CN104004066A - Micromolecular polypeptide for preventing or inhibiting inflammatory response and angiogenesis and application thereof - Google Patents

Abstract

The invention relates to a small molecular polypeptide for preventing and inhibiting inflammatory response and angiogenesis and application thereof. The invention also relates to the preparation method of the small molecule polypeptide and the pharmaceutical composition containing the polypeptide. The polypeptide of the present invention has many advantages, such as small molecular weight, can pass through various eye tissue barriers; good water solubility, can maintain a high concentration in neutral tears, aqueous humor and vitreous; simple synthesis, low preparation cost, etc.

Description

Small molecular polypeptide for preventing or inhibiting inflammatory response and angiogenesis and application thereof

technical field

The present invention relates to the field of biomedicine, in particular, the present invention relates to a class of small molecule polypeptides for preventing and/or treating inflammatory response and angiogenesis and applications thereof.

Background technique

Inflammation is a complex physiological and pathological response of body tissues with vascular system to harmful stimuli from internal and external environments. It is not only a protective defense response, but also a common pathway that causes many important diseases in the human body, such as infection, tumor, cardiovascular and cerebrovascular diseases, neurodegeneration, allergic diseases and autoimmune diseases. Stimuli such as pathogen infection and various endogenous injuries persist, which can stimulate a variety of immune and inflammatory cells, initiate adaptive immunity, and mediate the production of various pro-inflammatory cytokines, biologically active substances and growth factors, such as TNF- α, IL-1β, IL-6, CCL, CXCL, COX-2, reactive oxygen species (ROS), adhesion molecules, VEGF and TGF-β, etc., and then a cascade amplification effect occurs, causing tissue and cell damage and proliferation , Migration, apoptosis, autophagy, necrosis, neovascularization and other pathological reactions.

Pathological angiogenesis is also the pathological basis of various systemic and local diseases, including neovascular eye diseases, neovascularization of tumors, rheumatoid arthritis, psoriasis, etc. It involves the proliferation, migration, erosion and management of vascular endothelial cells Many processes, such as lumen formation, are strictly regulated by the balance of pro-angiogenic and anti-angiogenic factors. When this balance is broken, the cell signal of angiogenesis can be initiated, leading to its occurrence.

It can be seen that inflammation and neovascularization are closely related in pathogenesis and involved diseases. The same eye diseases, such as corneal infection, uveitis, inflammation-related glaucoma, neovascular glaucoma, diabetic retinopathy, retinopathy of prematurity, periretinal phlebitis, retinal vein occlusion, age-related macular degeneration, etc. , are closely related to pathological changes such as inflammatory infiltration, exudation, neovascular hemorrhage, and fibrosis of ocular tissues, resulting in severe damage to the visual function of patients, which in turn affects their quality of life.

However, the current treatment methods for such diseases are very limited, the effect is not ideal, and the safety needs to be further confirmed. The main treatment methods are local or systemic use of glucocorticoids, immunosuppressants, anti-TNF-α antagonists and VEGF inhibitors. These drugs usually have a certain curative effect, but due to the recurrence and intractability of such diseases, long-term use of hormones and immunosuppressants can cause increased intraocular pressure, cataracts, endophthalmitis, osteoporosis, liver and kidney function damage, Diabetes and other serious complications; and TNF-α antagonists have the risk of exacerbating or inducing demyelinating diseases, bilateral anterior optic neuropathy, tuberculosis, etc. At the same time, TNF-α and VEGF inhibitors are biomacromolecules, affected by ocular anatomy and functional barrier restrictions, it is difficult to achieve ideal bioavailability in ocular tissue by local or systemic administration; secondly, the eyeball is The human body is a special immune immune organ. The above-mentioned exogenous biological macromolecular protein drugs enter the eyeball many times, which may induce antigen-antibody reactions, trigger or aggravate ocular inflammatory damage; in addition, anti-TNF-α, VEGF and other such biological Compared with traditional drugs, the preparations are less toxic and have clearer targets. However, these biotherapeutic drugs are complex to synthesize and have high requirements for downstream processes and production of biotechnology, which makes them expensive and poses certain obstacles to their widespread application.

It can be seen that looking for small-molecule anti-inflammatory and anti-angiogenesis drugs with specific biological activity and good biocompatibility can pass through the barriers of various layers of ocular tissue through non-invasive or minimally invasive drug delivery routes, and improve the local biological function of the eye. Utilization, to reduce local and systemic side effects, has become an urgent problem to be solved in the field of clinical treatment of the above-mentioned various blinding eye diseases.

Contents of the invention

The object of the present invention is to provide a small molecular polypeptide with dual functions of preventing and treating inflammatory response and angiogenesis and its application.

In the first aspect of the present invention, there is provided a polypeptide represented by the following formula I, or a pharmaceutically acceptable salt thereof

[Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-[Xaa9]-[Xaa10]-[Xaa11]-[Xaa12 ]-[Xaa13]-[Xaa14]-[Xaa15]-[Xaa16]-[Xaa17]-[Xaa18]-[Xaa19]-[Xaa20]-[Xaa21]-[Xaa22]-[Xaa23]-[Xaa24]( I)

In the formula,

Xaa0 is none, or 1-3 amino acids constitute a peptide;

Xaa1 is an amino acid selected from the group consisting of Lys, Arg, Gln, or Asn;

Xaa2 is an amino acid selected from the group consisting of Asp, or Glu;

Xaa3 is an amino acid selected from the group consisting of Lys, Arg, Gln, or Asn;

Xaa4 is an amino acid selected from the group consisting of Ala, Val, Leu, or Ile;

Xaa5 is an amino acid selected from the group consisting of Met, Leu, Phe, or Ile;

Xaa6 is an amino acid selected from the group consisting of Leu, Ile, Val, Met, Ala, or Phe;

Xaa7 is an amino acid selected from the group consisting of Phe, Leu, Val, Ile, Ala, or Tyr;

Xaa8 is an amino acid selected from the group consisting of Thr, or Ser;

Xaa9 is an amino acid selected from the group consisting of Tyr, Trp, Phe, Thr, or Ser;

Xaa10 is an amino acid selected from the group consisting of Asp, or Glu;

Xaa11 is an amino acid selected from the group consisting of Gln, or Asn;

Xaal2 is an amino acid selected from the group consisting of Tyr, Trp, Phe, Thr, or Ser;

Xaa13 is an amino acid selected from the group consisting of Gln, or Asn;

Xaa14 is an amino acid selected from the group consisting of Glu, or Asp;

Xaa15 is an amino acid selected from the group consisting of Asn, Gln, His, Lys, or Arg;

Xaal6 is an amino acid selected from the group consisting of Asn, Gln, His, Lys, or Arg;

Xaa17 is an amino acid selected from the group consisting of Val, Ile, Leu, Met, Phe, or Ala;

Xaa18 is an amino acid selected from the group consisting of Asp, or Glu;

Xaa19 is an amino acid selected from the group consisting of Gln, or Asn;

Xaa20 is an amino acid selected from the group consisting of Ala, Val, or Leu, Ile;

Xaa21 is an amino acid selected from the group consisting of Ser, or Thr;

Xaa22 is an amino acid selected from the group consisting of Gly, Pro, or Ala;

Xaa23 is an amino acid selected from the group consisting of Ser, or Thr;

Xaa24 is none, or 1-3 amino acids constitute a peptide;

And the length of the polypeptide is 23-29 amino acids.

