CN103992377A - Novel small peptides inhibiting new vessels and application - Google Patents
Novel small peptides inhibiting new vessels and application Download PDFInfo
- Publication number
- CN103992377A CN103992377A CN201310052864.3A CN201310052864A CN103992377A CN 103992377 A CN103992377 A CN 103992377A CN 201310052864 A CN201310052864 A CN 201310052864A CN 103992377 A CN103992377 A CN 103992377A
- Authority
- CN
- China
- Prior art keywords
- polypeptide
- amino acid
- lower group
- ser
- group
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Abstract
The invention relates to novel small peptides inhibiting new vessels and application. The invention also relates to a preparation method of the polypeptide, application and pharmaceutical composition containing the polypeptide. The polypeptide possesses a plurality of advantages, such as small molecular weight, capability of permeating various ocular tissue barriers, good water solubility, capability of possessing a relatively high concentration in neutral tear, aqueous humor and vitreous humor, and the like.
Description
Technical field
The present invention relates to biomedicine field, particularly, relate to the little peptide of the inhibition new vessel that a class is new, described little peptide is the polypeptide that comes from people Neuropilin-1.The invention still further relates to method for making and the application of described polypeptide and contain the pharmaceutical composition of described polypeptide.
Background technology
The formation of new vessel is an extremely complicated process, and it comprises: the expansion of existing blood vessel, the increase of vascular permeability, blood vessel be the activationa and proliferation, migration of degraded, the endotheliocyte of matrix and the formation of new capillary vessel sample tube chamber around.
At eye, approximately 2/3 blinding disease is all relevant with pathologic neovascularization, for example: the cornea rebirth blood vessel that Herpetic Stromal Keratitis causes, choroidal neovascularization in age-related macular degeneration, and retinal neovascularization in diabetic retinopathy or retinopathy of prematurity etc.At present clinically, for conventional laser photocoagulation, photodynamic therapy (the Photodynamic therapy of using of eye pathologic neovascularization, PDT) and through pupil thermotherapy (Thermal transpupillary therapy, TTT) etc. treat.But these treatment meanss not only easily damage local organization, its late result is very not satisfactory yet.Therefore, people constantly attempt the more effective method of exploitation treatment eye pathologic neovascularization in recent years.
In the time of the effective angiogenesis inhibitors of exploitation, should fully take into account the singularity of ophthalmic remedy.
The first, there is multiple anatomical and functional barrier in eye.Whole body administration is usually due to blood aqueous barrier and blood-retina barrier and cannot reach in ocular tissue part enough drug levels; Topical, as intravitreal, the macromole that is greater than 76.5kDa is difficult in theory penetrate retina and acts on retina and choroidal neovascularization.For the administration of eye table, medicine must successively penetrate lipophilic corneal epithelial cell and closely connect and hydrophilic corneal stroma, therefore only possess suitable fat-soluble, lower molecular weight or can with eye table organization in the medicine of transporter (as: amino acid transport body, oligopeptides transporter etc.) combination could arrive anterior chamber and play a role.
The second, the degree that medicine dissolves in hydrophilic tear, aqueous humor, vitreous humor and its validity are proportionate.
The 3rd, based on above-mentioned major cause, the bioavailability of ophthalmic remedy is very low; Make it to improve, can strengthen the concentration of administration.Be used for the treatment of tumor neovasculature compound toxic side effect comparatively obvious, whole body and part all cannot high dosage administrations.In addition, the exogenous protein that molecular weight is larger is also responsive foreign matter source, can cause immunologic injury to part tissue of eye (as: uveal tract).
The 4th, although had a series of comparatively safe endogenous angiogenesis inhibitors successively to be confirmed at present, as angiostatin (angiostatin), it is made up of plasminogen Kringle structural domain 1-4 (plasminogen Kringle1-4), can obviously suppress the growth of blood vessel dependent tumors, but because its molecular weight is large and space conformation is complicated, therefore exist in preparation process, recombinant expressed purifying process is loaded down with trivial details and the residual grade of intracellular toxin is not enough.Just because of the restriction of above-mentioned all conditions, the medicine that is used for the treatment of at present ocular angiogenesis is very limited, such as recombinant anti human VEGF monoclonal antibody bevacizumab (Avastin), recombinant anti human VEGF monoclonal antibody fragment ranibizumab (Lucentis) etc., but their prices are high, and need repeatedly through vitreous space administration, even can cause blood vessel embolism equivalent risk.
As can be seen here, searching has the micromolecular inhibitor of special biologic activity and biocompatibility, see through various ocular tissues barrier through the route of administration without wound or Wicresoft, improve the local bioavailability of eye, reduce dosage, reduce the side effect of local and whole body, the clinical prevention tool of neovascular eye diseases is of great significance.Therefore, this area is in the urgent need to developing a kind of small molecules neovascularization inhibitor of the effective and safe that is suitable for eyeball tissue.
Summary of the invention
The object of this invention is to provide a class be suitable for eyeball tissue effective and safe can angiogenesis inhibiting micromolecule polypeptide with and fragment, analogue and derivative.
Another object of the present invention is to provide method for making and the application containing described polypeptide.
In a first aspect of the present invention, the polypeptide that provides a kind of following formula I to represent, or its pharmacy acceptable salt are provided in a first aspect of the present invention
[Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-[Xaa9]-[Xaa10]?(I)
In formula,
Xaa0 is nothing, or 1～2 Amino acid profile peptide section;
Xaa1 is selected from the amino acid of lower group: Cys; Or Ser;
Xaa2 is selected from the amino acid of lower group: Ser; Or Thr;
Xaa3 is selected from the amino acid of lower group: Gln; Asn;
Xaa4 is selected from the amino acid of lower group: Tyr; Trp; Phe; Thr; Or Ser;
Xaa5 is selected from the amino acid of lower group: Ser; Or Thr;
Xaa6 is selected from the amino acid of lower group: Thr; Or Ser;
Xaa7 is selected from the amino acid of lower group: Asn; Gln; His; Lys; Or Arg;
Xaa8 is selected from the amino acid of lower group: Trp; Tyr; Or Phe;
Xaa9 is selected from the amino acid of lower group: Cys; Or Ser;
Xaa10 is nothing, or 1～2 Amino acid profile peptide section;
And described polypeptide has the activity of angiogenesis inhibiting, and the length of described polypeptide is 9-13 amino acid.
