CN103966188A - Recombinant glucanase capable of being expressed and secreted in animal cell as well as recombination method and application of recombinant glucanase - Google Patents
Recombinant glucanase capable of being expressed and secreted in animal cell as well as recombination method and application of recombinant glucanase Download PDFInfo
- Publication number
- CN103966188A CN103966188A CN201410161721.0A CN201410161721A CN103966188A CN 103966188 A CN103966188 A CN 103966188A CN 201410161721 A CN201410161721 A CN 201410161721A CN 103966188 A CN103966188 A CN 103966188A
- Authority
- CN
- China
- Prior art keywords
- seq
- gene
- glucanase
- pegx
- pbga
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/244—Endo-1,3(4)-beta-glucanase (3.2.1.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01006—Endo-1,3(4)-beta-glucanase (3.2.1.6)
Abstract
The invention discloses a recombinant glucanase capable of being expressed and secreted in an animal cell as well as a recombination method and application of recombinant glucanase. The nucleotide sequence of the recombinant glucanase capable of being expressed and secreted in an animal cell is SEQ ID No:1 or SEQ ID No:3. The recombinant glucanase is obtained through the steps as follows: a microbe source gene is subjected to codon transformation and signal peptide substitution to screen out two glucanase genes suitable for being expressed and secreted in an animal cell; the two genes to recombined and transformed to obtain two new recombinases capable of being expressed and secreted in an animal cell. According to the invention, the obtained new recombinant beta-glucanase pBgA3pEG and the new recombinant beta-glucanase pBg2ApEG can be expressed and secreted in an animal cell, have wider pH adaptability and tolerance, can be used for the development of animal feed enzymic preparations, and can be used for the transgenic animal production.
Description
Technical field
The technology of the present invention belongs to biological technical field, more specifically, the present invention relates to a kind of restructuring dextranase and recombination method and the application that can secrete at animal cell expression.
Background technology
Beta-glucan belongs to the structural non-starch polysaccharide in plant cell wall, by β-1,3 and β-1, the D type glucose polymerisation body that 4 glycosidic links are formed by connecting, molecular weight is greatly more than 6500KDa, extensively be present in higher plant cell wall, in barley, oat Formation of Endosperm Cell Walls, content is high, the about 4%-10% of beta-glucan content in barley.In wheat, rye, corn, Chinese sorghum, the medium Cereal farm crop of millet also have certain content, and beta-glucan divides by its solvability and is divided into water-soluble and water-insoluble two classes, its soluble part can form viscosity chyme in animal gastrointestinal tract, affect the endogenous digestive ferment diffusion of animal, and then affect nutrient digestion, not dissolving part is the main component of plant cell wall, the embedding of part nutritive substance wherein, hinders the digestion of digestive ferment.Beta-glucan is barley, oat wheat, rye, corn, Chinese sorghum, main anti-nutrition component in millet.
Beta-glucanase (β-glucanase) can be hydrolyzed the beta-glucan in the cereal such as barley, wheat and rye, β-1 in catalytic pyrolysis beta-glucan molecule, and 3-1,4 glycosidic links, degraded generates small molecules oligosaccharides and glucose.Much studies show that, pig, fowl wheat, adds beta-glucanase and can improve animal to crude protein in barley, energy, AA utilising efficiency, improves breeding performonce fo animals, reduces nitrogen, foul smell discharge (X.Ao, 2010a in farm animal excrement; Owusu-Asiedu et al., 2012; Willamil et al., 2012).Dextranase has become the most frequently used exogenous enzyme preparation of animal feedstuff additive, be a class efficient, have no side effect and " green " fodder additives of environment-friendly type.But these external source digestive ferment animals self can not secrete, all first to utilize microorganism fermentation to obtain corresponding enzyme all the time, add in feed artificial, adding additive in feed to affected by the factors such as feed granulating, expanded, storage, and need constantly to add, effect is undesirable, and cost is high.