More preferably, the peptide segment is

Xaa1 is an amino acid selected from the group consisting of Lys, or Arg;

Xaa2 is an amino acid selected from the group consisting of Asp, or Glu;

Xaa3 is an amino acid selected from the group consisting of Lys, or Arg;

Xaa4 is an amino acid selected from the group consisting of Ala, or Val;

Xaa5 is an amino acid selected from the group consisting of Met, or Leu;

Xaa6 is an amino acid selected from the group consisting of Leu, or Ile;

Xaa7 is an amino acid selected from the group consisting of Phe, or Leu;

Xaa8 is an amino acid selected from the group consisting of Thr, or Ser;

Xaa9 is an amino acid selected from the group consisting of Tyr, or Phe;

Xaa10 is an amino acid selected from the group consisting of Asp, or Glu;

Xaa11 is an amino acid selected from the group consisting of Gln, or Asn;

Xaa12 is an amino acid selected from the group consisting of Tyr, or Phe;

Xaa13 is an amino acid selected from the group consisting of Gln, or Asn;

Xaa14 is an amino acid selected from the group consisting of Glu, or Asp;

Xaa15 is an amino acid selected from the group consisting of Asn, or Gln;

Xaa16 is an amino acid selected from the group consisting of Asn, or Gln;

Xaa17 is an amino acid selected from the group consisting of Val, or Leu;

Xaa18 is an amino acid selected from the group consisting of Asp, or Glu;

Xaa19 is an amino acid selected from the group consisting of Gln, or Asn;

Xaa20 is an amino acid selected from the group consisting of Ala, or Val;

Xaa21 is an amino acid selected from the group consisting of Ser, or Thr;

Xaa22 is an amino acid selected from the group consisting of Gly, or Ala;

Xaa23 is an amino acid selected from the group consisting of Ser, or Thr;

Xaa24 is None.

In another preferred embodiment, Xaa0 is a peptide segment consisting of 1-3 amino acids, more preferably, 1-2.

In another preferred example, Xaa24 is a peptide segment consisting of 1-3 amino acids, more preferably 1-2.

In another preferred example, the length of the polypeptide is 22-29 amino acids.

In another preferred embodiment, the polypeptide is selected from the following group:

(a) have the polypeptide of aminoacid sequence shown in SEQ ID NO:2;

(b) Substituting the amino acid sequence shown in SEQ ID NO: 2 with 1-6 (preferably, 1-4, more preferably 1-3, and most preferably 1-2) amino acid residues, The polypeptide derived from (a) is formed by deletion or addition, and has the function of inhibiting inflammatory response and angiogenesis.

In another preferred example, the derivative polypeptide retains ≥70% of the activity of inhibiting inflammatory response and inhibiting angiogenesis of the polypeptide shown in SEQ ID NO:2.

In another preferred example, the identity of the derived polypeptide to SEQ ID NO: 2 is ≥80%, preferably ≥90%; more preferably ≥95%.

In a second aspect of the present invention there is provided an isolated nucleic acid molecule encoding the polypeptide of the first aspect.

In another preference, the nucleic acid molecule has the sequence shown in SEQ ID NO:1.

In a third aspect of the present invention, a pharmaceutical composition is provided, which contains:

(a) the polypeptide described in the first aspect or a pharmaceutically acceptable salt thereof; and

(b) A pharmaceutically acceptable carrier or excipient.

In another preferred example, the dosage form of the composition is eye drops, injections, ophthalmic gel or ophthalmic ointment.

In another preferred example, the composition is a relief dosage form.

In the fourth aspect of the present invention, there is provided the use of the polypeptide or pharmaceutically acceptable salt described in the first aspect for the preparation of a medicament for inhibiting inflammatory response and angiogenesis, and/or the medicament For the prevention and treatment of (a) inflammation-related diseases; (b) neovascularization-related diseases.

In another preferred example, the inflammation-related diseases are selected from the group consisting of ocular inflammatory diseases, pancreatitis, inflammatory bowel disease, lung inflammation, contact dermatitis, rheumatoid arthritis, ankylosing spondylitis ;

The angiogenesis-related diseases are selected from the group consisting of neovascular eye disease, tumor, ischemic heart disease, non-inflammatory cardiomyopathy, coronary arteriosclerosis, arteriosclerosis obliterans, arterial embolism, arterial thrombosis, Berger's disease, chronic Inflammation, inflammatory bowel disease, ulcers, rheumatoid arthritis, scleroderma, psoriasis, infertility, and sarcoidosis.

In another preferred example, the drug prevents or treats diseases related to inflammation and neovascularization selected from the following group: ocular corneal infection, uveitis, inflammation-related glaucoma, neovascular glaucoma, diabetic Retinopathy, retinopathy of prematurity, periretinal phlebitis, age-related macular degeneration, inflammatory bowel disease, contact dermatitis, rheumatoid arthritis, ankylosing spondylitis

In the fifth aspect of the present invention, there is provided a method for inhibiting inflammation in a mammal, administering the polypeptide of the present invention or a pharmaceutically acceptable salt thereof to a subject in need.

In another preferred example, the subject is human.

In another preferred example, the inflammatory response is an inflammatory response associated with uveitis.

It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described in the following (such as embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, we will not repeat them here.

Description of drawings

The following drawings are used to illustrate specific embodiments of the present invention, but not to limit the scope of the present invention defined by the claims.

Figure 1 shows the photographs of the anterior segment of rats, in which there was a large amount of fibrous exudation in the pupil area of the anterior chamber of the animals in the LPS group, resulting in the closure of the pupil, and the iris blood vessels were obviously dilated and congested; while in the KS23 group and the dexamethasone intervention group, only the iris was visible Vascular congestion was obvious, but no obvious fibrous exudation membrane was seen.

Figure 2 shows the histological sections of rat eyeballs, in which the cell infiltration in the anterior chamber angle of the KS23 intervention group was significantly less than that of the LPS group; No cellular infiltration was seen.

Figure 3 shows the measurement results of total protein in aqueous humor and cell exudation. Figure 3(a) shows that 24 hours after LPS modeling, the protein level in aqueous humor in the intervention group given KS23 or dexamethasone was significantly reduced. Figure 3(b) shows that the number of exudated cells in the aqueous humor of the KS23 group and the dexamethasone group was significantly lower than that of the LPS group.

Figure 4 shows the results of MTS cell viability detection. Under different concentrations, the absorbance of MTS is not different from that of the control group.

Figure 5 shows the detection of inflammatory factors induced by LPS stimulation, in which Figure 5(a) shows that in terms of IL-6, the 10μM KS23 group and the 50μM KS23 group were significantly reduced compared with the LPS group, while the 1μM KS23 group and the LPS group had no significant difference ; Figure 5(b) shows that for TNF-α, the TNF-α levels in the 10 μM and 50 μM KS23 intervention groups were significantly lower than those in the LPS group, and there was no significant difference between the 1 μM KS23 group TNF-α and the LPS group.

