Xaa=Asn or Gln
<220>
<221>misc_feature
<222>(18)..(18)
＜223〉Xaa=Phe or Leu
<220>
<221>misc_feature
<222>(19)..(19)
＜223〉Xaa=Pro or Ala
<220>
<221>misc_feature
<222>(20)..(20)
＜223〉Xaa=Cys or Ser
<220>
<221>misc_feature
<222>(21)..(21)
＜223〉Xaa=Lys or Arg
<220>
<221>misc_feature
<222>(22)..(22)
＜223〉Xaa=Asn or Gln
<220>
<221>misc_feature
<222>(23)..(23)
＜223〉Xaa=Leu, Ile, Val, Met, Ala or Phe
<220>
<221>misc_feature
<222>(24)..(24)
＜223〉Xaa=Asp or Glu
<220>
<221>misc_feature
<222>(25)..(25)
＜223〉Xaa=Glu or Asp
<220>
<221>misc_feature
<222>(26)..(26)
＜223〉Xaa=Asn or Gln
<220>
<221>misc_feature
<222>(27)..(27)
＜223〉Xaa=Tyr or Phe
<400>5
Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
1 5 10 15
Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa?Xaa
20 25
Claims (10)
1. polypeptide that following formula I is represented, or its pharmacy acceptable salt
[Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-[Xaa9]-[Xaa10]-[Xaa11]-[Xaa12]-[Xaa13]-[Xaa14]-[Xaa15]-[Xaa16]-[Xaa17]-[Xaa18]-[Xaa19]-[Xaa20]-[Xaa21]-[Xaa22]-[Xaa23]-[Xaa24]-[Xaa25]-[Xaa26]-[Xaa27]-[Xaa28](I)
In the formula,
Xaa0 does not have, or 1-3 amino acid constitutes the peptide section;
Xaa1 is the amino acid that is selected from down group: Gln or Asn;
Xaa2 is the amino acid that is selected from down group: His or Arg;
Xaa3 is the amino acid that is selected from down group: Trp or Tyr;
Xaa4 is the amino acid that is selected from down group: Ser or Thr;
Xaa5 is the amino acid that is selected from down group: Ala, Val, Leu or Ile;
Xaa6 is the amino acid that is selected from down group: Gln or Asn;
Xaa7 is the amino acid that is selected from down group: Thr or Ser;
Xaa8 is the amino acid that is selected from down group: Pro or Ala;
Xaa9 is the amino acid that is selected from down group: His or Arg;
Xaa10 is the amino acid that is selected from down group: Thr or Ser;
Xaa11 is the amino acid that is selected from down group: His or Arg;
Xaa12 is the amino acid that is selected from down group: Asn or Gln;
Xaa13 is the amino acid that is selected from down group: Arg or Lys;
Xaa14 is the amino acid that is selected from down group: Thr or Ser;
Xaa15 is the amino acid that is selected from down group: Pro or Ala;
Xaa16 is the amino acid that is selected from down group: Glu or Asp;
Xaa17 is the amino acid that is selected from down group: Asn or Gln;
Xaa18 is the amino acid that is selected from down group: Phe or Leu;
Xaa19 is the amino acid that is selected from down group: Pro or Ala;
Xaa20 is the amino acid that is selected from down group: Cys or Ser;
Xaa21 is the amino acid that is selected from down group: Lys or Arg;
Xaa22 is the amino acid that is selected from down group: Asn or Gln;
Xaa23 is the amino acid that is selected from down group: Leu, Ile, Val, Met, Ala or Phe;
Xaa24 is the amino acid that is selected from down group: Asp or Glu;
Xaa25 is the amino acid that is selected from down group: Glu or Asp;
Xaa26 is the amino acid that is selected from down group: Asn or Gln;
Xaa27 is the amino acid that is selected from down group: Tyr or Phe;
Xaa28 does not have, or 1-3 amino acid constitutes the peptide section;
And described polypeptide has the activity of angiogenesis inhibiting, and the length of described polypeptide is 27-33 amino acid.
2. polypeptide as claimed in claim 1 is characterized in that, described polypeptide is a cyclic peptide.
3. polypeptide as claimed in claim 1 is characterized in that, Xaa0 is that Cys and Xaa28 are Cys, and described polypeptide is linear; Perhaps Xaa0 is that Cys and Xaa28 are two halfcystines formation disulfide linkage of Cys and Xaa0 and Xaa28 position.
4. polypeptide as claimed in claim 1 is characterized in that, described polypeptide is selected from down group:
(a) has the polypeptide of aminoacid sequence shown in the SEQ ID NO:1,2 or 3;
(b) aminoacid sequence shown in the SEQ ID NO:1,2 or 3 is formed through replacement, disappearance or the interpolation of 1-5 amino-acid residue, and have the angiogenesis inhibiting function by (a) polypeptides derived.
5. an isolated nucleic acid molecule is characterized in that, the described polypeptide of its coding claim 1.
6. pharmaceutical composition is characterized in that it contains:
(a) the described polypeptide of claim 1 or its pharmacy acceptable salt; With
(b) pharmaceutically acceptable carrier or vehicle.
7. pharmaceutical composition as claimed in claim 6 is characterized in that, the formulation of described composition is collyrium, injection, gel for eye use or spongaion.