At present, large quantities of beta-glucanases (β-glucanase) gene is on various bacteriums, fungi is successfully cloned out, as Alicyclobacillus sp.A4CelA4 gene (Bai et al., 2010), Paecilomyces sp.FLH30 source PsBg16A (Hua et al., 2011) gene, (Hua et al., 2011), Bisporasp.MEY-1Bg17 gene (Luo et al., 2010), B.licheniformis EGW039eg1314 gene (Teng et al., 2006) etc.After these gene clones, produce enzyme through intestinal bacteria or yeast fermentation, narrower according to the most enzyme gene optimal pHs of report, in different pH damping fluids, only there is a peak, be difficult to adapt to animal gastrointestinal tract pH1.0～7.0 and continue the acid or alkali environment changing, only can be in stomach or enteron aisle performance hydrolytic action in animal gastrointestinal tract, action time is short, its acid and alkali-resistance, resistance to stomach en-, trypsinase ability is uneven, and its optimum temperature substantial deviation animal normal body temperature, is distributed in 40-70 DEG C more.Feed granulating temperature majority requires 80-95 DEG C, in its practical application, enzyme temperature capacity is had relatively high expectations, and is subject to many factors, be difficult to select desirable enzyme for the production of.
Therefore, be necessary beta-glucanase to improve, to adapting to animal gastrointestinal tract environment.
Summary of the invention
Based on this, in order to overcome the defect of above-mentioned prior art, the invention provides a kind of can be in the restructuring dextranase of zooblast secreting, expressing and recombination method and application.
In order to realize foregoing invention object, the present invention has taked following technical scheme:
Can be at a restructuring dextranase for zooblast secreting, expressing, the nucleotides sequence of described restructuring dextranase is classified SEQ ID No:1 or SEQ ID No:3 as; The aminoacid sequence of described restructuring dextranase is SEQ ID No:2 or SEQ ID No:4.
The present invention also provides the recombination method of above-mentioned restructuring dextranase, comprises the following steps:
(1) the mature peptide district codon of microbe-derived glucanase gene Bg17A and eg1314 is optimized, artificial removal's gene Bg17A and eg1314 self signal peptide sequence, Bg17A and eg1314 gene mature peptide N end that pig parotid gland protein signal peptide sequence shown in SEQ ID No:5 is added to after codon optimized carry out genetic modification, and improved gene is respectively: the pEGX shown in the pBgA shown in SEQ ID No:6 and SEQ ID No:7;
(2), by improved gene 5, ' end and 3 ' end add respectively after EcoRI and XhoI restriction site, be cloned in pUC57 plasmid, recycling EcoRI and XhoI restriction endonuclease respectively enzyme are cut, obtain the internally-cut enzyme segment that contains modifying gene, be cloned in mammalian cell expression vector pCDNA3.1 (+) plasmid, obtained respectively carrier pCDNA-pBgA and pCD-pEGX;
(3), remove pEGX gene N end PSP signal peptide sequence, whole subcipher with pBgA gene C end, the rigidity peptide A3 that is SEQ ID No:10 by sequence number connects, pEGX gene is connected to pBgA gene C end, and add flag-tag label at pEGX gene C end, the beta-glucanase pBgA3pEG that obtains recombinating, its nucleotides sequence is classified SEQ ID No:1 as, and aminoacid sequence is SEQ ID No:2;
(4), the restructuring dextranase pBgA3pEG of step (3) acquisition is cloned in pCDNA3.1 (+) carrier to acquisition pCD-pBgA3pEG; Taking pCD-pBgA3pEG as template, SEQ ID No:11 and SEQ ID No:12 are that primer increases for the first time and obtains pBgA-2A; Then taking the carrier pCD-pEGX in step (2) as template, SEQ ID No:13 and SEQ ID No:14 are that primer increases for the second time and obtains 2A-pEGX;
(5), using SEQ ID No:11 and SEQ ID No:14 as primer, the pBgA-2A obtaining taking step (4) and 2A-pEGX are as template, carry out the amplification of gene overlap extension PCR, obtain restructuring beta-glucanase pBg2ApEG, its nucleotides sequence is classified SEQ ID No:3 as, and aminoacid sequence is SEQ ID No:4.