More preferably, in described polypeptide:
Xaa0 is nothing;
Xaa1 is selected from the amino acid of lower group: Cys; Or Ser;
Xaa2 is selected from the amino acid of lower group: Ser; Or Thr;
Xaa3 is selected from the amino acid of lower group: Gln; Or Asn;
Xaa4 is selected from the amino acid of lower group: Tyr; Or Phe;
Xaa5 is selected from the amino acid of lower group: Ser; Or Thr;
Xaa6 is selected from the amino acid of lower group: Thr; Or Ser;
Xaa7 is selected from the amino acid of lower group: Asn; Or Gln;
Xaa8 is selected from the amino acid of lower group: Trp; Or Tyr;
Xaa9 is selected from the amino acid of lower group: Cys; Or Ser;
Xaa10 is nothing;
In another preference, the length of described polypeptide is 9 amino acid.
In another preference, the length of described polypeptide is 8 amino acid.
In another preference, described polypeptide is selected from lower group:
(a) there is the polypeptide of aminoacid sequence shown in SEQ IDNO:2;
(b) by (preferably 1-2 of 1-3 of the process of aminoacid sequence shown in SEQ ID NO:2, more preferably 1) replacement, disappearance or the interpolation of amino-acid residue form, and have angiogenesis inhibiting function by (a) derivative polypeptide.
In another preference, described derivative polypeptide retained >=70% SEQ ID NO:2 shown in the angiogenesis inhibiting activity of polypeptide.
In another preference, homogeny >=80% of described derivative polypeptide and SEQ ID NO:2, preferably >=90%; More preferably >=95%.
The present invention also provides has dimer angiogenesis inhibiting function, formula I compound and polymer form.
In a second aspect of the present invention, a kind of nucleic acid molecule of separation is provided, its code book is invented above-mentioned polypeptide.
In a third aspect of the present invention, a kind of pharmaceutical composition is provided, it contains:
(a) above-mentioned polypeptide or its pharmacy acceptable salt of the present invention; With
(b) pharmaceutically acceptable carrier or vehicle.
In another preference, the formulation of described composition be collyrium, injection (as near the eyes and intraocular injection), gel for eye use or spongaion.
In another preference, described composition is slow release formulation.
In a fourth aspect of the present invention, the purposes of a kind of polypeptide of the present invention or pharmacy acceptable salt is provided, they are used to prepare the medicine of angiogenesis inhibiting or control and relevant diseases of angiogenesis.
In another preference, group under being selected from described and relevant diseases of angiogenesis: neovascular eye diseases, tumour, ischemic heart disease, non-inflammation myocardosis, coronary sclerosis, atherosclerosis obliterans, arterial thrombosis, arterial thrombus, Berger's disease, chronic inflammatory diseases, inflammatory bowel, ulcer, rheumatic arthritis, scleroderma, psoriatic, infertility or sarcoma shape disease etc.
In another preference, described neovascular eye diseases comprises and involves choroid, retina, cornea or iris, comprises senile macular degeneration SMD, proliferative diabetic retinopathy, retinal vessel barrier disease, retinopathy of prematurity, corneal infection, neovascular glaucoma etc.
In a fifth aspect of the present invention, a kind of method that suppresses Mammals blood vessel new life is provided, comprise step: the object to needs is used polypeptide of the present invention or its pharmacy acceptable salt.
In another preference, described to as if people.
In another preference, described angiogenesis is the angiogenesis relevant to neovascular eye diseases.
In should be understood that within the scope of the present invention, above-mentioned each technical characterictic of the present invention and can combining mutually between specifically described each technical characterictic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tire out and state no longer one by one at this.
Brief description of the drawings
Following accompanying drawing is used for illustrating specific embodiment of the invention scheme, limits and be not used in the scope of the invention being defined by claims.
Fig. 1 has shown the impact of little peptide ZY7 on human umbilical vein endothelial cell HUVECs propagation, and little peptide ZY7 has the effect of remarkable inhibition of endothelial cell proliferation.With respect to VEGF group, the little peptide ZY7 of VEGF+ group (1 μ M～100 μ M) has the effect of remarkable inhibition HUVECs propagation, * P<0.05, and * * P<0.01, difference has statistical significance.
Fig. 2 shows the impact that little peptide ZY7 forms human umbilical vein endothelial cell HUVECs tube chamber, and visible little peptide ZY7 has the effect that remarkable inhibition endotheliocyte tube chamber forms.
Fig. 2 a-2c shows the restraining effect that little peptide ZY7 forms HUVECs tube chamber.
Fig. 2 a is VEGF group; Fig. 2 b is VEGF+ZY7 (100 μ M) group; Fig. 2 c is with respect to VEGF group, and the little peptide ZY7 of VEGF+ group (1 μ M～100 μ M) has the effect that remarkable inhibition HUVECs tube chamber forms, * P<0.05, and * * P<0.01, difference has statistical significance.
Fig. 3 shows the impact of little peptide ZY7 on new vessel on chick chorioallantoic membrane: little peptide ZY7 has the effect of remarkable inhibition new vessel.
Fig. 3 a-3c shows 3-5 level Microvessel Count within the scope of filter paper week 2.5mm.
Fig. 3 a is PBS group; Fig. 3 b is ZY7 (10 μ l/ sheet) group; Fig. 3 c is ZY7 (50 μ l/ sheet) group; Fig. 3 d is with respect to PBS group, and the little peptide ZY7 group of each concentration all obviously suppresses chick chorioallantoic membrane new vessel number, and restraining effect is concentration dependent, * P<0.05, and * * P<0.01, difference has statistical significance.
Fig. 4 shows the impact of little peptide ZY7 on Mouse Retina new vessel: little peptide ZY7 has the effect of remarkable inhibition Mouse Retina new vessel.