Figure 6(a) and (b) show that KS23 has a dose-dependent inhibitory effect on the transcription and expression of IL-6 and TNF-α, respectively.

Figure 7 shows that the KS23-treated filter paper sheet (especially the 50 μM group) significantly inhibited the reduction in the number of branched blood vessels in the allantoic membrane of chicken embryos, and the number of microvessels was significantly reduced compared with the PBS group.

Figure 8 shows that the uncovered area of cells in the scratch area of the KS23 intervention group (50 μM) was significantly increased compared with the VEGF stimulation group, suggesting that the KS23 intervention significantly reduced the migration of endothelial cells induced by VEGF.

Detailed ways

After extensive and in-depth research, the inventors firstly prepared a small molecule polypeptide with dual functions of inhibiting inflammatory response and angiogenesis, with a molecular weight of less than 3KD (about 2652D). Specifically, the inventors applied the method of bioinformatics, selected several candidate sequences based on the analysis of homology and biological characteristics, synthesized them by solid-phase method, and then induced them by experimental endotoxin. The uveitis model and the chicken embryo allantoic membrane model were screened, and a new type of small molecule polypeptide, KS23, which can inhibit ocular inflammatory immune response and angiogenesis, was obtained.

The small peptide KS23 of the present invention has a small molecular weight and can penetrate various eye tissue barriers; has good water solubility and can maintain a high concentration in neutral tears, aqueous humor and vitreous humor; has high safety and has no toxic side effects on biological tissues Small; ophthalmic topical drug bioavailability is high, which is beneficial to reduce systemic side effects. The present invention has been accomplished on this basis.

active peptide

In the present invention, the terms "polypeptide of the present invention", "KS23 polypeptide", "KS23 small peptide" or "peptide KS23" are used interchangeably, and all refer to the peptide KS23 amino acid sequence (SEQ ID NO :2, the protein or polypeptide of KDKAMLFTYDQYQENNVDQASGS). In addition, the term also includes variant forms of SEQ ID NO: 2 that have the function of inhibiting inflammatory response and angiogenesis. These variations include (but are not limited to): 1-6 (usually 1-5, preferably 1-3, more preferably 1-2, and most preferably 1) amino acid deletions, insertions And/or substitution, adding one or several (usually within 5, preferably within 3, more preferably within 2) amino acids at the C-terminal and/or N-terminal. For example, in the art, substitutions with amino acids with similar or similar properties generally do not change the function of the protein. The addition of one or several amino acids at the C-terminus and/or N-terminus usually does not alter the structure and function of the protein. Furthermore, the term also includes monomeric and multimeric forms of the polypeptides of the invention.

The present invention also includes active fragments, derivatives and analogs of KS23 protein. As used herein, the terms "fragment", "derivative" and "analogue" refer to a polypeptide that substantially retains the function or activity of inhibiting inflammatory response and angiogenesis. The polypeptide fragments, derivatives or analogs of the present invention may be (i) polypeptides having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, or (ii) A polypeptide with substituent groups in amino acid residues, or (iii) a polypeptide formed by fusion of a KS23 polypeptide with another compound (such as a compound that extends the half-life of the polypeptide, such as polyethylene glycol), or (iv) an additional amino acid sequence The polypeptide fused to this polypeptide sequence (subsequent protein fused with leader sequence, secretory sequence or 6His and other tag sequences). Such fragments, derivatives and analogs are within the purview of those skilled in the art in light of the teachings herein.

One class of preferred active derivatives refers to that compared with the amino acid sequence of formula I, there are at most 5, preferably at most 3, more preferably at most 2, and most preferably 1 amino acid is replaced by an amino acid with similar or similar properties. substitution to form a polypeptide. These conservative variant polypeptides are preferably produced by amino acid substitutions according to Table 1.

Table 1

initial residue representative replacement preferred substitution Ala(A) Val; Leu; Ile Val Arg(R) Lys; Gln; Asn Lys Asn(N) Gln; His; Lys; Arg Gln Asp(D) Glu Glu Cys(C) Ser Ser

Gln(Q) Asn Asn Glu(E) Asp Asp Gly(G) Pro; Ala His(H) Asn; Gln; Lys; Arg Arg Ile (I) Leu; Val; Met; Ala; Phe Leu Leu(L) Ile; Val; Met; Ala; Phe Ile Lys(K) Arg; Gln; Asn Arg Met(M) Leu; Phe; Ile Leu Phe(F) Leu; Val; Ile; Ala; Tyr Leu Pro(P) Ala Ala Ser(S) Thr Thr Thr(T) Ser Ser Trp(W) Tyr; Phe Tyr Tyr(Y) Trp; Phe; Thr; Ser Phe Val(V) Ile; Leu; Met; Phe; Leu

The invention also provides analogs of KS23 polypeptides. The difference between these analogs and the natural KS23 polypeptide may be the difference in amino acid sequence, or the difference in the modified form that does not affect the sequence, or both. Analogs also include analogs with residues other than natural L-amino acids (eg, D-amino acids), and analogs with non-naturally occurring or synthetic amino acids (eg, β, γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides exemplified above.

Modified (usually without altering primary structure) forms include: chemically derivatized forms of polypeptides such as acetylation or carboxylation, in vivo or in vitro. Modifications also include glycosylation, such as those resulting from polypeptides that are modified by glycosylation during synthesis and processing of the polypeptide or during further processing steps. Such modification can be accomplished by exposing the polypeptide to an enzyme that performs glycosylation, such as a mammalian glycosylase or deglycosylation enzyme. Modified forms also include sequences with phosphorylated amino acid residues (eg, phosphotyrosine, phosphoserine, phosphothreonine). It also includes polypeptides modified to improve their proteolytic resistance or to optimize their solubility (such as Retro-inverso peptides in which all amino acid sequences of SEQ ID NO: 2 are combined with D-type amino acids in reverse order).

The polypeptides of the present invention can also be used in the form of salts derived from pharmaceutically or physiologically acceptable acids or bases. These salts include, but are not limited to, those formed with the following acids: hydrochloric, hydrobromic, sulfuric, citric, tartaric, phosphoric, lactic, pyruvic, acetic, succinic, oxalic, fumaric, maleic, acid, oxaloacetic acid, methanesulfonic acid, ethanesulfonic acid, benzenesulfonic acid, or isethionic acid. Other salts include those formed with alkali or alkaline earth metals such as sodium, potassium, calcium or magnesium, as well as in the form of esters, carbamates or other conventional "prodrugs".

coding sequence

The present invention also relates to polynucleotides encoding KS23 polypeptides. A preferred coding sequence is AAGGACAAGGCTATGCTCTTCACCTATGATCAGTACCAGGAAAATAATGTGGACCAGGCCTCCGGCTCT (SEQ ID NO: 1).

A polynucleotide of the invention may be in the form of DNA or RNA. DNA can be either the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide can be the same as the sequence of the coding region shown in SEQ ID NO: 1 or a degenerate variant. As used herein, "degenerate variant" in the present invention refers to a nucleic acid sequence that encodes a protein with SEQ ID NO: 2, but differs from the corresponding coding region sequence in SEQ ID NO: 1.