In some embodiment, described in step (4) and (5), pcr amplification condition is therein: 98 DEG C of 10s; 60 DEG C of 5s; 72 DEG C of 10～20S; 35 circulations; 72 DEG C of 2min.
The present invention also provides above-mentioned can prepare the application in bioreactor or transgenic animal at the restructuring dextranase of zooblast secreting, expressing.
The present invention utilizes gene recombination technology, the mature peptide district of 4 glucanase genes of microbial source is carried out to codon modify, again signal peptide is replaced with to pig parotid secretion signal peptide, screen 2 the artificial glucanase gene pBgA and the pEGX that are adapted at animal cell expression secretion; According to the narrow defect of monomeric enzyme self pH sphere of action, utilize gene overlap elongation technology, the fusion but two enzymes of action pH scope complementation are recombinated by two different sourcess, obtain two brand-new restructuring beta-glucanase pBgA3pEG and pBg2ApEG that can secrete at animal cell expression, these two enzymes have wider pH scope, cover the whole digestive tube (stomach of animal, small intestine, large intestine), at animal stomach, small intestine, the whole enteron aisle such as large intestine can play a role, and remains higher activity.
Compared with prior art, the present invention has following beneficial effect:
1, the present invention obtains two brand-new restructuring beta-glucanase pBgA3pEG and pBg2ApEG can secrete at animal cell expression, there is wider pH adaptability and tolerance, not only can, for the exploitation of animal-feed zymin, can produce for transgenic animal simultaneously.
2, the present invention obtains two artificial reconstructed beta glucan enzyme gene pBgA and pEGX, have dextranase activity, and can secrete at mammalian cell expression, in can producing for transgenic animal.
Brief description of the drawings
Fig. 1 is vector construction schematic diagram in the embodiment of the present invention 1, and wherein, CMV is CMV promotor, and PSP is pig parotid gland protein signal;
Fig. 2 is that pCel, ppsBg16A, pBgA and the pEGX enzyme in the embodiment of the present invention 1, optimized through password are at the enzyme activity detection of expression figure of PK15 cell, wherein, transfection pCDNA3.1 empty carrier is as contrast, and 3 biology of Data Source repeat, data representation enzyme mean value ± standard error alive;
Fig. 3 is the structure schematic diagram of dextranase pBgA3pEG and pBg2ApEG of recombinating in the embodiment of the present invention 1;
Fig. 4 is that in the embodiment of the present invention 1, the enzyme of pBg-2A, 2A-pEGX and restructuring dextranase pBg2ApEG is cut qualification collection of illustrative plates;
Fig. 5 is dextranase pBgA3pEG and the pBg2ApEG detection of expression figure at PK15 cell that recombinates in the embodiment of the present invention 1;
Fig. 6 is in the embodiment of the present invention 2, recombinate dextranase pBgA3pEG and the stability test result figure of pBg2ApEG to pH; Wherein Fig. 6 A is that in different pH damping fluids, two recombinases are lived relatively with the relative enzyme of monomeric enzyme with B; Fig. 6 C is that two kinds of recombinases are lived relatively with the relative enzyme of two kinds of monomeric enzymes;
Fig. 7 is the enzyme activity comparison of dextranase pBgA3pEG and pBg2ApEG of recombinating in the embodiment of the present invention 3.
Embodiment
Describe the present invention in detail below in conjunction with the drawings and specific embodiments.
If no special instructions, the reagent using in following examples all derives from commercially available, and working method is existing routine operation method.