Fig. 4 a is PBS group; Fig. 4 b is ZY7 (l) group of 2 μ g/ μ; Fig. 4 c is with respect to hyperoxia+PBS group, (1 μ g/ μ l～2 μ g/ μ l) obviously suppresses Mouse Retina new vessel number to hyperoxia+little peptide ZY7 group, and restraining effect is concentration dependent, * P<0.05, * P<0.01, difference has statistical significance.
Embodiment
The inventor is through extensive and deep research, prepared first and had angiogenesis inhibiting function, and molecular weight is less than the micromolecule polypeptide of 3kD.Particularly, the method of inventor's applying biological information science, based on the analysis such as homology analysis and biological characteristics, several candidate sequences are designed, adopt solid phase method to be synthesized, separation and purification obtains highly purified little peptide ZY7, and use HPLC and MS to identify it, again through chick chorioallantoic membrane vascular pattern, oxygen inducing mouse induced retinal neovascularization models in mice, cell proliferation of human umbilical vein model and the Human umbilical vein endothelial cells tube chamber model discrimination of VEGF induction, obtain a class novel, there is the micromolecule polypeptide of prevention and treatment relevant diseases of angiogenesis.
The molecular weight of little peptide of the present invention is little, can see through various ocular tissues barrier; Good water solubility can keep higher concentration in neutral tear, aqueous humor and vitreous humor; Safe, little to biological tissue's toxic side effect; Eye local application bioavailability is high, can reduce dosage, thereby reduce systemic side effects.Complete on this basis the present invention.
People Neuropilin-1
Neuropilin is a kind of transmembrane glycoprotein of people's reported first such as nineteen ninety-five Satoda.According to the alternative splicing of neuropilin gene, can form two isomer: Neuropilin-1 and Neuropilin-2, there is 44% homology between the two.The same with other Neuropilin family member high conservative structures, Neuropilin-1 is transmembrane protein, its born of the same parents have 3 different structural domains outward, are called a1/a2, FV/FV III (b1/b2) and MAM (c), and its cross-film district and endochylema inner compartment are included into d structural domain.Neuropilin-1 gene wide expression in tissue, for example: neural system, endotheliocyte, some tumour cell, the heart, lung, placenta etc.In new vessel generative process, VEGF-165, PlGF-2, VEGF-B, VEGF-E can be combined with Neuropilin-1, activate the signal transduction pathway in downstream, bring into play important biological effect.
Active polypeptide
In the present invention, term " polypeptide of the present invention ", " ZY7 polypeptide ", " the little peptide of ZY7 ", " small peptide ZY7 " or " peptide ZY7 " are used interchangeably, all refer to have albumen or the polypeptide of the peptide ZY7 aminoacid sequence (CSQYSTNWC, as shown in SEQ ID NO:1) of neovascularization inhibiting activity.In addition, described term also comprises having variant form angiogenesis inhibiting function, SEQ IDNO:2 sequence.These variant forms comprise (but being not limited to): 1-2 (being more preferably 1) amino acid whose disappearance, insertion and/or replacement, and at C-terminal and/or N-terminal interpolation or disappearance one or several (being generally in 2, is preferably 1) amino acid.For example, in the art, while replacement with the close or similar amino acid of performance, conventionally can not change the function of protein.Again such as, add or one of disappearance or several amino acid also can not change the structure and function of protein conventionally at C-terminal and/or N-terminal.In addition, described term also comprises monomer and polymer form polypeptide of the present invention.This term also comprises linear and nonlinear polypeptide (as cyclic peptide).A kind of typical polypeptide is C-terminal and/or an amino acid of N-terminal disappearance, forms 8 amino acid whose polypeptide.
The present invention also comprises active fragments, derivative and the analogue of ZY7 polypeptide.As used herein, term " fragment ", " derivative " and " analogue " refer to and substantially keep angiogenesis inhibiting function or active polypeptide.Polypeptide fragment of the present invention, derivative or analogue can be that (i) has one or more conservative or substituted polypeptide of non-conservation amino-acid residue (preferably conservative amino acid residue), or (ii) in one or more amino-acid residues, there is the polypeptide of substituted radical, or (iii) ZY7 polypeptide and another compound (such as extending the compound of polypeptide transformation period, for example polyoxyethylene glycol) merge the polypeptide that forms, or (iv) additional aminoacid sequence be blended in this peptide sequence and the polypeptide that forms (with leader sequence, the sequence label such as secretion sequence or 6His merges and the then albumen of formation).According to instruction herein, these fragments, derivative and analogue belong to the known scope of those skilled in the art.
The preferred reactive derivative of one class refers to, compared with the aminoacid sequence with formula I, have 3 at the most, and preferably at the most 1, more preferably 1 amino acid is replaced by the similar or close amino acid of character and forms polypeptide at the most.These conservative property variation polypeptide preferably carry out amino acid substitution according to table 1 and produce.
Table 1
| Initial residue | Representational replacement | Preferred replacement |
| Ala(A) | Val;Leu;Il?e | Val |
| Arg(R) | Lys;Gln;Asn | Lys |
| Asn(N) | Gln;His;Lys;Arg | Gln |
| Asp(D) | Glu | Glu |
[0080]?
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro;Ala | Ala |
| His(H) | Asn;Gln;Lys;Arg | Arg |
| Ile(I) | Leu;Val;Met;Ala;Phe | Leu |
| Leu(L) | Ile;Val;Met;Ala;Phe | Ile |
| Lys(K) | Arg;Gln;Asn | Arg |
| Met(M) | Leu;Phe;Ile | Leu |
| Phe(F) | Leu;Val;Ile;Ala;Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr;Phe | Tyr |
| Tyr(Y) | Trp;Phe;Thr;Ser | Phe |
| Val(V) | Ile;Leu;Met;Phe;Ala | Leu |
Invention also provides the analogue of ZY7 polypeptide.The difference of these analogues and natural ZY7 polypeptide can be the difference on aminoacid sequence, can be also the difference not affecting on the modified forms of sequence, or have both at the same time.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(as D-amino acid), and has the analogue of non-natural amino acid (as β, gamma-amino acid) that exist or synthetic.Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide exemplifying.