The full-length KS23 nucleotide sequence or its fragments of the present invention can usually be obtained by PCR amplification, recombination or artificial synthesis. At present, the DNA sequence encoding the polypeptide (or its fragment, or its derivative) of the present invention can be obtained completely through chemical synthesis. This DNA sequence can then be introduced into various existing DNA molecules (or eg vectors) and cells known in the art.

The present invention also relates to a vector comprising the polynucleotide of the present invention, and a host cell produced by genetic engineering using the vector or the KS23 protein coding sequence of the present invention.

On the other hand, the present invention also includes polyclonal antibodies and monoclonal antibodies, especially monoclonal antibodies, specific to the polypeptide encoded by KS23DNA or its fragments.

Preparation

The polypeptides of the present invention may be recombinant polypeptides or synthetic polypeptides. The polypeptides of the invention may be chemically synthesized, or recombinant. Correspondingly, the polypeptide of the present invention can be artificially synthesized by conventional methods, and can also be produced by recombinant methods.

A preferred method is to use liquid-phase synthesis technology or solid-phase synthesis technology, such as Boc solid-phase method, Fmoc solid-phase method or a combination of the two methods. Solid-phase synthesis can quickly obtain samples, and the appropriate resin carrier and synthesis system can be selected according to the sequence characteristics of the target peptide. For example, the preferred solid phase carrier in the Fmoc system is Wang resin connected with the C-terminal amino acid in the peptide, the Wang resin structure is polystyrene, and the arm between the amino acid is 4-alkoxybenzyl alcohol; use 25% hexahydropyridine /dimethylformamide at room temperature for 20 minutes to remove the Fmoc protecting group, and extend from the C-terminal to the N-terminal one by one according to the given amino acid sequence. After the synthesis is completed, the synthesized proinsulin-related peptide is cleaved from the resin with trifluoroacetic acid containing 4% p-cresol and the protective group is removed, and the resin can be filtered off and separated by ether precipitation to obtain the crude peptide. After lyophilization of the resulting product solution, the desired peptide was purified by gel filtration and reverse phase high pressure liquid chromatography. When using the Boc system for solid-phase synthesis, the preferred resin is a PAM resin connected to the C-terminal amino acid in the peptide. The structure of the PAM resin is polystyrene, and the arm between the amino acid is 4-hydroxymethylphenylacetamide; synthesized in Boc In the system, in a cycle of deprotection, neutralization, and coupling, the protecting group Boc is removed with TFA/dichloromethane (DCM) and neutralized with diisopropylethylamine (DIEA/dichloromethane. Peptide chain condensation is completed Afterwards, use hydrogen fluoride (HF) containing p-cresol (5-10%), treat at 0°C for 1 hour, cut the peptide chain from the resin, and remove the protecting group at the same time. With 50-80% acetic acid (containing A small amount of mercaptoethanol) to extract the peptide, the solution is lyophilized and further separated and purified with molecular sieve Sephadex G10 or Tsk-40f, and then purified by high-pressure liquid phase to obtain the desired peptide. Various couplings known in the field of peptide chemistry can be used Reagents and coupling methods can be used to couple amino acid residues, for example, dicyclohexylcarbodiimide (DCC), hydroxybenzotriazole (HOBt) or 1,1,3,3-tetrauronium hexafluorophosphate can be used (HBTU) for direct coupling. For the synthesized short peptide, its purity and structure can be confirmed by reversed-phase high-performance liquid phase and mass spectrometry analysis.

In a preferred example, the polypeptide KS23 of the present invention is prepared by solid-phase synthesis according to its sequence, purified by high-performance liquid chromatography to obtain a high-purity lyophilized powder of the target peptide, and stored at -20°C.

Another approach is to use recombinant techniques to produce the polypeptides of the invention. The polynucleotides of the present invention can be used to express or produce recombinant KS23 polypeptides by conventional recombinant DNA techniques. Generally speaking, there are the following steps:

(1) Transform or transduce a suitable host cell with the polynucleotide (or variant) encoding the KS23 polypeptide of the present invention, or with a recombinant expression vector containing the polynucleotide;

(2) host cells cultured in a suitable medium;

(3) Separation and purification of protein from culture medium or cells.

Recombinant polypeptides can be expressed intracellularly, on the cell membrane, or secreted extracellularly. The recombinant protein can be isolated and purified by various separation methods by taking advantage of its physical, chemical and other properties, if desired. These methods are well known to those skilled in the art. Examples of these methods include, but are not limited to: conventional refolding treatment, treatment with protein precipitating agents (salting out method), centrifugation, osmotic disruption, supertreatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption layer Analysis, ion exchange chromatography, high performance liquid chromatography (HPLC) and various other liquid chromatography techniques and combinations of these methods.

Since the polypeptide of the present invention is relatively short, multiple polypeptides can be concatenated together, the expression product can be obtained after recombinant expression, and then the desired small peptide can be formed by enzymatic digestion and other methods.

Pharmaceutical compositions and methods of administration

In another aspect, the present invention also provides a pharmaceutical composition, which contains (a) a safe and effective amount of the polypeptide of the present invention or a pharmaceutically acceptable salt thereof; and (b) a pharmaceutically acceptable carrier or excipient . The amount of the polypeptide of the present invention is usually 10 μg-100 mg/dose, preferably 100-1000 μg/dose.

For the purposes of the present invention, an effective dosage is about 0.01 mg/kg to 50 mg/kg, preferably 0.05 mg/kg to 10 mg/kg body weight of the polypeptide of the present invention administered to an individual. In addition, the polypeptides of the present invention can be used alone or together with other therapeutic agents (eg formulated in the same pharmaceutical composition).

The pharmaceutical composition may also contain a pharmaceutically acceptable carrier. The term "pharmaceutically acceptable carrier" refers to a carrier for the administration of a therapeutic agent. The term refers to pharmaceutical carriers which do not, by themselves, induce the production of antibodies deleterious to the individual receiving the composition and which are not unduly toxic upon administration. These vectors are well known to those of ordinary skill in the art. A thorough discussion of pharmaceutically acceptable excipients can be found in Remington's Pharmaceutical Sciences (Mack Pub. Co., N.J. 1991). Such carriers include, but are not limited to: saline, buffer, dextrose, water, glycerol, ethanol, adjuvants, and combinations thereof.

Pharmaceutically acceptable carriers in therapeutic compositions can contain liquids, such as water, saline, glycerol and ethanol. In addition, there may also be auxiliary substances in these carriers, such as wetting agents or emulsifying agents, pH buffering substances and the like.

Typically, therapeutic compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution, or suspension, in liquid carriers prior to injection can also be prepared.

Once formulated, the compositions of the present invention can be administered by conventional routes including, but not limited to, intraocular, intramuscular, intravenous, subcutaneous, intradermal, or topical administration. The subject to be prevented or treated can be an animal; especially a human.

When the pharmaceutical composition of the present invention is used for actual treatment, various dosage forms of the pharmaceutical composition can be used according to the usage conditions. Preferably, eye drops, injections, ophthalmic gels and ophthalmic ointments can be exemplified.