Embodiment 1 can be at the recombination method of the restructuring dextranase of animal cell expression secretion
Comprise the following steps:
1. candidate gene screening
According to bibliographical information, the present invention is from the glucanase gene of 4 kinds of bacteriums of NCBI screening and originated from fungus, obtain respectively CelA4 gene (the Bai et al. that derives from Alicyclobacillus sp.A4, 2010), PsBg16A gene (the Hua et al. in Paecilomyces sp.FLH30 source, 2011), Bg17 gene (the Luo et al. in Bisporasp.MEY-1 source, 2010), eg1314 gene (the Teng et al. in B.licheniformis EGW039 source, 2006) complete sequence, these genes have higher activity in bacterium and fungi.
2, candidate gene Optimizing Reconstruction
Utilize the online software of Signal P3.0 (
http:// www.cbs.dtu.dk/services/SignalP/), predict respectively mature peptide district and the signal peptide district of four genes, then according to pig codon preference, utilize Optimum Gene TM Gene Design system software to be optimized the mature peptide district codon of microbe-derived gene C elA4, PsBg16A, Bg17A and eg1314.Artificial removal's microbial source gene C elA4, PsBg16A, Bg17A and eg1314 self signal peptide sequence, by pig parotid gland protein signal peptide (PSP, 60bp, SEQ ID No:5) sequence add to password optimize after CelA4, PsBg16A, Bg17A and eg1314 gene mature peptide N end carry out genetic modification.Improved gene is named respectively pCel (SEQ ID No:8), ppsBg16A (SEQ ID No:9), pBgA (SEQ ID No:6) and pEGX (SEQ ID No:7).
3, mammalian cell expression vector is entered in the gene clone after Optimizing Reconstruction
' end and 3 ' end add respectively EcoRI and XhoI restriction site for pCel, ppsBg16A, psBgA and pEGX gene 5 that artificial reconstructed password is optimized, entrust Nanjing Genscript Biotechnology Co., Ltd. synthetic, gene completes synthetic rear clone and preserves in pUC57 business plasmid (Jin Sirui), is respectively pUC-pCel, pUC-ppsBg16A, pUC-pBgA and pUC-pEGX.
Utilize EcoRI (fermentas company) and XhoI (fermentas company) restriction endonuclease respectively enzyme cut pUC-pCel, pUc-ppsBg16A, pUC-psBgA, pUC-pEGX plasmid, obtain respectively EcoRI-ppsBg16A-xhoI, EcoRI-pCel-xhoI, EcoRI-pBgA-xhoI and EcoRI-pEGX-XhoI internally-cut enzyme segment, and be cloned in mammalian cell expression vector pCDNA3.1 (+) plasmid (Invitrogen company), obtain carrier pCD-pCel, pCD-ppsBg16A, pCDNA-pBgA and pCD-pEGX (Fig. 1).
4, screening can be at the dextranase of mammalian cell expression secretion
With liposome Lipofectamine LTX Reagent (Invitrogen company) by pCD-pCel, pCD-ppsBg16A, pCDNA-pBgA and pCD-pEGX By Transfecting Porcine kidney pK15 cell (Wen Shi research institute provides), after 72 hours, collecting cell nutrient solution, live with reference to national standard " the mensuration spectrophotometry of NYT911-2004 fodder additives activity of beta-glucanase " cellular enzymes, enzyme activity determination condition: 0.8% barley substrate, at 39.5 DEG C, water-bath 30min.Enzyme activity determination the results are shown in Figure 2, and as can be seen from Figure 2, compared with the control, activity of beta-glucanase significantly promotes for pCDNA-pBgA and pCD-pEGX.Therefore, through cell expressing checking, screening can be at pBgA (deriving from Bisporasp.MEY-1Bg17 gene) and two kinds of dextranase of pEGX (deriving from B.licheniformis EGW039eg1314 gene) of mammalian cell expression secretion.And pBgA, the working pH condition and range of pEGX gene has certain complementarity, and pBgA working pH is that 1.0～5.0, pEGX working pH is 4.0～7.5 (seeing Fig. 6).