(conventionally the not changing primary structure) form of modification comprises: in body or the chemically derived form of external polypeptide as acetylize or carboxylated.Modify and also comprise glycosylation, as those carry out polypeptide glycosylation modified and that produce in procedure of processing in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (as mammiferous glycosylase or deglycosylating enzyme) and completes by polypeptide is exposed to.Modified forms also comprises the have phosphorylated amino acid residue sequence of (as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its anti-proteolysis performance or optimized solubility property by modifying.
Polypeptide of the present invention can also with by pharmaceutically or the acceptable acid of physiology or the derivative salt form of alkali use.These salt include, but is not limited to the salt forming with following acid: spirit of salt, Hydrogen bromide, sulfuric acid, citric acid, tartrate, phosphoric acid, lactic acid, pyruvic acid, acetic acid, succsinic acid, oxalic acid, fumaric acid, toxilic acid, oxaloacetic acid, methylsulfonic acid, ethyl sulfonic acid, Phenylsulfonic acid or isethionic acid.Other salt comprise: the salt forming with basic metal or alkaline-earth metal (as sodium, potassium, calcium or magnesium), and with the form of " prodrug " of ester, carbamate or other routines.
Encoding sequence
The invention still further relates to the polynucleotide of coding ZY7 polypeptide.A kind of preferred encoding sequence is (SEQ IDNO:1, encoding sequence: TGCTCCCAGTATAGCACCAACTGGTGC), the small peptide ZY7 shown in its coding SEQ ID NO:2.
Polynucleotide of the present invention can be DNA form or rna form.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in SEQ ID NO:1 or the varient of degeneracy.As used herein, taking SEQ ID NO:1 as example, " varient of degeneracy " refers to that coding has the polypeptide of SEQ ID NO:2 sequence in the present invention, but with SEQ ID NO:1 in the differentiated nucleotide sequence of corresponding encoded region sequence.
ZY7 Nucleotide full length sequence of the present invention or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic conventionally.At present, can be completely obtain the DNA sequence dna of code book invention polypeptide (or its fragment, or derivatives thereof) by chemosynthesis.Then this DNA sequence dna can be introduced in various existing DNA moleculars as known in the art (or as carrier) and cell.
The present invention also relates to the carrier that comprises polynucleotide of the present invention, and the host cell producing through genetically engineered with carrier of the present invention or ZY polypeptid coding sequence.
On the other hand, the present invention also comprises that ZY7 polypeptide is had to specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.
Preparation method
Polypeptide of the present invention can be recombinant polypeptide or synthetic polypeptide.Polypeptide of the present invention can be chemosynthesis, or restructuring.Correspondingly, polypeptide of the present invention can be used ordinary method synthetic, also can produce with recombination method.
A kind of preferred method is to use liquid phase synthetic technology or solid phase synthesis technique, as Boc solid phase method, Fmoc solid phase method or two kinds of methods are combined use.Solid phase synthesis can obtain sample fast, can select suitable resin carrier and synthesis system according to the sequence signature of object peptide.For example, in Fmoc system, preferred solid phase carrier is as being connected with the Wang resin of C terminal amino acid in peptide, and Wang resin structure is polystyrene, and arm between amino acid is 4-alkoxyl group benzylalcohol; By 25% hexahydropyridine/dimethyl formamide room temperature treatment 20 minutes, to remove Fmoc blocking group, and hold one by one and extend to N end by C according to given aminoacid sequence.After having synthesized, with synthetic proinsulin related peptides being cut down and remove protecting group from resin containing the trifluoroacetic acid of 4% p-methyl phenol, can cross after filtering resin ether sedimentation and separate and obtain thick peptide.By after the solution freeze-drying of products therefrom, purify required peptide by gel-filtration and reverse phase HPLC method.In the time using Boc system to carry out solid phase synthesis, preferred resin is the PAM resin that is connected with C terminal amino acid in peptide, and PAM resin structure is polystyrene, and arm between amino acid is 4-methylol phenylacetamide; In Boc synthesis system, going in the circulation of protection, neutralization, coupling, remove blocking group Boc with TFA/ methylene dichloride (DCM) and also use diisopropylethylamine (DIEA/ methylene dichloride neutralization.After peptide chain condensation completes, with the hydrogen fluoride (HF) containing p-cresol (5-10%), at 0 DEG C, process 1 hour, peptide chain is cut from resin, remove blocking group simultaneously.With 50-80% acetic acid (containing a small amount of mercaptoethanol) extracting peptide, after solution freeze-drying, further use molecular sieve SephadexG10 or Tsk-40f separation and purification, and then obtain required peptide through high-pressure liquid phase purifying.Can use various coupling agents known in chemistry of peptides field and the each amino-acid residue of coupling method coupling, for example can use dicyclohexylcarbodiimide (DCC), hydroxyl benzotriazole (HOBt) or 1,1,3,3-, tetra-urea phosphofluoric acid esters (HBTU) carry out direct coupling.For the synthetic small peptide obtaining, its purity and structure can be confirmed with RP-HPLC and mass spectroscopy.
In a preference, polypeptide ZY7 of the present invention, by its sequence, adopts the method preparation of solid phase synthesis, and row high-efficient liquid phase chromatogram purification, obtains high purity object peptide freeze-dried powder ,-20 DEG C of storages.
Another kind method is to produce polypeptide of the present invention with recombinant technology.By conventional recombinant DNA technology, can utilize polynucleotide of the present invention to can be used to the ZY7 polypeptide of expression or Restruction.In general there are following steps:
(1). with the polynucleotide (or varient) of coding of the present invention ZY7 polypeptide, or with the recombinant expression vector conversion that contains these polynucleotide or the suitable host cell of transduceing;
(2). the host cell of cultivating in suitable substratum;
(3). separation, protein purification from substratum or cell.
Extracellular can be expressed or be secreted into recombinant polypeptide in cell or on cytolemma.If needed, can utilize its physics, the separating by various separation methods with other characteristic and the albumen of purification of Recombinant of chemistry.These methods are well-known to those skilled in the art.The example of these methods includes, but are not limited to: conventional renaturation processing, with the combination of protein precipitant processing (salt analysis method), centrifugal, the broken bacterium of infiltration, super processing, ultracentrifugation, sieve chromatography (gel-filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography (LC) technology and these methods.