These pharmaceutical compositions can be formulated by mixing, diluting or dissolving according to conventional methods, and occasionally adding suitable pharmaceutical additives such as excipients, disintegrants, binders, lubricants, diluents, buffers, isotonic agents, etc. (isotonicities), preservatives, wetting agents, emulsifiers, dispersants, stabilizers and co-solvents, and the preparation process can be carried out in a conventional manner depending on the dosage form.

For example, the preparation of eye drops can be carried out as follows: the short peptide KS23 or its pharmaceutically acceptable salt is dissolved in sterile water (surfactant is dissolved in sterile water) together with the basic substance, and the osmotic pressure is adjusted and pH to physiological state, and optionally add suitable pharmaceutical additives such as preservatives, stabilizers, buffers, isotonic agents, antioxidants and viscosifiers, and then completely dissolve.

The pharmaceutical compositions of the present invention can also be administered in the form of sustained release formulations. For example, the short peptide KS23 or its salt can be incorporated into pills or microcapsules supported by slow-release polymers, and then the pills or microcapsules are surgically implanted into the tissues to be treated. In addition, the short peptide KS23 or its salt can also be applied by inserting a pre-coated intraocular lens. Examples of sustained-release polymers include ethylene-vinyl acetate copolymers, polyhydroxymethacrylate (polyhydrometaacrylate), polyacrylamide, polyvinylpyrrolidone, methylcellulose, lactic acid polymers, Lactic acid-glycolic acid copolymers and the like are preferably exemplified by biodegradable polymers such as lactic acid polymers and lactic acid-glycolic acid copolymers.

When the pharmaceutical composition of the present invention is used for actual treatment, the dose of the short peptide KS23 or its pharmaceutically acceptable salt as the active ingredient can be adjusted according to the body weight, age, sex, and degree of symptoms of each patient to be treated. be reasonably determined. For example, when topical eye drops, usually the concentration is about 0.1-10wt%, preferably 1-5wt%, can be administered 2-6 times a day, 1-5 drops each time.

Inflammation related diseases

As used herein, the term "inflammation-related diseases" includes various infection or non-infection causes of accumulation of local inflammatory factors and causing local tissue damage, exudation and proliferative diseases.

TNF-α and IL-6, also known as pro-inflammatory cytokines, are key cytokines in the inflammatory response, mainly produced by activated macrophages and monocytes, which can induce the recruitment of inflammatory cells, promote cytokines, peanut The synthesis of tetraenoic acid and nitric oxide plays a vital role in the early stage of host non-specific defense against bacterial, viral and other infections, in stress and in maintaining inflammatory responses

The polypeptide KS23 of the present invention has obvious activity of anti-inflammatory immune response, which is mainly manifested in: the KS23 polypeptide can inhibit the rat uveitis reaction induced by endotoxin (LPS), and reduce the infiltration and infiltration of inflammatory cells in the anterior chamber, vitreous body and retina. The extravasation of protein can inhibit the release of TNF-α and IL-6 inflammatory factors in RAW264.7 mouse macrophages activated by LPS in vitro.

Therefore, the polypeptide of the present invention has therapeutic effects on TNF-α, IL-6, and VEGF-related inflammatory diseases, such as eye corneal infection, uveitis, inflammation-related glaucoma, neovascular glaucoma, diabetic retinopathy, Retinopathy of prematurity, periretinal phlebitis, age-related macular degeneration, inflammatory bowel disease, contact dermatitis, rheumatoid arthritis, ankylosing spondylitis, etc.

Angiogenesis-related diseases

VEGF is the central inducing mediator of angiogenesis cascade reaction, it can induce endothelial cell proliferation, migration and tube formation, and plays an important role in the occurrence and development of tumor neovascularization, neovascular eye disease, rheumatoid arthritis and other diseases .

In the present invention, angiogenesis-related diseases are not particularly limited, and include various angiogenesis-related diseases known in the art. Representative examples of diseases associated with angiogenesis include (but are not limited to): neovascular eye disease, neoplasm, ischemic heart disease, non-inflammatory cardiomyopathy, coronary atherosclerosis, arteriosclerosis obliterans, arterial embolism, Arterial thrombosis, Berger's disease, chronic inflammation, inflammatory bowel disease, ulcer, rheumatoid arthritis, scleroderma, psoriasis, infertility or sarcoid-like disease, etc.

Preferably, the neovascular eye diseases include (but are not limited to): involving the choroid, retina, cornea or iris, including age-related macular degeneration, proliferative diabetic retinopathy, retinal vascular occlusive disease, retinopathy of prematurity , corneal infection, neovascular glaucoma, etc.

The KS23 polypeptide of the present invention can also prevent the neovascularization of chicken embryo allantoic membrane and antagonize the migration of endothelial cells induced by VEGF. Therefore, the polypeptide of the present invention can be used to inhibit angiogenesis so as to treat diseases related to angiogenesis.

Industrial applicability

The pharmaceutical composition containing the peptide of the present invention or a pharmaceutically acceptable salt thereof as an active ingredient has significant inhibitory activity on inflammatory immune response. It is confirmed by in vivo animal experiments that the polypeptide of the present invention can inhibit the intraocular inflammatory response of endotoxin-induced experimental uveitis.

The main advantages of the present invention include:

(a) The polypeptide of the present invention has a small molecular weight and can penetrate various eye tissue barriers;

(b) It has good water solubility and can maintain a high concentration in neutral tear fluid, aqueous humor and vitreous humor;

(c) high safety and little toxic and side effects on biological tissues;

(d) It can be prepared by solid-phase synthesis, and has high purity, large yield and low cost.

Therefore, the polypeptide of the present invention is expected to be developed into a drug for treating diseases related to inflammation and neovascularization.

Below in conjunction with specific embodiment, further illustrate the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention. The experimental method that does not indicate specific conditions in the following examples, usually according to conventional conditions such as Sambrook et al., molecular cloning: the conditions described in the laboratory manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer suggested conditions.

Example 1

Synthesis of Peptides

The KS23 polypeptide whose sequence is SEQ ID NO: 2 was synthesized using a commercially available SYMPHONY polypeptide synthesizer. Proceed as follows:

1. Prepare the required protected amino acid solution, condensation reagent, and cutting reagent according to the software calculation, and add enough DMF and DCM to the corresponding bottle of the instrument

2. Add 100umol FMOC-Ala-Wang-Resin to the reactor,

3. Put a 15mg centrifuge tube on the pipeline where the cutting fluid is collected.

4. Edit the program. Generally, the swelling time of the resin is 30 minutes, the deprotection time is 5 minutes, twice 15 minutes, the condensation time is 30 minutes, and the cutting program is 2 hours.

5. Turn on the computer and synthesize according to the program.

6. Finally, the cutting solution was precipitated with ether, centrifuged, dried, and purified by HPLC.

120 mg of polypeptide KS23 was prepared as white powder (good water solubility), purity: >95%. Seal and store at -20°C for later use.

Example 2

Effect of KS23 on endotoxin-induced experimental uveitis

1. Materials and methods:

1.1 Materials and main instruments and equipment: Wistar rats were purchased from Shanghai Xipro-Bikay Experimental Animal Co., Ltd.; endotoxin (LPS, E.coli055: B5) was purchased from Sigma Company.

1.2 Model making and intervention test: Rats were randomly divided into 4 groups (n=6):

Blank control group;

LPS modeling group;

50μg KS23 vitreous injection intervention group;

10ug dexamethasone vitreous injection intervention group.

Rats were given intraperitoneal injection of 0.4ml/100g body weight of 5% pentobarbital for general anesthesia, compound tropicamide and tetracaine for local mydriasis and surface anesthesia. Draw out 50ug/10uL KS23 solution with an insulin injection needle. Under the operating microscope, avoid the blood vessels near the corner of the sclera and insert the needle. After the injection needle is clearly seen in the vitreous cavity, slowly inject the small peptide solution, stay for 10 seconds, and slowly pull it out. needles. After 30 minutes, wipe the soles of the rear feet of the rats with an alcohol cotton ball, and inject 200ug/100uL LPS solution with an insulin needle.

1.3 Aqueous humor collection and detection: After 24 hours, the animals were anesthetized and photographed with an operating microscope. Then, a microsyringe was used to puncture the central area next to the cornea, and the aqueous humor of both eyes was slowly drawn out, and stored in crushed ice in an EP tube. On the same day, the aqueous humor protein concentration was measured and the inflammatory cells were counted. The protein concentration was determined by the Coomassie brilliant blue (Bradford) method; the cells were counted using a cell counting plate under a microscope after being diluted 5 times with placenta blue staining solution.

1.4 Histological analysis: After 24 hours of LPS injection, the animal was anesthetized, and the complete eyeball was removed. After the bulbous wall fascia was simply separated, it was immediately placed in a special fixative solution and fixed at room temperature for 48 hours. Exudation of inflammatory cells in the corpus and retina (especially the optic nerve head).

1.5 Statistical analysis: Experimental data with Said, using SPSS16.0 statistical software package for statistical analysis. One-way ANOVA was used to compare the inflammatory cells and protein exudation in aqueous humor of each group. P<0.05 means the difference is statistically significant.

2. Results

2.1 Gross and histological sections: photos of the anterior segment of the rats showed a large amount of fibrous exudation in the anterior chamber pupil area of the animals in the LPS group, resulting in pupillary membrane closure and iris blood vessel dilation and hyperemia; while in the KS23 group and the dexamethasone intervention group, only Iris vascular congestion was obvious, but no obvious fibrous exudate membrane (Figure 1).

The tissue sections at the iris and ciliary body showed that the cell exudation in the anterior chamber angle of the KS23 intervention group was significantly less than that of the LPS group; No cellular infiltration was seen.

2.2 Determination of total protein and cells in aqueous humor: Figure 3(a) shows that 24 hours after LPS modeling, the aqueous humor protein content in the LPS group was 19.66±1.76 mg/ml. After the intervention of KS23 or dexamethasone, the protein levels in aqueous humor decreased significantly, respectively 11.21±2.15mg/ml and 7.72±1.14mg/ml, which were significantly different from those in the LPS group (P<0.01). Similarly, Figure 3(b) shows that the number of extracellular cells in the KS23 group and the dexamethasone group (20.25±4.99×10 ⁵ /ml and 11.00±2.94×10 ⁵ /ml) was higher than that of the LPS group (38.33±5.13× 10 ⁵ /ml) decreased significantly (P<0.01). However, there was no difference in the detection of aqueous humor between the intravitreal injection of KS23 polypeptide group and the control group.

3. Conclusion: This example shows from clinical manifestations, aqueous humor inflammatory indicators and histological examination that KS23 short peptide can significantly reduce the performance of the anterior segment of rats with experimental uveitis, reduce the exudation of proteins and inflammatory cells in aqueous humor, and at the same time It can also reduce the infiltration of inflammatory cells in the anterior chamber angle and retinal tissue, and effectively relieve ocular inflammation. Although the anti-inflammatory effect of KS23 short peptide is weaker than that of the classic anti-inflammatory hormone (dexamethasone), the long-term use of the latter may cause steroid-induced glaucoma, drug-induced cataract, and even serious systemic side effects such as osteoporosis and diabetes. In this study, no abnormalities were found in the detection of aqueous humor inflammatory indicators in the short peptide injection group. It can be seen that the small molecule polypeptide (KS23) with specific anti-inflammatory activity, good biocompatibility, and easy tissue penetration has a positive effect on the control of ocular inflammation. Inflammation has unique strengths and prospects.

Example 3

Anti-inflammatory effect of KS23 on RAW264.7 mouse macrophages

1. Materials and methods:

1.1 Materials and main equipment: RAW264.7 mouse macrophage cell line was purchased from the Institute of Cells, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences; endotoxin (LPS, E.coli055:B5, purchased from Sigma); CellTiter AQueous One Solution Cell Proliferation Assay (MTS, purchased from Promega).

1.2 Experimental method: RAW264.7 cells were cultured with high-glucose DMEM and incubated in a 37-degree incubator; after the cells were inoculated at different concentrations, they were incubated with medium containing 10% fetal bovine serum for 24 hours, until the density was about 70-80% ; After giving serum-free medium starvation for 24 hours, the cells of each group were treated with 100ng/ml LPS and different concentrations of KS23.

1.3 MTS cell viability detection: Cells were seeded in 96-well plate at 1×10 ⁵ /well, divided into PBS group, LPS100ng/ml group, KS230.1μM group, KS231μM group, KS2310μM group, KS2350μM group and DXM10μM group, each group 6 duplicate wells, after incubation for 24 hours, add 20 μL of MTS solution to each well, and incubate at 37°C in the dark for 3 hours, then detect the absorbance at a wavelength of 490 nm in an automatic microplate reader;

1.4 Cell culture medium ELISA test: Cells were seeded in 24-well plates at 5×10 ⁵ /well, divided into PBS group, LPS group, LPS+KS231μM group, LPS+KS2310μM group, LPS+KS2350μM group and LPS+DXM10μM group, each group Do 3 replicate holes. After 24 hours, the culture medium was collected and centrifuged at a high speed of 16,000g×10min×4°C, and the supernatant was collected and stored at -80°C for detection of TNF-α and IL-6.

1.5 Cell real time PCR detection: Cells were seeded in a 6-well plate at 5×10 ⁵ /well, grouped in the same way as before, and each group was made with 3 replicate wells. After 6 hours, the cell culture medium was removed, washed with pre-cooled PBS, blotted dry thoroughly, added 500 μL Invitrogen Trizol to lyse, and RT-PCT was performed to detect the levels of TNF-α, IL-6 and GAPDH mRNA.

1.6 Statistical analysis: Experimental data with Said, using SPSS16.0 statistical software package for statistical analysis. One-way ANOVA was used to compare the differences in protein levels and mRNA levels of inflammatory factors in each group. P<0.05 means the difference is statistically significant.

2. Results

2.1 MTS cell viability detection: The experiment showed that the absorbance of KS23 (0.1μM～50μM) MTS was 0.58±0.02, 0.57±0.03, 0.57±0.02, 0.56±0.02, and there was no difference with the control group (0.55±0.02) (P>0.05) , 100ng/mL LPS (0.58±0.03) and 10μM DXM (0.55±0.03) had no significant effect on the viability of RAW264.7 cells (P>0.05). (Figure 4).

2.2 Detection of inflammatory factors: TNF-α and IL-6 are important inflammatory factors induced by LPS stimulation. The level of TNF-α in the 10μM and 50μM KS23 intervention groups (4742±693.3pg/ml; 3352±454.4pg/ml) was significantly lower than that in the LPS group (6413±483.9pg/mL) (*P<0.05, **P<0.01) , 1μM KS23 group TNF-α (5973±283.8pg/ml) and LPS group had no significant difference (P>0.05). In terms of IL-6, the 10μM KS23 group (5223±456.1pg/ml) and the 50μM KS23 group (3343±973.7pg/ml) were also significantly reduced compared with the LPS group (7403±1061pg/mL) (*P<0.05, **P <0.01), while there was no significant difference between the 1μM KS23 group (6387±592.1pg/ml) and the LPS group (P>0.05) (Fig. 5).

The effects of KS23 on LPS-induced TNF-α and IL-6mRNA levels were further detected. After 6 hours of LPS induction, the TNF-αmRNA POWER values in the 10μM group and 50μM group (23.47±2.08 and 17.76±1.54) were significantly lower than those in the LPS group (32.15±2.74) (P<0.01), but not in the 1μM group (28.60±1.42). Inhibition of TNF-α transcription (P>0.05). Similarly, the 10μM (8.30±0.36) and 50μM groups (6.28±0.48) could significantly inhibit the transcription of IL-6 inflammatory cytokines (P<0.01), while the 1μM group (9.87±0.46) and the LPS group (11.39±1.17) had no significant Difference (P>0.05) (Figure 6). The above studies all showed that the 50 μM KS23 intervention group had no significant difference in the inhibitory effect on TNF-α and IL-6 inflammatory factors compared with the 10 μM DXM group (P>0.05).

3. Conclusion: From the results of in vitro experiments, KS23 can inhibit the transcription and synthesis of important pro-inflammatory cytokines (TNF-α and IL-6) in endotoxin-activated macrophages in a good dose-dependent manner.

Example 4

The Effect of KS23 on Angiogenesis of Chicken Embryo Allantoic Membrane

1. Materials and methods:

1.1 Materials: Whatman filter paper was purchased from Sigma, USA.

1.2 Model making and intervention test: Divide chicken breeding eggs 1-2 days after birth into 3 groups randomly, followed by control group, 10μg KS23 intervention group, and 50μg KS23 intervention group, with 9-15 eggs in each group. Wash the surface of the eggs with tap water, soak in 0.2% Xinjieer solution for 5-10 minutes, with the blunt end facing up, and cultivate them in an incubator with a temperature of 37 degrees and a humidity of 60%-70%, turning over at least twice a day , with 24h as a day, hatched for 5 days. Under sterile conditions, use tweezers to open a small hole of about 1 cm ² -2 cm ² at its blunt end (air cell end), uncover the eggshell membrane and the air cell in turn, and expose the allantoic membrane with blood vessels. Whatman filter paper with a diameter of 5 mm was used as the sample carrier, and each filter paper absorbed 5 μl of PBS solution containing 0 μg, 10 μg or 50 μg KS23, dried and placed in the center of the allantoic membrane. Seal the small window with plastic tape. Continue to incubate for 2 days under the same conditions as above.

1.3 Count the number of microvessels in the allantoic membrane: open the tape, observe the new microvessels on the allantoic membrane, and measure the number of microvessels (diameter not greater than 10 μm) within 5 mm around the egg filter paper of each group under a stereo microscope.

1.4 Statistical analysis: Experimental data with express. One-way ANOVA was used to compare the number of microvessels in the allantoic membrane of chicken embryos in each group. P<0.05 means the difference is statistically significant.

2. Results

Within the range of 5 mm around the filter paper sheet on the egg allantoic membrane of the breeder hens, the blood vessels of the chicken embryo allantoic membrane of the PBS control group branched from the large blood vessels step by step to form many microvessels, and the number of microvessels in the KS23 treatment group was significantly less than Normal group (Figure 7).

Example 5

The effect of KS23 on the migration of endothelial cells induced by VEGF

1. Materials and methods:

1.1 Materials: human recombinant VEGF, purchased from Sigma, USA. Human umbilical vein endothelial cells (HUVECs) were purchased from ScienCell Laboratories.

1.2 Cell migration scratch test: cells were inoculated in a six-well culture dish at 3×10 ⁵ /well, and after the cell growth area reached 90%, the cells were starved for 24 hours by changing the serum-free RPMI1640 culture medium (so that the cells were basically synchronized, During this period, it is in a non-metabolic state, and the cells are mainly in the G0-G1 phase). Make a straight scratch with a width of about 0.8 mm on the cells in the center of the well with a 200 μL Tip. The scraped cells were rinsed with serum-free medium. Add experimental reagents to PBS group, VEGF50ng/ml group, VEGF+KS231μM group, VEGF+KS2310μM group, VEGF+KS2350μM group, and place them in a 37°C incubator to continue culturing. After culturing for 0h and 24h, take photos and record them under a 10×5 times inverted microscope. Using Image-Pro Plus image software to calculate the scratch area uncovered by cells after 0h and 24h, the ratio of scratch area uncovered by cells after 24h/the scratch area uncovered by cells at 0h was used to represent the migration ability of cells.

1.3 Statistical processing: experimental data with express. One-way ANOVA was used to compare the migration of cells among the groups. P<0.05 means the difference is statistically significant.

2. Results

The cells in the VEGF-induced group migrated significantly after 24 hours, and the uncovered area of cells in the scratch area was only 21.75% of 0h, while the uncovered area of cells in the scratch area in the 50μM small peptide intervention group was 52.75% of 0h, which significantly inhibited VEGF-induced endothelial Migration of cells (P<0.01, Figure 8).

Example 6

Preparation of eye drops

Using conventional techniques, mix the following components to prepare 1% ophthalmic eye drops, the formulation of which is as follows:

3 volunteers with moderate acute uveitis tried it for a week, 4 times a day (or once every 2 hours), 2 drops/eye each time.

Among them, the classification criteria for acute uveitis are as follows:

① Mild: ciliary hyperemia, KP+~++, anterior chamber inflammatory cells 0~++, anterior chamber flare 0~++. ② Moderate: ciliary congestion, KP++～+++, anterior chamber inflammatory cells++～+++, anterior chamber flare++～+++. ③Severe: mixed congestion, KP+++～++++, anterior chamber inflammatory cells +++～++++, anterior chamber flare +++～++++, anterior chamber fibrinous exudation, hypopyon .

The efficacy judgment criteria are as follows:

Visual acuity, ocular subjective symptoms, anterior chamber inflammatory cells, and aqueous humor flares were used as the main judgment indicators. The treatment status is divided into four grades: cured, markedly effective, effective and ineffective, which are scored separately.

Healed: ① Vision recovered above 1.0; ② Ocular subjective symptoms disappeared; ③ Anterior chamber inflammatory cells (-), aqueous humor flare (-).

Significant effect: ① vision improved by more than 4 lines; ② ocular subjective symptoms relieved; ③ anterior chamber inflammatory cells decreased, ++++→++/+++→+, aqueous humor flare weakened, ++++→++ /+++→+.

Effective: ① Vision improved by more than 2 lines; ② Ocular subjective symptoms reduced; ③ Anterior chamber inflammatory cells decreased, ++++→+++/+++→++, aqueous humor flare weakened, ++++→ +++/+++→++.

Ineffective: ①No improvement in vision; ②No improvement in ocular subjective symptoms; ③Anterior chamber inflammatory cells did not decrease or increase, and aqueous humor flare did not change.

Results: After one week of treatment, the visual acuity of the three patients improved by 2 lines or more, the subjective symptoms of the eyes improved, the corneal depression decreased, and the glare and cells of the anterior chamber decreased. This shows that the eye drops can effectively inhibit eye inflammation and neovascularization-related diseases.

Example 7

Preparation of Derivative Polypeptide and Test of Its Effect on Inhibiting Inflammatory Response

The following several derivative polypeptides were prepared, and according to the method shown in Example 3, the inhibitory effect of each KS23 derivative polypeptide (50 μM) on inflammatory factors TNF-α and IL-6 was determined, as shown in Table 2:

Table 2

The results showed that the treatment group (50 μM) of the above derivative polypeptide K23-1-6 had obvious inhibitory effect on TNF-α and IL-6. It can be seen that the polypeptide of the present invention and its derived polypeptides have a good inhibitory effect on the inflammatory response.

Example 8

Test of Derived Peptide's Effect on Inhibiting Angiogenesis

The method in Example 5 was used to test the inhibitory effect of the above derivative polypeptide on neovascularization.

The results are shown in Table 3:

table 3

All documents mentioned in this application are incorporated by reference in this application as if each were individually incorporated by reference. In addition, it should be understood that after reading the above teaching content of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims (10)

1. A polypeptide represented by the following formula I, or a pharmaceutically acceptable salt thereof [Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-[Xaa9]-[Xaa10]-[Xaa11]-[Xaa12 ]-[Xaa13]-[Xaa14]-[Xaa15]-[Xaa16]-[Xaa17]-[Xaa18]-[Xaa19]-[Xaa20]-[Xaa21]-[Xaa22]-[Xaa23]-[Xaa24]( I) In the formula, Xaa0 is none, or 1-3 amino acids constitute a peptide; Xaa1 is an amino acid selected from the group consisting of Lys, Arg, Gln, or Asn; Xaa2 is an amino acid selected from the group consisting of Asp, or Glu; Xaa3 is an amino acid selected from the group consisting of Lys, Arg, Gln, or Asn; Xaa4 is an amino acid selected from the group consisting of Ala, Val, Leu, or Ile; Xaa5 is an amino acid selected from the group consisting of Met, Leu, Phe, or Ile; Xaa6 is an amino acid selected from the group consisting of Leu, Ile, Val, Met, Ala, or Phe; Xaa7 is an amino acid selected from the group consisting of Phe, Leu, Val, Ile, Ala, or Tyr; Xaa8 is an amino acid selected from the group consisting of Thr, or Ser; Xaa9 is an amino acid selected from the group consisting of Tyr, Trp, Phe, Thr, or Ser; Xaa10 is an amino acid selected from the group consisting of Asp, or Glu; Xaa11 is an amino acid selected from the group consisting of Gln, or Asn; Xaal2 is an amino acid selected from the group consisting of Tyr, Trp, Phe, Thr, or Ser; Xaa13 is an amino acid selected from the group consisting of Gln, or Asn; Xaa14 is an amino acid selected from the group consisting of Glu, or Asp; Xaa15 is an amino acid selected from the group consisting of Asn, Gln, His, Lys, or Arg; Xaal6 is an amino acid selected from the group consisting of Asn, Gln, His, Lys, or Arg; Xaa17 is an amino acid selected from the group consisting of Val, Ile, Leu, Met, Phe, or Ala; Xaa18 is an amino acid selected from the group consisting of Asp, or Glu; Xaa19 is an amino acid selected from the group consisting of Gln, or Asn; Xaa20 is an amino acid selected from the group consisting of Ala, Val, or Leu, Ile; Xaa21 is an amino acid selected from the group consisting of Ser, or Thr; Xaa22 is an amino acid selected from the group consisting of Gly, Pro, or Ala; Xaa23 is an amino acid selected from the group consisting of Ser, or Thr; Xaa24 is none, or 1-3 amino acids constitute a peptide; And the length of the polypeptide is 23-29 amino acids. 2. The polypeptide according to claim 1, wherein Xaa0 is a peptide segment of 1-3 amino acids. 3. The polypeptide according to claim 1, wherein Xaa24 is a peptide segment of 1-3 amino acids. 4. The polypeptide of claim 1, wherein the polypeptide is selected from the group consisting of: (a) have the polypeptide of aminoacid sequence shown in SEQ ID NO:2; (b) A polypeptide derived from (a) formed by substituting, deleting or adding 1-6 amino acid residues to the amino acid sequence shown in SEQ ID NO: 2, and having the function of inhibiting inflammatory response and angiogenesis. 5. An isolated nucleic acid molecule encoding the polypeptide of claim 1. 6. A pharmaceutical composition, characterized in that it contains: (a) the polypeptide of claim 1 or a pharmaceutically acceptable salt thereof; and (b) A pharmaceutically acceptable carrier or excipient. 7. The pharmaceutical composition according to claim 6, wherein the dosage form of the composition is injection, eye drops, ophthalmic gel or ophthalmic ointment. 8. The use of the polypeptide or pharmaceutically acceptable salt according to claim 1, characterized in that it is used for the preparation of medicines, the medicines are used to inhibit inflammation and angiogenesis, and/or the medicines are used to prevent and Treatment of (a) inflammation-related diseases; (b) neovascularization-related diseases. 9. The use according to claim 8, wherein the inflammation-related diseases are selected from the group consisting of ocular inflammatory diseases, pancreatitis, inflammatory bowel disease, lung inflammation, contact dermatitis, Rheumatoid arthritis, ankylosing spondylitis; The angiogenesis-related diseases are selected from the group consisting of neovascular eye disease, tumor, ischemic heart disease, non-inflammatory cardiomyopathy, coronary arteriosclerosis, arteriosclerosis obliterans, arterial embolism, arterial thrombosis, Berger's disease, chronic Inflammation, inflammatory bowel disease, ulcers, rheumatoid arthritis, scleroderma, psoriasis, infertility, and sarcoidosis. 10. The use according to claim 8, wherein the drug prevents or treats diseases associated with inflammation and neovascularization selected from the group consisting of ocular corneal infection, uveitis, glaucoma associated with inflammation , Neovascular glaucoma, diabetic retinopathy, retinopathy of prematurity, periretinal phlebitis, age-related macular degeneration, inflammatory bowel disease, contact dermatitis, rheumatoid arthritis, ankylosing spondylitis.