5, the dextranase screening is recombinated
Narrow for the single dextranase working pH scope screening, acid or alkali environment is required harsh, can not adapt to the defects such as animal gastrointestinal tract pH1.0～6.5 environment completely, dextranase is recombinated, can be optimized to the pH performance of the recombinase that obtains.
The design of a, fusion beta-glucanase pBgA3pEG and synthetic
First remove pEGX gene N end PSP signal peptide sequence, whole subcipher with pBgA gene C end, by the codon optimized rigidity peptide A3 (GAAGCCGCTGCCAAGGAGGCTGCCGCTAAAGAAGCTGCTGCTAAG of pig, sequence number is SEQ ID No:10) connection, pEGX gene is connected to pBgA gene C end, and add flag-tag label at pEGX gene C end, so that zymoprotein is detected, (nucleotide sequence is SEQ ID No:1 to obtain merging beta-glucanase pBgA3pEG, aminoacid sequence is SEQ ID No:2), finally pBgA3pEG is entrusted Shanghai Jin Sirui biotech firm synthetic.Then be cloned in pCDNA3.1 (+) carrier, obtain pCD-pBgA3pEG (Fig. 3).
B, the pBg2ApEG design of restructuring beta-glucanase and structure
Taking pCD-pBgA3pEG as template, use primers F 1:A5 '-CCAGTGTGGTG
gAATTCtTGTCTT-3 ' (SEQ ID No:11, underscore is EcoR I) and primer R2:5 '-CCAGCCAATTTCAAGAGAGCATAATTAGTACACTGGTTCCATCCGCCGGATCCTGA G-3 ' (SEQ ID No:12) amplification obtain pBgA-2A (1312bp, enzyme is cut qualification and is seen Fig. 4 A), amplification system: PrimeSTAR HS (Premix) 25 μ l, Primer F1 1ul, PrimerR21ul, template 50～200ng, sterile purified water adds to 50 μ l.Then taking pCD-pEGX as template, use primers F 3:5 '-GTTGAGAGCAACCCAGGTCCCATGTTTCAGCTCTGGAAACT-3, (SEQ ID No:13) and primer R4:5 '-GGGCCCTCTAGA
cTCGAGcTCAAGT
tTATCATCATCATCCTTGTAATCCtTTTTTGTGTATCGCACCCA-3 ' (SEQ ID No:14, underscore part is Xho I and flag-tag label) increasing obtains 2A-pEGX (770bp, enzyme is cut qualification and is seen Fig. 4 A), amplification system: PrimeSTAR HS (Premix) 25 μ l, Primer F3 1ul, PrimerR4 1ul, template 50～200ng, sterile purified water adds to 50 μ l.Finally utilize primers F 1 (SEQ ID No:11) and R4 (SEQ ID No:14), taking pBgA-2A and 2A-pEGX as template, utilize gene overlap extension PCR, (nucleotide sequence is SEQ ID No:3 to obtain pBg2ApEG, aminoacid sequence is SEQ ID No:4,2073bp, enzyme is cut qualification and is seen Fig. 4 B), amplification system: PrimeSTAR HS (Premix) 25 μ l, Primer F1 1ul, PrimerR4 1ul, template 50～200ng, sterile purified water adds to 50 μ l.Finally pBg2ApEG is cloned into pCDNA3.1 (+) and produces pCD-pBg2ApEG (Fig. 3).
Above-mentioned pcr amplification condition is: 98 DEG C of 10s; 60 DEG C of 5s; 72 DEG C of 10～20S; 35 circulations; 72 DEG C of 2min.