Because polypeptide of the present invention is shorter, therefore can consider multiple polypeptide to be cascaded, the expression product of recombinant expressed rear acquisition polymer form, then forms required little peptide by the enzyme method such as cut.
Relevant diseases of angiogenesis
In the present invention, relevant diseases of angiogenesis is not particularly limited, and comprises the various disease relevant to angiogenesis as known in the art.Representational, relevant to angiogenesis disease example comprises (but being not limited to): neovascular eye diseases, tumour, ischemic heart disease, non-inflammation myocardosis, coronary sclerosis, atherosclerosis obliterans, arterial thrombosis, arterial thrombus, Berger's disease, chronic inflammatory diseases, inflammatory bowel, ulcer, rheumatic arthritis, scleroderma, psoriatic, infertility or sarcoma shape disease etc.
Preferably, described neovascular eye diseases comprises (but being not limited to): involve choroid, retina, cornea or iris, comprise senile macular degeneration SMD, proliferative diabetic retinopathy, retinal vessel barrier disease, retinopathy of prematurity, corneal infection, neovascular glaucoma etc.
Pharmaceutical composition and application process
On the other hand, the present invention also provides a kind of pharmaceutical composition, the polypeptide of the present invention that it contains (a) safe and effective amount or its pharmacy acceptable salt; And (b) pharmaceutically acceptable carrier or vehicle.The quantity of polypeptide of the present invention is generally 10 microgram-100 milligram/agent, is preferably 100-1000 microgram/agent.
For the purposes of the present invention, effective dosage is for giving individual approximately 0.01 mg/kg to 50 mg/kg, the preferably polypeptide of the present invention of 0.05 mg/kg to 10 mg/kg body weight.In addition, polypeptide of the present invention can be alone, also can use (as being formulated in same pharmaceutical composition) together with other treatment agent.
Pharmaceutical composition also can contain pharmaceutically acceptable carrier.Term " pharmaceutically acceptable carrier " refers to be used for the treatment of the carrier of agent administration.This term refers to some medicament carriers like this: they itself are not induced and produce accepting the harmful antibody of individuality of said composition, and after administration, there is no undue toxicity.These carriers are well known to those of ordinary skill in the art.In Remington's Pharmaceutical Sciences (Mack Pub.Co., N.J.1991), can find discussing fully about pharmaceutically acceptable vehicle.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol, adjuvant and combination thereof.
In therapeutic composition Chinese materia medica, acceptable carrier can contain liquid, as water, salt solution, glycerine and ethanol.In addition, in these carriers, also may there is complementary material, as wetting agent or emulsifying agent, pH buffer substance etc.
Conventionally, therapeutic composition can be made to injectable agent, for example liquor or suspension; Also can be made into before injection, be applicable to allocating in solution or suspension, the solid form of liquid vehicle.
Once be made into composition of the present invention, it can be carried out to administration by conventional route, comprising (but being not limited to): eye table, near the eyes, intraocular, intramuscular, intravenously, subcutaneous, intracutaneous or topical.Wait that the object that prevents or treat can be animal; Especially people.
In the time that pharmaceutical composition of the present invention is used to actual therapeutic, can adopt according to service condition the pharmaceutical composition of various different dosage forms.What preferably, can exemplify has collyrium, injection, gel for eye use and a spongaion.
These pharmaceutical compositions can be prepared by mixing, dilute or dissolving according to conventional methods, and add once in a while suitable medicated premix, as vehicle, disintegrating agent, tackiness agent, lubricant, thinner, buffer reagent, isotonic agent (isotonicities), sanitas, wetting agent, emulsifying agent, dispersion agent, stablizer and solubility promoter, and this process for preparation can be undertaken by usual way according to formulation.
For example, the preparation of collyrium can be carried out like this: small peptide ZY7 or its pharmacy acceptable salt are dissolved in sterilized water (being dissolved with tensio-active agent in sterilized water) together with base substance, regulate osmotic pressure and potential of hydrogen to physiological status, and can at random add suitable medicated premix as sanitas, stablizer, buffer reagent, isotonic agent, antioxidant and tackifier, then make it dissolve completely.
Pharmaceutical composition of the present invention can also sustained release formulation administration.For example, small peptide ZY7 or its salt can be impregnated in the pill or micro-capsule taking release polymer as carrier, then this pill or micro-capsule are passed through to Operation tissue to be treated.In addition, small peptide ZY7 or its salt also can be applied by inserting the ophthalmic lens that scribble in advance medicine.As the example of release polymer, what can exemplify has vinyl-vinyl acetate copolymer, poly-hydroxyl-metacrylate (polyhydrometaacrylate), polyacrylamide, polyvinylpyrrolidone, methylcellulose gum, lactic acid polymer, a lactic acid-ethanol copolymer etc., and what preferably can exemplify is that biodegradable polymkeric substance is as lactic acid polymer and lactic acid-ethanol copolymer.
In the time that pharmaceutical composition of the present invention is used to actual therapeutic, as the small peptide ZY7 of activeconstituents or the dosage of its pharmacy acceptable salt, can be according to each patient's to be treated body weight, age, sex, symptom degree and reasonably determined.For example, in the time of Local eye drop, its concentration is about 0.1-10wt% conventionally, preferably 1-5wt%, and every day can 2-6 administration, and each 1-2 drips.
Industrial applicability
Contain peptide of the present invention or its pharmaceutically-acceptable salts pharmaceutical composition as activeconstituents, have significant inhibition active to angiogenesis.Confirm through animal experiment, polypeptide of the present invention not only can suppress the angiogenesis of chick chorioallantoic membrane and the Mouse Retina new vessel of oxygen induction, and can suppress propagation and the tube chamber formation of human umbilical vein endothelial cell.
Major advantage of the present invention comprises:
(a) molecular weight of polypeptide ZY7 of the present invention is little, can see through ocular tissue's barrier;
(b) good water solubility can keep higher concentration in neutral tear, aqueous humor and vitreous humor;
(c) safe, little to biological tissue's toxic side effect; And eye local application bioavailability is high, can reduce dosage, thereby reduce systemic side effects;
(d) can be by the method preparation of solid phase synthesis, purity is high, and output is large, and cost is low;
(e) good stability of polypeptide of the present invention.
Therefore polypeptide of the present invention is expected to be developed to medicine, is used for the treatment of neovascular eye diseases and relevant neovascular diseases, as tumor neogenetic blood vessels etc.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment are only not used in and limit the scope of the invention for the present invention is described.The experimental technique of unreceipted actual conditions in the following example, conventionally according to normal condition as people such as Sambrook, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Preparation example
Synthesizing of little peptide ZY7 and derivative polypeptide
Adopt commercially available SYMPHONY type 12 passage Peptide synthesizers (Protein Technologies company of the U.S.), press the operational manual of synthesizer, adopt Fmoc solid phase method, the respectively ZY7 polypeptide of composition sequence as shown in SEQ ID NO:2, and derivative polypeptide ZY7-1 to ZY7-6 as shown in SEQ ID NO.:3-6.
After having synthesized, cut polypeptide (cutting liquid (10/g): TFA (J.T.Baker) 94.5%, water 2.5%, EDT (ALDRICH) 2.5%, TIS (ALDRICH) 1% from resin; Clipping time: 120min).Nitrogen for lysate (Shanghai is than Europe gas industry company) is dried up as far as possible, wash six times with ether (a chemical reagent company limited is tried in Shanghai), then normal temperature volatilizes.
By HPLC (SHIMADZU high performance liquid chromatograph model: preparative, analysis mode, software: Class-VP.Sevial System, manufacturer: SHIMADZU) purified polypeptide, by thick peptide with pure water or add a small amount of acetonitrile (Fisher) and dissolve, according to the following condition little peptide ZY7 of purifying and derivative polypeptide thereof respectively.
Pump A:0.1% trifluoroacetic acid+ultrapure water
Pump B:0.1% trifluoroacetic acid+acetonitrile
Flow velocity: 1.0ml/min
Detect volume: 30ul
Wavelength: 220nm
Test column: Column:Venusi MRC-ODS C18 post (30x250mm)
Testing process is in table 2.
Table 2
Finally, by the solution freeze-drying after purifying, obtain little peptide ZY7 and the derivative polypeptide ZY7-1 to ZY7-6 of high purity (>95%).
The little peptide ZY7 of finished product taking a morsel, carries out the molecular weight identification of Purity and the ESI-MS of HPLC analysis.
Result shows, the purity of the little peptide ZY7 of Purity is greater than 99%, and little peptide ZY7 has 9 amino acid, and molecular weight is 1KD, conforms to predictor.
By the little peptide of white powder, pack, be placed in-20 DEG C long-term and preserve.
Embodiment 1
The impact of little peptide ZY7 on human umbilical vein endothelial cell proliferation activity
Use MTS method, concrete grammar is as follows:
Primary human umbilical vein endothelial cell HUVECs (purchased from ScienCell company) is inoculated in 96 orifice plates, and inoculum density is 2 × 10
4/ ml; After cell attachment, add ECM37 DEG C of serum-free culture agent to cultivate 24 hours; In each hole, add respectively afterwards serum-free culture agent ECM as negative control, VEGF (100ng/ml) (purchased from Sigma company) as the little peptide ZY7 of positive control, VEGF (100ng/ hole)+different concns as treatment group; Continue to cultivate after 24 hours, in each hole, add the MTS solution (purchased from Promega company) of 20 μ l; Hatch after 4 hours for 37 DEG C, utilize microplate reader (Bio-Rad company) to measure the absorbancy in the each hole of 490nm, judge the proliferation activity of cell according to OD490, finally use SPSS11.0.1 to carry out statistical study.
The results are shown in Figure 1, visible little peptide ZY7 has the effect of obvious inhibition human umbilical vein endothelial cell HUVECs propagation, and be concentration dependent, with respect to VEGF group, the little peptide ZY7 of VEGF+ group (1 μ M～100 μ M) has the effect of obvious inhibition HUVECs propagation, * P<0.05, * * P<0.01, difference has statistical significance.
Embodiment 2
Little peptide ZY7 forms active impact to human umbilical vein endothelial cell tube chamber
Use Matrigel matrigel method, concrete grammar is as follows:
In 96 orifice plates, add Matrigel matrigel (purchased from BD company) 50 μ l/ holes, hatch 30 minutes for 37 DEG C.After it forms solid state, primary human umbilical vein endothelial cell HUVECs is inoculated in to matrigel surface, inoculum density is 8 × 10
6/ ml; And in each hole, add respectively serum-free culture agent ECM as negative control, VEGF (100ng/ml) (purchased from Sigma company) as the little peptide ZY7 of positive control, VEGF (100ng/ml)+different concns as treatment group, 37 DEG C are continued to cultivate.In process latter 6 hours under 200 times of mirrors to orifice plate in cell get at random 3 visuals field and take pictures, and utilize software I mage-Pro Plus Program5.1 (Media Cybernetics, Inc.) calculate the wherein summation of the tube chamber maximum diameter of formation, finally use SPSS11.0.1 to carry out statistical study.
The results are shown in Figure 2, little peptide ZY7 had obvious inhibition human umbilical vein endothelial cell HUVECs tube chamber to form effect in 6 hours, and be concentration dependent.Fig. 2 a-2c shows the restraining effect that little peptide ZY7 forms HUVECs tube chamber.Fig. 2 a is VEGF group; Fig. 2 b is VEGF+ZY7 (100 μ M) group; Fig. 2 c is with respect to VEGF group, and the little peptide ZY7 of VEGF+ group (1 μ M～100 μ M) has the effect that obvious inhibition HUVECs tube chamber forms, * P<0.05, and * * P<0.01, difference has statistical significance.
Embodiment 3
The mensuration of the anti-chick chorioallantoic membrane new vessel of little peptide ZY7 effect
Use chick embryo allantois membrane modle, concrete grammar is as follows:
Hatch 5 days (24 hours meters one day) by packing climatic chamber (T=37 DEG C, humidity H=60-70%) after the kind egg sterilization of raw latter 1-2 days into, each egg-turning of morning and evening every day once; To contain afterwards cortisone acetate (5 μ g/ μ l, 5 μ l/ sheets) filter paper (Whatman quantitative filter papers, Sigma, ashless, Grade42, Cat No1442-042,42.5mm Φ × 100circles) drip respectively PBS (5 μ l/ sheet) or lower concentration (2 μ g/ μ l), high density (10 μ g/ μ little peptide ZY7 (5 μ l/ sheet) l), filter paper is air-dry to be placed between kind of egg chorioallantoic membrane great vessels and sealing kind of an egg; Continue that kind of an egg is placed in to climatic chamber (temperature T=37 DEG C, humidity H=60-70%) and hatch 2 days (24 hours meters one day), not egg-turning; Expose afterwards chick chorioallantoic membrane completely, take pictures (scope is filter paper week 5mm) and to 3-5 level Microvessel Count (scope is filter paper week 2.5mm), use SPSS11.0.1 to carry out statistical study.
The results are shown in Figure 3, compare as seen PBS group, little peptide ZY7 obviously suppresses the effect of chick chorioallantoic membrane new vessel at lower concentration (10 μ g/ sheet) and high density (50 μ g/ sheet) Shi Junyou.Fig. 3 a-3c has shown 3-5 level Microvessel Count within the scope of filter paper week 2.5mm.Fig. 3 a is PBS group; Fig. 3 b is ZY7 (10 μ g/ sheet) group; Fig. 3 c is ZY7 (50 μ g/ sheet) group; Fig. 3 d is with respect to PBS group, and the little peptide ZY7 group of each concentration all obviously suppresses chick chorioallantoic membrane new vessel number, and restraining effect is concentration dependent, * P<0.05, and * * P<0.01, difference has statistical significance.
Embodiment 4
The mensuration of the anti-Mouse Retina pathologic neovascularization of little peptide ZY7 effect
Use hypoxia inducible Mouse Retina pathology model, concrete grammar is as follows:
The birth C57BL/6 of latter 7 days is placed in to oxygen concn together with the female mouse of lactation to be simultaneously about 75% ± 2% environment and to raise.After 5 days, take out mouse, and in take out after the same day and within the 3rd day, in mouse vitreum, inject respectively 0.5 μ l lower concentration (0.5 μ g/ μ l), middle concentration (1 μ g/ μ l), high density (2 μ g/ μ little peptide ZY7 and control sample PBS l), postoperative by mouse be placed in normal air continue raise to set up hypoxia inducible Mouse Retina pathology model, after 5 days, take out eyeball of mouse, be fixed in 4% paraformaldehyde, after paraffin embedding, cut into slices, and it is carried out to HE dyeing.Under 200 times of light microscopics, the endotheliocyte core of retinal neovascularization is counted, and used SPSS11.0.1 to carry out statistical study.
The results are shown in Figure 4, little peptide ZY7 middle concentration (1 μ g/ μ l) and high density (2 μ g/ μ l) Shi Junyou obviously suppress the effect of Mouse Retina pathologic neovascularization, * P<0.05, * * P<0.01, has statistical significance.
Embodiment 5
The active testing of derivative polypeptide
Press the method shown in embodiment 3, measure the anti-chick chorioallantoic membrane new vessel effect of the derivative polypeptide of each ZY7.Result is as shown in table 3:
Table 3
| Sample | Sequence | SEQ?ID?NO.: | Microvessel Count |
| Derivative polypeptide 1 (ZY7-1) | CSQY GTNWC | 3 | 47 |
| Derivative polypeptide 2 (ZY7-2) | CSQYS NSWC | 4 | 44 |
| Derivative polypeptide 3 (ZY7-3) | SSQY GTNWC | 5 | 49 |
| Derivative polypeptide 4 (ZY7-4) | CSQYSTN YC | 6 | 45 |
| Derivative polypeptide 5 (ZY7-5) | ASCSQYSTNWC SA | 7 | 47 |
| Derivative polypeptide 6 (ZY7-6) | CSQYSTNW | 8 | 52 |
| Contrast (PBS) | ? | ? | 66 |
Result shows, compared with control group, derivative polypeptide 1-6 has the effect of remarkable inhibition chick chorioallantoic membrane new vessel at lower concentration (10 μ g/ sheet).
Embodiment 6
The preparation of collyrium
Utilize routine techniques, mix following component, make 1% collyrium, its formula is as follows:
Try out one week every day 3 times, each 1 droplet/through 5 volunteers.Result shows that this collyrium can suppress the angiogenesis of eye.
All documents of mentioning in the present invention are all quoted as a reference in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. the polypeptide that following formula I represents, or its pharmacy acceptable salt
[Xaa0]-[Xaa1]-[Xaa2]-[Xaa3]-[Xaa4]-[Xaa5]-[Xaa6]-[Xaa7]-[Xaa8]-[Xaa9]-[Xaa10](I)
In formula,
Xaa0 is nothing, or 1～2 Amino acid profile peptide section;
Xaa1 is selected from the amino acid of lower group: Cys; Or Ser;
Xaa2 is selected from the amino acid of lower group: Ser; Or Thr;
Xaa3 is selected from the amino acid of lower group: Gln; Asn;
Xaa4 is selected from the amino acid of lower group: Tyr; Trp; Phe; Thr; Or Ser;
Xaa5 is selected from the amino acid of lower group: Ser; Or Thr;
Xaa6 is selected from the amino acid of lower group: Thr; Or Ser;
Xaa7 is selected from the amino acid of lower group: Asn; Gln; His; Lys; Or Arg;
Xaa8 is selected from the amino acid of lower group: Trp; Tyr; Or Phe;
Xaa9 is selected from the amino acid of lower group: Cys; Or Ser;
Xaa10 is nothing, or 1～2 Amino acid profile peptide section;
And described polypeptide has the activity of angiogenesis inhibiting, and the length of described polypeptide is 9-13 amino acid.
2. polypeptide as claimed in claim 1, is characterized in that, Xaa0 is 1～2 amino acid whose peptide section.
3. polypeptide as claimed in claim 1, is characterized in that, Xaa10 is 1～2 amino acid whose peptide section.
4. polypeptide as claimed in claim 1, is characterized in that, described polypeptide is selected from lower group:
(a) there is the polypeptide of aminoacid sequence shown in SEQ ID NO:2;
(b) aminoacid sequence shown in SEQ ID NO:2 is formed through replacement, disappearance or the interpolation of 1-3 amino-acid residue, and have angiogenesis inhibiting function by (a) derivative polypeptide.
5. a nucleic acid molecule for separation, is characterized in that, its polypeptide claimed in claim 1 of encoding.
6. a pharmaceutical composition, is characterized in that, it contains:
(a) polypeptide or its pharmacy acceptable salt described in claim 1; With
(b) pharmaceutically acceptable carrier or vehicle.
7. pharmaceutical composition as claimed in claim 6, is characterized in that, the formulation of described composition is injection, collyrium, gel for eye use or spongaion.
8. the purposes of polypeptide as claimed in claim 1 or pharmacy acceptable salt, is characterized in that, for the preparation of the medicine of angiogenesis inhibiting or control and relevant diseases of angiogenesis.
9. purposes as claimed in claim 8, it is characterized in that group under being selected from described and relevant diseases of angiogenesis: neovascular eye diseases, tumour, ischemic heart disease, non-inflammation myocardosis, coronary sclerosis, atherosclerosis obliterans, arterial thrombosis, arterial thrombus, Berger's disease, chronic inflammatory diseases, inflammatory bowel, ulcer, rheumatic arthritis, scleroderma, psoriatic, infertility and sarcoma shape disease.
10. a method that suppresses Mammals blood vessel new life, is characterized in that, comprises step: use polypeptide of the present invention or its pharmacy acceptable salt to the object of needs.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310052864.3A CN103992377B (en) | 2013-02-18 | 2013-02-18 | Small peptides inhibiting new vessels and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310052864.3A CN103992377B (en) | 2013-02-18 | 2013-02-18 | Small peptides inhibiting new vessels and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103992377A true CN103992377A (en) | 2014-08-20 |
| CN103992377B CN103992377B (en) | 2017-05-17 |
Family
ID=51306741
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310052864.3A Expired - Fee Related CN103992377B (en) | 2013-02-18 | 2013-02-18 | Small peptides inhibiting new vessels and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103992377B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101434648A (en) * | 2008-09-28 | 2009-05-20 | 华东师范大学 | Peptide for inhibiting angiogenesis, and use thereof in angiogenesis medicament preparation |
| CN101597324A (en) * | 2009-03-02 | 2009-12-09 | 华东师范大学 | A kind of decapeptide inhibiting angiogenesis and application thereof |
| CN102336811A (en) * | 2010-07-26 | 2012-02-01 | 上海市第一人民医院 | Novel small peptide capable of inhibiting new vessels and application thereof |
| US8318163B2 (en) * | 2007-05-17 | 2012-11-27 | Genentech, Inc. | Anti-pan neuropilin antibody and binding fragments thereof |
-
2013
- 2013-02-18 CN CN201310052864.3A patent/CN103992377B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8318163B2 (en) * | 2007-05-17 | 2012-11-27 | Genentech, Inc. | Anti-pan neuropilin antibody and binding fragments thereof |
| CN101434648A (en) * | 2008-09-28 | 2009-05-20 | 华东师范大学 | Peptide for inhibiting angiogenesis, and use thereof in angiogenesis medicament preparation |
| CN101597324A (en) * | 2009-03-02 | 2009-12-09 | 华东师范大学 | A kind of decapeptide inhibiting angiogenesis and application thereof |
| CN102336811A (en) * | 2010-07-26 | 2012-02-01 | 上海市第一人民医院 | Novel small peptide capable of inhibiting new vessels and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103992377B (en) | 2017-05-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104341486B (en) | Novel polypeptide for inhibiting new blood vessel and application thereof | |
| CN102336811B (en) | The little peptide of the suppression new vessel that one class is new and application thereof | |
| CN105859833B (en) | Polypeptide and its application of a kind of angiogenesis inhibiting or growth | |
| CN106552260A (en) | Interleukin-13 7 generates the application in disease in modulating vascular | |
| EP2853537B1 (en) | Small molecule polypeptide for preventing and restraining inflammation and application of same | |
| CN104341489B (en) | Novel polypeptide for inhibiting new blood vessel and application thereof | |
| US10501511B2 (en) | Low molecular polypeptide for preventing and treating inflammation and use thereof | |
| CN103992376A (en) | Novel small peptides inhibiting new vessels and application | |
| CN102336812B (en) | A kind of polypeptide with inhibiting angiogenesis activity | |
| CN103087153B (en) | New neovessel inhibition small peptides and applications thereof | |
| CN101503458B (en) | Small molecule polypeptide for preventing and treating angiogenesis and use thereof | |
| WO2016115732A1 (en) | Polypeptide for inhibiting angiogenesis or growth and application thereof | |
| CN103992377A (en) | Novel small peptides inhibiting new vessels and application | |
| CN104004057B (en) | The little peptide of one class suppression new vessels and application thereof | |
| CN102311485B (en) | Polypeptide with neovascularization suppression effect and application thereof | |
| CN103897034A (en) | Micro-molecule polypeptide for preventing and/or curing inflammatory reaction and application thereof | |
| CN106220714A (en) | A kind of suppress the polypeptide of new vessels, the medicine containing this polypeptide and application thereof | |
| CN104861058B (en) | A new class of polypeptide with neuroprotective function | |
| CN101942012A (en) | Polypeptide for preventing and treating angiogenesis and application thereof | |
| CN105017406A (en) | Novel polypeptide with nerve protection function | |
| US8933031B2 (en) | Polypeptide inhibiting angiogenesis and application thereof | |
| CN104004066A (en) | Micromolecular polypeptide for preventing or inhibiting inflammatory response and angiogenesis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170517 Termination date: 20190218 |