8. the purposes of polypeptide as claimed in claim 1 or pharmacy acceptable salt is characterized in that, is used to prepare the medicine that is used for angiogenesis inhibiting or control and relevant diseases of angiogenesis.
9. purposes as claimed in claim 8, it is characterized in that being selected from of described and relevant diseases of angiogenesis organized down: neovascular illness in eye, tumour, ischemic heart disease, non-inflammation myocardosis, coronary sclerosis, atherosclerosis obliterans, arterial thrombosis, arterial thrombus, Berger ' s disease, chronic inflammatory diseases, inflammatory bowel, ulcer, rheumatic arthritis, scleroderma, psoriatic, infertility and sarcoma shape disease.
10. a method that suppresses Mammals blood vessel new life is characterized in that, comprises step: use polypeptide of the present invention or its pharmacy acceptable salt for the object of needs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910054509 CN101942012A (en) | 2009-07-08 | 2009-07-08 | Polypeptide for preventing and treating angiogenesis and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200910054509 CN101942012A (en) | 2009-07-08 | 2009-07-08 | Polypeptide for preventing and treating angiogenesis and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101942012A true CN101942012A (en) | 2011-01-12 |
Family
ID=43434239
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200910054509 Pending CN101942012A (en) | 2009-07-08 | 2009-07-08 | Polypeptide for preventing and treating angiogenesis and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101942012A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019043649A2 (en) | 2017-08-31 | 2019-03-07 | Singapore Health Services Pte Ltd | Angio-3 for treatment of retinal angiogenic diseases |
| CN110092816A (en) * | 2018-01-29 | 2019-08-06 | 上海市第一人民医院 | Prevent and treat micromolecule polypeptide and its application of fibrosis |
-
2009
- 2009-07-08 CN CN 200910054509 patent/CN101942012A/en active Pending
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019043649A2 (en) | 2017-08-31 | 2019-03-07 | Singapore Health Services Pte Ltd | Angio-3 for treatment of retinal angiogenic diseases |
| CN111344002A (en) * | 2017-08-31 | 2020-06-26 | 新加坡保健服务集团 | Angio-3 for the treatment of retinal angiogenic diseases |
| JP2020532586A (en) * | 2017-08-31 | 2020-11-12 | シンガポール ヘルス サービシーズ プライベート リミテッド | ANGIO-3 for the treatment of retinal vascular disease |
| EP3675889A4 (en) * | 2017-08-31 | 2021-05-12 | Singapore Health Services PTE Ltd | Angio-3 for treatment of retinal angiogenic diseases |
| US11266710B2 (en) | 2017-08-31 | 2022-03-08 | Singapore Health Services Pte Ltd. | Angio-3 for treatment of retinal angiogenic diseases |
| CN110092816A (en) * | 2018-01-29 | 2019-08-06 | 上海市第一人民医院 | Prevent and treat micromolecule polypeptide and its application of fibrosis |
| CN110092816B (en) * | 2018-01-29 | 2023-08-01 | 上海市第一人民医院 | Small molecule polypeptide for preventing and treating fibrosis and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2316356T3 (en) | COMPLEMENTARY SYNTHETIC PEPTIDES AND ITS OPHTHALMOLOGICAL USES. | |
| CN104072580B (en) | For peptide promoting angiogenesis and application thereof | |
| JPH05506030A (en) | How to predispose mammals to promote tissue repair | |
| CN102827253A (en) | Micro-molecular polypeptide inhibiting inflammatory response, and application thereof | |
| TW200829267A (en) | Method of treating endothelial dysfunction | |
| CN102336811B (en) | The little peptide of the suppression new vessel that one class is new and application thereof | |
| CN106552260A (en) | Interleukin-13 7 generates the application in disease in modulating vascular | |
| CN101942012A (en) | Polypeptide for preventing and treating angiogenesis and application thereof | |
| CN102336812B (en) | A kind of polypeptide with inhibiting angiogenesis activity | |
| CN101503458B (en) | Small molecular polypeptide for preventing and treating angiogenesis and application thereof | |
| CN102311485A (en) | Polypeptide with neovascularization suppression effect and application thereof | |
| CN104341489B (en) | Novel polypeptide for inhibiting new blood vessel and application thereof | |
| CN103087153B (en) | New neovessel inhibition small peptides and applications thereof | |
| CN104004057B (en) | The little peptide of one class suppression new vessels and application thereof | |
| CN101015683B (en) | Application of human RTN4B protein in preparation of medicine for healing wound | |
| CN103992376B (en) | Small peptides inhibiting new vessels and application | |
| CN103159851A (en) | Micromolecule polypeptide preventing and restraining inflammation and application thereof | |
| CN100334114C (en) | Novel fusion protein production and uses | |
| CN104004066A (en) | Micromolecular polypeptide for preventing or inhibiting inflammatory response and angiogenesis and application thereof | |
| CN105017406B (en) | Novel polypeptide with neuroprotective function | |
| CN103992377B (en) | Small peptides inhibiting new vessels and application | |
| CN102838660B (en) | A kind of little peptide suppressing inflammatory and immune response and application thereof | |
| JPH0680694A (en) | Polypeptide/polymer ion complex active for wound healing | |
| US8933031B2 (en) | Polypeptide inhibiting angiogenesis and application thereof | |
| WO2013060020A1 (en) | Novel small peptide capable of inhibiting new vessels and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20110112 |