6, the animal cell expression of recombinase checking
The recombinase protein pBgA3pEG obtaining and pBg2ApEG are detected to the cellular immunofluorescence analytical procedure of detection method reference standard, contrast control transfection PCDNA3.1 (+) empty carrier at pig kidney pK15 cell expressing.Detected result is as Fig. 5, as can be seen from Figure 5, improved recombinase protein pBgA3pEG and pBg2ApEG can high efficient expression and translations (green fluorescence part) in pig kidney pK15 cell, and it is distributed in whole tenuigenin, and control cells can't detect correlative protein expression.
The stability test of the restructuring beta-glucanase albumen that embodiment 2 embodiment 1 obtain to pH
By pCD-pBgA3pEG and pCD-pBg2ApEG By Transfecting Porcine kidney pK15 cell, after 3 days, collecting cell nutrient solution, as first enzyme liquid, is measured pBgA3pEG and pBg2ApEG 1,4 beta-glucanase activity in different pH damping fluids referring to national standard.Damping fluid is: 0.1MKCl-HCl (pH10-2.0), 0.1M Na
2hPO
4– Citrate trianion (pH2.6-7.6) and 0.1MTris-HCl (pH8.0-9.0).
PBgA3pEG and pBg2ApEG and monomeric enzyme thereof are hatched after 2 hours in different pH damping fluids, under optimal pH condition, measure its residual enzyme and live.The results are shown in Figure 6, as can be seen from Figure 6, compared with monomeric enzyme, recombinase is obviously widened (enzyme that pH1.0-7.0 can maintain more than 50% is lived) to the sphere of action of pH, and the working pH of monomeric enzyme pBgA is 1.0～5.0, and pH exceedes 5.0, its enzyme is lived and is reduced rapidly, monomeric enzyme pEGX working pH be 4.0～7.5, pH lower than 4.5, enzyme is lived and is reduced rapidly.Therefore, after restructuring, recombinase working pH covers pH1.0～pH7.0, and sphere of action is obviously widened, and in production application, recombinase of the present invention can adapt to whole gi tract pH1.5～6.5, and action time is more lasting, and the stability of pH is significantly improved.
The enzyme activity comparison of two restructuring beta-glucanase albumen that embodiment 3 embodiment 1 obtain
By pCD-pBgA3pEG and pCD-pBg2ApEG By Transfecting Porcine kidney pK15 cell, after 3 days, collecting cell nutrient solution, as first enzyme liquid, is measured pBgA3pEG and pBg2ApEG 1,4 beta-glucanase activity in different pH damping fluids referring to national standard.Damping fluid is 0.1MNa
2hPO
4– Citrate trianion (pH2.6-7.6).
PBgA3pEG and pBg2ApEG were hatched respectively after 2 hours in damping fluid, under the condition of pH4.0 and pH5.6, measure its residual enzyme and live.The results are shown in Figure 7, as can be seen from Figure 7, recombinase pBgA3pEG shows higher enzyme than pBg2ApEG and lives.
The above embodiment has only expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but can not therefore be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (5)
1. can, at a restructuring dextranase for zooblast secreting, expressing, it is characterized in that, the nucleotides sequence of described restructuring dextranase is classified SEQ ID No:1 or SEQ ID No:3 as.
2. according to claim 1 can, at the restructuring dextranase of zooblast secreting, expressing, it is characterized in that, the aminoacid sequence of described restructuring dextranase is SEQ ID No:2 or SEQ ID No:4.
3. can, at the recombination method of the restructuring dextranase of zooblast secreting, expressing, it is characterized in that described in claim 1 or 2, comprise the following steps:
(1) the mature peptide district codon of microbe-derived glucanase gene Bg17A and eg1314 is optimized, artificial removal's gene Bg17A and eg1314 self signal peptide sequence, Bg17A and eg1314 gene mature peptide N end that pig parotid gland protein signal peptide sequence shown in SEQ ID No:5 is added to after codon optimized carry out genetic modification, and improved gene is respectively: the pEGX shown in the pBgA shown in SEQ ID No:6 and SEQ ID No:7;
(2), improved gene 5 ' end and 3 ' end are added respectively after EcoRI and XhoI restriction site, be cloned in pUC57 plasmid, recycling EcoRI and XhoI restriction endonuclease respectively enzyme are cut, obtain the internally-cut enzyme segment that contains modifying gene, be cloned in mammalian cell expression vector pCDNA3.1 (+) plasmid, obtained respectively carrier pCDNA-pBgA and pCD-pEGX;
(3), remove pEGX gene N end PSP signal peptide sequence, whole subcipher with pBgA gene C end, the rigidity peptide A3 that is SEQ ID No:10 by sequence number connects, pEGX gene is connected to pBgA gene C end, and add flag-tag label at pEGX gene C end, the beta-glucanase pBgA3pEG that obtains recombinating, its nucleotides sequence is classified SEQID No:1 as, and aminoacid sequence is SEQ ID No:2;
(4), the restructuring dextranase pBgA3pEG of step (3) acquisition is cloned in pCDNA3.1 (+) carrier to acquisition pCD-pBgA3pEG; Taking pCD-pBgA3pEG as template, SEQ ID No:11 and SEQ ID No:12 are that primer increases for the first time and obtains pBgA-2A; Then taking the carrier pCD-pEGX in step (2) as template, SEQ ID No:13 and SEQ ID No:14 are that primer increases for the second time and obtains 2A-pEGX;
(5), using SEQ ID No:11 and SEQ ID No:14 as primer, the pBgA-2A obtaining taking step (4) and 2A-pEGX are as template, carry out the amplification of gene overlap extension PCR, obtain restructuring beta-glucanase pBg2ApEG, its nucleotides sequence is classified SEQ ID No:3 as, and aminoacid sequence is SEQ ID No:4.
4. according to claim 3 can, at the recombination method of the restructuring dextranase of zooblast secreting, expressing, it is characterized in that, described in step (4) and (5), pcr amplification condition is: 98 DEG C of 10s; 60 DEG C of 5s; 72 DEG C of 10～20s; 35 circulations; 72 DEG C of 2min.
5. described in claim 1 or 2, can prepare the application in bioreactor or transgenic animal at the restructuring dextranase of zooblast secreting, expressing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410161721.0A CN103966188B (en) | 2014-02-12 | 2014-04-22 | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2014100493846 | 2014-02-12 | ||
| CN201410049384 | 2014-02-12 | ||
| CN201410049384.6 | 2014-02-12 | ||
| CN201410161721.0A CN103966188B (en) | 2014-02-12 | 2014-04-22 | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103966188A true CN103966188A (en) | 2014-08-06 |
| CN103966188B CN103966188B (en) | 2016-04-20 |
Family
ID=51236195
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410161721.0A Expired - Fee Related CN103966188B (en) | 2014-02-12 | 2014-04-22 | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966188B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086068A (en) * | 2016-06-06 | 2016-11-09 | 广东温氏食品集团股份有限公司 | A kind of polycistron, the specific expressed polycistronic carrier of salivary gland and construction method thereof |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005003319A2 (en) * | 2003-07-02 | 2005-01-13 | Diversa Corporation | Glucanases, nucleic acids encoding them and methods for making and using them |
| CN101134949A (en) * | 2006-08-30 | 2008-03-05 | 中国农业科学院饲料研究所 | Beta-glucanase, encoding gene thereof, recombinant plasmid and bacterial strain and uses thereof |
| CN101838637A (en) * | 2009-12-31 | 2010-09-22 | 中国农业科学院饲料研究所 | Wide-temperature applicability acidic dextranase AGL9A, and gene and application thereof |
-
2014
- 2014-04-22 CN CN201410161721.0A patent/CN103966188B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005003319A2 (en) * | 2003-07-02 | 2005-01-13 | Diversa Corporation | Glucanases, nucleic acids encoding them and methods for making and using them |
| CN101134949A (en) * | 2006-08-30 | 2008-03-05 | 中国农业科学院饲料研究所 | Beta-glucanase, encoding gene thereof, recombinant plasmid and bacterial strain and uses thereof |
| CN101838637A (en) * | 2009-12-31 | 2010-09-22 | 中国农业科学院饲料研究所 | Wide-temperature applicability acidic dextranase AGL9A, and gene and application thereof |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086068A (en) * | 2016-06-06 | 2016-11-09 | 广东温氏食品集团股份有限公司 | A kind of polycistron, the specific expressed polycistronic carrier of salivary gland and construction method thereof |
| CN106086068B (en) * | 2016-06-06 | 2019-11-08 | 温氏食品集团股份有限公司 | A kind of polycistron, the specific expressed polycistronic carrier of salivary gland and its construction method |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103966188B (en) | 2016-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Co-fermentation using recombinant Saccharomyces cerevisiae yeast strains hyper-secreting different cellulases for the production of cellulosic bioethanol | |
| Hooker et al. | Leveraging anaerobic fungi for biotechnology | |
| Willson et al. | Production of a functional cell wall-anchored minicellulosome by recombinant Clostridium acetobutylicum ATCC 824 | |
| CN109182360B (en) | Micromolecular cellulose endonuclease gene and protein and application thereof | |
| CN105238704A (en) | Method for rapidly improving enzyme activity of Trichoderma reesei cellulase | |
| Kim et al. | Heterologous expression of family 10 xylanases from Acidothermus cellulolyticus enhances the exoproteome of Caldicellulosiruptor bescii and growth on xylan substrates | |
| CN105274011A (en) | Method for improving enzyme activity of cellulose of trichoderma reesei | |
| CN106687586A (en) | Polypeptides having xylanase activity with a high conversion rate of xylose-containing polysaccharides | |
| ES2727390T3 (en) | Expression of recombinant beta-xylosidases enzymes | |
| Wilson et al. | LacI transcriptional regulatory networks in Clostridium thermocellum DSM1313 | |
| CN103966188B (en) | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application | |
| CN106086068B (en) | A kind of polycistron, the specific expressed polycistronic carrier of salivary gland and its construction method | |
| Liu et al. | Metal-organic frameworks coupling simultaneous saccharication and fermentation for enhanced butyric acid production from rice straw under visible light by Clostridium tyrobutyricum CtΔack:: cat1 | |
| Kojima et al. | Direct ethanol production from cellulosic materials by Zymobacter palmae carrying Cellulomonas endoglucanase and Ruminococcus β-glucosidase genes | |
| CN112899294B (en) | Multifunctional enzyme gene HG27 and application thereof | |
| Jiang et al. | The draft genome sequence of thermophilic Thermoanaerobacterium thermosaccharolyticum M5 capable of directly producing butanol from hemicellulose | |
| Zou et al. | Function analysis of 5′-UTR of the cellulosomal xyl-doc cluster in Clostridium papyrosolvens | |
| Chen et al. | Bi-functional fusion enzyme EG-M-Xyn displaying endoglucanase and xylanase activities and its utility in improving lignocellulose degradation | |
| CN103525789B (en) | A kind of can the whole cell xylanase that promote rumen zymosis and preparation method thereof | |
| CN112852845A (en) | Novel multifunctional enzyme gene HG32 and application thereof | |
| CN105063078A (en) | Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element | |
| CN108865913B (en) | Method for constructing recombinant bacterium capable of efficiently secreting and expressing chondroitin sulfate hydrolase | |
| CN102994476A (en) | Saccharifying enzyme | |
| CN104726388A (en) | Pullulanase enzyme-producing strain and method for improving enzyme-producing capacity thereof | |
| CN103562216A (en) | Enhanced fermentation of cellodextrins and beta-D-glucose |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160420 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |