CN103966188B - Can in the restructuring dextranase of animal cell expression secretion and recombination method and application - Google Patents
Can in the restructuring dextranase of animal cell expression secretion and recombination method and application Download PDFInfo
- Publication number
- CN103966188B CN103966188B CN201410161721.0A CN201410161721A CN103966188B CN 103966188 B CN103966188 B CN 103966188B CN 201410161721 A CN201410161721 A CN 201410161721A CN 103966188 B CN103966188 B CN 103966188B
- Authority
- CN
- China
- Prior art keywords
- seqidno
- gene
- restructuring
- pegx
- dextranase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
- C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
- C12N9/2405—Glucanases
- C12N9/2434—Glucanases acting on beta-1,4-glucosidic bonds
- C12N9/244—Endo-1,3(4)-beta-glucanase (3.2.1.6)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01006—Endo-1,3(4)-beta-glucanase (3.2.1.6)
Abstract
The invention discloses a kind of can in the restructuring dextranase of animal cell expression secretion and recombination method and application.The nucleotides sequence of the described restructuring dextranase can secreted at animal cell expression be classified as SEQ? ID? No:1 or SEQ? ID? No:3.Described restructuring dextranase is through and carries out codon modify and signal peptide replacement to microbial source gene, screens 2 glucanase genes being adapted at animal cell expression secretion; Through transforming these two gene recombination, obtaining two can secrete new recombinase at animal cell expression.Two brand-new restructuring beta-glucanase pBgA3pEG and pBg2ApEG that the present invention obtains can secrete at animal cell expression, there is wider pH adaptability and tolerance, not only may be used for the exploitation of animal-feed zymin, may be used for transgenic animal simultaneously and produce.
Description
Technical field
The technology of the present invention belongs to biological technical field, more specifically, the present invention relates to a kind of can in the restructuring dextranase of animal cell expression secretion and recombination method and application.
Background technology
Beta-glucan belongs to the structural non-starch polysaccharide in plant cell wall, by β-1,3 and β-1, the D type glucose polimer that 4 glycosidic links are formed by connecting, molecular weight is greatly about more than 6500KDa, extensively be present in higher plant cell wall, in barley, oat Formation of Endosperm Cell Walls, content is high, and in barley, beta-glucan content is about 4%-10%.In wheat, rye, corn, Chinese sorghum, millet medium Cereal farm crop also have certain content, and beta-glucan divides and is divided into water-soluble and water-insoluble two classes by its solvability, its soluble part can form viscous chyme in animal gastrointestinal tract, affect the endogenous digestive ferment diffusion of animal, and then affect nutrient digestion, do not dissolve the main component that part is plant cell wall, the embedding of part nutritive substance wherein, hinders the digestion of digestive ferment.Beta-glucan is barley, oat wheat, rye, corn, Chinese sorghum, anti-nutrition component main in millet.
Beta-glucanase (β-glucanase) can be hydrolyzed the beta-glucan in the cereal such as barley, wheat and rye, β-1,3-1,4 glycosidic link in catalytic pyrolysis beta-glucan molecule, and degraded generates small molecules oligosaccharides and glucose.Many research displays, pig, fowl wheat, add beta-glucanase in barley and can improve animal to crude protein, energy, AA utilising efficiency, improves breeding performonce fo animals, reduces the nitrogen in farm animal excrement, foul smell discharge (X.Ao, 2010a; Owusu-Asieduetal., 2012; Willamiletal., 2012).Dextranase has become the most frequently used exogenous enzyme preparations of animal feedstuff additive, be a class efficient, have no side effect and environment-friendly type " green " fodder additives.But these external source digestive ferment animals self can not secrete, all first utilize fermentable to obtain corresponding enzyme all the time, add in feed artificial, add additive in feed to easily to affect by factors such as feed granulating, expanded, storages, and need constantly to add, effect is undesirable, and cost is high.
At present, large quantities of beta-glucanase (β-glucanase) gene is on various bacterium, fungi successful clone out, as Alicyclobacillussp.A4CelA4 gene (Baietal., 2010), Paecilomycessp.FLH30 source PsBg16A (Huaetal., 2011) gene, (Huaetal., 2011), Bisporasp.MEY-1Bg17 gene (Luoetal., 2010), B.licheniformisEGW039eg1314 gene (Tengetal., 2006) etc.After these gene clones, enzyme is produced through intestinal bacteria or yeast fermentation, narrower according to the most enzyme gene optimal pH of report, in different pH damping fluid, only there is a peak, be difficult to adapt to the acid or alkali environment that animal gastrointestinal tract pH1.0 ~ 7.0 continue change, in animal gastrointestinal tract, only can play hydrolytic action at stomach or enteron aisle, action time is short, its acid and alkali-resistance, resistance to stomach en-, trypsinase ability is uneven, and its optimum temperature substantial deviation animal normal body temperature, is distributed in 40-70 DEG C more.Feed granulating temperature majority requires 80-95 DEG C, in its practical application, requires higher to enzyme temperature capacity, by many factors, be difficult to select desirable enzyme for the production of.
Therefore, be necessary to improve beta-glucanase, to animal gastrointestinal tract environment can be adapted to.
Summary of the invention
Based on this, in order to overcome the defect of above-mentioned prior art, the invention provides a kind of can in the restructuring dextranase of zooblast secreting, expressing and recombination method thereof and application.
In order to realize foregoing invention object, this invention takes following technical scheme:
Can at a restructuring dextranase for zooblast secreting, expressing, the nucleotides sequence of described restructuring dextranase is classified as SEQIDNo:1 or SEQIDNo:3; The aminoacid sequence of described restructuring dextranase is SEQIDNo:2 or SEQIDNo:4.
Present invention also offers the recombination method of above-mentioned restructuring dextranase, comprise the following steps:
(1) the mature peptide district codon of microbe-derived glucanase gene Bg17A and eg1314 is optimized, artificial removal's gene Bg17A and eg1314 its own signal peptide sequence, pig parotid gland protein signal peptide sequence shown in SEQIDNo:5 is added to codon optimized after Bg17A and eg1314 gene mature peptide N end carry out genetic modification, improved gene is respectively: the pEGX shown in pBgA and SEQIDNo:7 shown in SEQIDNo:6;
(2), by improved gene 5, ' end and 3 ' end are respectively after interpolation EcoRI and XhoI restriction site, be cloned in pUC57 plasmid, recycling EcoRI and XhoI restriction endonuclease respectively enzyme is cut, obtain the internally-cut enzyme segment containing modifying gene, be cloned in mammalian cell expression vector pCDNA3.1 (+) plasmid, obtained carrier pCDNA-pBgA and pCD-pEGX respectively;
(3), remove pEGX gene N and hold PSP signal peptide sequence, with whole subcipher of pBgA gene C end, the rigidity peptide A3 being SEQIDNo:10 by sequence number connects, pEGX gene is connected to pBgA gene C end, and add flag-tag label at pEGX gene/C terminal, obtain restructuring beta-glucanase pBgA3pEG, its nucleotides sequence is classified as SEQIDNo:1, and aminoacid sequence is SEQIDNo:2;
(4) the restructuring dextranase pBgA3pEG, by step (3) obtained is cloned in pCDNA3.1 (+) carrier, obtains pCD-pBgA3pEG; Take pCD-pBgA3pEG as template, SEQIDNo:11 and SEQIDNo:12 be primer carry out first time amplification obtain pBgA-2A; Then with the carrier pCD-pEGX in step (2) for template, SEQIDNo:13 and SEQIDNo:14 be primer carry out second time amplification obtain 2A-pEGX;
(5), using SEQIDNo:11 and SEQIDNo:14 as primer, pBgA-2A and 2A-pEGX obtained with step (4) is for template, carry out the amplification of gene overlap extension PCR, obtain restructuring beta-glucanase pBg2ApEG, its nucleotides sequence is classified as SEQIDNo:3, and aminoacid sequence is SEQIDNo:4.
Wherein in some embodiments, described in step (4) and (5), pcr amplification condition is: 98 DEG C of 10s; 60 DEG C of 5s; 72 DEG C of 10 ~ 20S; 35 circulations; 72 DEG C of 2min.
Present invention also offers and above-mentionedly can prepare the application in bioreactor or transgenic animal at the restructuring dextranase of zooblast secreting, expressing.
The present invention utilizes gene recombination technology, the mature peptide district of 4 of microbial source glucanase genes is carried out codon modify, signal peptide is replaced with pig parotid secretion signal peptide again, screen 2 artificial glucanase gene pBgA and pEGX being adapted at animal cell expression secretion; According to the defect that monomeric enzyme self pH sphere of action is narrow, utilize gene overlap elongation technology, by two different sourcess but two enzymes of action pH scope complementation carry out restructuring merge, obtain two brand-new can at restructuring beta-glucanase pBgA3pEG and pBg2ApEG of animal cell expression secretion, these two enzymes have wider pH scope, cover the whole digestive tube (stomach of animal, small intestine, large intestine), at animal stomach, small intestine, the whole enteron aisle such as large intestine can play a role, and remains higher activity.
Compared with prior art, the present invention has following beneficial effect:
1, two brand-new restructuring beta-glucanase pBgA3pEG and pBg2ApEG that the present invention obtains can secrete at animal cell expression, there is wider pH adaptability and tolerance, not only may be used for the exploitation of animal-feed zymin, may be used for transgenic animal simultaneously and produce.
2, two artificial reconstructed beta glucan enzyme gene pBgA and pEGX of the present invention's acquisition, have dextranase activity, and can secrete at mammalian cell expression, may be used in transgenic animal production.
Accompanying drawing explanation
Fig. 1 is vector construction schematic diagram in the embodiment of the present invention 1, and wherein, CMV is CMV promoter, and PSP is pig parotid gland protein signal;
Fig. 2 is through the enzyme activity detection of expression figure of pCel, ppsBg16A, pBgA and pEGX enzyme of password optimization at PK15 cell in the embodiment of the present invention 1, wherein, transfection pCDNA3.1 empty carrier is as contrast, and Data Source 3 biology repeat, data representation enzyme mean value ± standard error alive;
Fig. 3 is the structure schematic diagram of dextranase pBgA3pEG and pBg2ApEG of recombinating in the embodiment of the present invention 1;
Fig. 4 is that the enzyme of pBg-2A, 2A-pEGX and restructuring dextranase pBg2ApEG in the embodiment of the present invention 1 cuts qualification collection of illustrative plates;
Fig. 5 is the detection of expression figure of dextranase pBgA3pEG and pBg2ApEG at PK15 cell that recombinate in the embodiment of the present invention 1;
Fig. 6 is the stability test result figure of dextranase pBgA3pEG and pBg2ApEG to pH that recombinate in the embodiment of the present invention 2; Wherein Fig. 6 A with B is that in different pH damping fluid, two recombinases compare with the relative enzyme of monomeric enzyme is alive; Fig. 6 C is that two kinds of recombinases compare with the relative enzyme of two kinds of monomeric enzymes is alive;
Fig. 7 is that recombinate in the embodiment of the present invention 3 enzyme activity of dextranase pBgA3pEG and pBg2ApEG compares.
Embodiment
The present invention is described in detail below in conjunction with the drawings and specific embodiments.
If no special instructions, the reagent used in following examples all derives from commercially available, and working method is existing conventional practices.
Embodiment 1 can at the recombination method of the restructuring dextranase of animal cell expression secretion
Comprise the following steps:
1. candidate gene screening
According to bibliographical information, the present invention screens the glucanase gene of 4 kinds of bacteriums and originated from fungus from NCBI, obtain the CelA4 gene (Baietal. deriving from Alicyclobacillussp.A4 respectively, 2010), PsBg16A gene (the Huaetal. in Paecilomycessp.FLH30 source, 2011), Bg17 gene (the Luoetal. in Bisporasp.MEY-1 source, 2010), eg1314 gene (the Tengetal. in B.licheniformisEGW039 source, 2006) complete sequence, these genes have higher activity in bacterium and fungi.
2, candidate gene Optimizing Reconstruction
Utilize the online software of SignalP3.0 (
http:// www.cbs.dtu.dk/services/SignalP/), predict mature peptide district and the signal peptide district of four genes respectively, then according to pig codon preference, the mature peptide district codon of OptimumGeneTMGeneDesignsystem software to microbe-derived gene C elA4, PsBg16A, Bg17A and eg1314 is utilized to be optimized.Artificial removal's microbial source gene C elA4, PsBg16A, Bg17A and eg1314 its own signal peptide sequence, by pig parotid gland protein signal peptide (PSP, 60bp, SEQIDNo:5) sequence add to password optimize after CelA4, PsBg16A, Bg17A and eg1314 gene mature peptide N end carries out genetic modification.Improved gene names pCel (SEQIDNo:8), ppsBg16A (SEQIDNo:9), pBgA (SEQIDNo:6) and pEGX (SEQIDNo:7) respectively.
3, mammalian cell expression vector is entered in the gene clone after Optimizing Reconstruction
' end and 3 ' end add EcoRI and XhoI restriction site to pCel, ppsBg16A, psBgA and pEGX gene 5 optimized by artificial reconstructed password respectively, entrust Nanjing Genscript Biotechnology Co., Ltd.'s synthesis, gene completes in synthesis rear clone to pUC57 business plasmid (Jin Sirui) and preserves, and is respectively pUC-pCel, pUC-ppsBg16A, pUC-pBgA and pUC-pEGX.
Utilize EcoRI (fermentas company) and XhoI (fermentas company) restriction endonuclease respectively enzyme cut pUC-pCel, pUc-ppsBg16A, pUC-psBgA, pUC-pEGX plasmid, obtain EcoRI-ppsBg16A-xhoI, EcoRI-pCel-xhoI, EcoRI-pBgA-xhoI and EcoRI-pEGX-XhoI internally-cut enzyme segment respectively, and be cloned in mammalian cell expression vector pCDNA3.1 (+) plasmid (Invitrogen company), obtain carrier pCD-pCel, pCD-ppsBg16A, pCDNA-pBgA and pCD-pEGX (Fig. 1).
4, screening can at the dextranase of mammalian cell expression secretion
With liposome LipofectamineLTXReagent (Invitrogen company) by pCD-pCel, pCD-ppsBg16A, pCDNA-pBgA and pCD-pEGX By Transfecting Porcine kidney pK15 cell (Wen Shi research institute provides), after 72 hours, collecting cell nutrient solution, live with reference to national standard " the mensuration spectrophotometry of NYT911-2004 fodder additives activity of beta-glucanase " cellular enzymes, enzyme activity determination condition: 0.8% barley substrate, at 39.5 DEG C, water-bath 30min.Enzyme activity determination the results are shown in Figure 2, and as can be seen from Figure 2, compared with the control, activity of beta-glucanase significantly promotes pCDNA-pBgA and pCD-pEGX.Therefore, through cell expressing checking, screening can at the pBgA (deriving from Bisporasp.MEY-1Bg17 gene) of mammalian cell expression secretion and pEGX (deriving from B.licheniformisEGW039eg1314 gene) two kinds of dextranase.And the working pH condition and range of pBgA, pEGX gene has certain complementarity, pBgA working pH is 1.0 ~ 5.0, pEGX working pH is 4.0 ~ 7.5 (see Fig. 6).
5, the dextranase screened is recombinated
For the single dextranase working pH narrow scope screened, require harsh to acid or alkali environment, can not adapt to the defects such as animal gastrointestinal tract pH1.0 ~ 6.5 environment completely, recombinate to dextranase, the pH performance to the recombinase obtained can be optimized.
A, the design of merging beta-glucanase pBgA3pEG and synthesis
First remove pEGX gene N and hold PSP signal peptide sequence, with whole subcipher of pBgA gene C end, by the rigidity peptide A3 (GAAGCCGCTGCCAAGGAGGCTGCCGCTAAAGAAGCTGCTGCTAAG that pig is codon optimized, sequence number is SEQIDNo:10) connection, pEGX gene is connected to pBgA gene C end, and add flag-tag label at pEGX gene/C terminal, so that detect zymoprotein, (nucleotide sequence is SEQIDNo:1 to obtain merging beta-glucanase pBgA3pEG, aminoacid sequence is SEQIDNo:2), Shanghai Jin Sirui biotech firm is finally entrusted by pBgA3pEG to synthesize.Then be cloned in pCDNA3.1 (+) carrier, obtain pCD-pBgA3pEG (Fig. 3).
B, the pBg2ApEG design of restructuring beta-glucanase and structure
Be template with pCD-pBgA3pEG, use primers F 1:A5 '-CCAGTGTGGTG
gAATTCtTGTCTT-3 ' (SEQIDNo:11, underscore is EcoR I) and primer R2:5 '-CCAGCCAATTTCAAGAGAGCATAATTAGTACACTGGTTCCATCCGCCGGATCCTGA G-3 ' (SEQIDNo:12) amplification obtain pBgA-2A (1312bp, enzyme is cut qualification and is seen Fig. 4 A), amplification system: PrimeSTARHS (Premix) 25 μ l, PrimerF11ul, PrimerR21ul, template 50 ~ 200ng, sterile purified water adds to 50 μ l.Then be template with pCD-pEGX, use primers F 3:5 '-GTTGAGAGCAACCCAGGTCCCATGTTTCAGCTCTGGAAACT-3, (SEQIDNo:13) and primer R4:5 '-GGGCCCTCTAGA
cTCGAGcTCAAGT
tTATCATCATCAT cCTTGTAATCCtTTTTTGTGTATCGCACCCA-3 ' (SEQIDNo:14, underscore part is Xho I and flag-tag label) increasing obtains 2A-pEGX (770bp, enzyme is cut qualification and is seen Fig. 4 A), amplification system: PrimeSTARHS (Premix) 25 μ l, PrimerF31ul, PrimerR41ul, template 50 ~ 200ng, sterile purified water adds to 50 μ l.Finally utilize primers F 1 (SEQIDNo:11) and R4 (SEQIDNo:14), with pBgA-2A and 2A-pEGX for template, utilize gene overlap extension PCR, (nucleotide sequence is SEQIDNo:3 to obtain pBg2ApEG, aminoacid sequence is SEQIDNo:4,2073bp, enzyme is cut qualification and is seen Fig. 4 B), amplification system: PrimeSTARHS (Premix) 25 μ l, PrimerF11ul, PrimerR41ul, template 50 ~ 200ng, sterile purified water adds to 50 μ l.Finally pBg2ApEG is cloned into pCDNA3.1 (+) and produces pCD-pBg2ApEG (Fig. 3).
Above-mentioned pcr amplification condition is: 98 DEG C of 10s; 60 DEG C of 5s; 72 DEG C of 10 ~ 20S; 35 circulations; 72 DEG C of 2min.
6, the animal cell expression checking of recombinase
Recombinase protein pBgA3pEG and pBg2ApEG obtained is detected at pig kidney pK15 cell expressing, the cellular immunofluorescence analytical procedure of detection method reference standard, contrast control transfection PCDNA3.1 (+) empty carrier.Detected result is as Fig. 5, as can be seen from Figure 5, improved recombinase protein pBgA3pEG and pBg2ApEG can high expression and translation (green fluorescence part) in pig kidney pK15 cell, and it is distributed in whole tenuigenin, and compared with control cells, can't detect correlative protein expression.
The restructuring beta-glucanase albumen that embodiment 2 embodiment 1 obtains is to the stability test of pH
By pCD-pBgA3pEG and pCD-pBg2ApEG By Transfecting Porcine kidney pK15 cell, after 3 days, collecting cell nutrient solution is as first enzyme liquid, measures pBgA3pEG and pBg2ApEG 1,4 beta-glucanase activity in different pH damping fluid see national standard.Damping fluid is: 0.1MKCl-HCl (pH10-2.0), 0.1MNa
2hPO
4– Citrate trianion (pH2.6-7.6) and 0.1MTris-HCl (pH8.0-9.0).
After pBgA3pEG and pBg2ApEG and monomeric enzyme thereof are hatched 2 hours in different pH damping fluid, under optimal pH condition, measure its residual enzyme live.The results are shown in Figure 6, as can be seen from Figure 6, compared with monomeric enzyme, the sphere of action of recombinase to pH is obviously widened (enzyme that pH1.0-7.0 can maintain more than 50% is lived), and the working pH of monomeric enzyme pBgA is 1.0 ~ 5.0, pH more than 5.0, its enzyme is lived and is reduced rapidly, monomeric enzyme pEGX working pH be 4.0 ~ 7.5, pH lower than 4.5, enzyme is lived and is reduced rapidly.Therefore, after restructuring, recombinase working pH covers pH1.0 ~ pH7.0, and sphere of action is obviously widened, and in production application, recombinase of the present invention can adapt to whole gi tract pH1.5 ~ 6.5, and action time is more lasting, and the stability of pH is significantly improved.
The enzyme activity of two restructuring beta-glucanase albumen that embodiment 3 embodiment 1 obtains compares
By pCD-pBgA3pEG and pCD-pBg2ApEG By Transfecting Porcine kidney pK15 cell, after 3 days, collecting cell nutrient solution is as first enzyme liquid, measures pBgA3pEG and pBg2ApEG 1,4 beta-glucanase activity in different pH damping fluid see national standard.Damping fluid is 0.1MNa
2hPO
4– Citrate trianion (pH2.6-7.6).
After pBgA3pEG and pBg2ApEG is hatched 2 hours respectively in damping fluid, under the condition of pH4.0 and pH5.6, measure its residual enzyme live.The results are shown in Figure 7, as can be seen from Figure 7, recombinase pBgA3pEG shows higher enzyme than pBg2ApEG and lives.
The above embodiment only have expressed several embodiment of the present invention, and it describes comparatively concrete and detailed, but therefore can not be interpreted as the restriction to the scope of the claims of the present invention.It should be pointed out that for the person of ordinary skill of the art, without departing from the inventive concept of the premise, can also make some distortion and improvement, these all belong to protection scope of the present invention.Therefore, the protection domain of patent of the present invention should be as the criterion with claims.
Claims (5)
1. at a restructuring dextranase for zooblast secreting, expressing, can it is characterized in that, the nucleotides sequence of described restructuring dextranase is classified as SEQIDNo:1 or SEQIDNo:3.
2. according to claim 1ly at the restructuring dextranase of zooblast secreting, expressing, can it is characterized in that, the aminoacid sequence of described restructuring dextranase is SEQIDNo:2 or SEQIDNo:4.
3. at the recombination method of the restructuring dextranase of zooblast secreting, expressing, can it is characterized in that, comprise the following steps described in claim 1 or 2:
(1) the mature peptide district codon of microbe-derived glucanase gene Bg17A and eg1314 is optimized, artificial removal's gene Bg17A and eg1314 its own signal peptide sequence, pig parotid gland protein signal peptide sequence shown in SEQIDNo:5 is added to codon optimized after Bg17A and eg1314 gene mature peptide N end carry out genetic modification, improved gene is respectively: the pEGX shown in pBgA and SEQIDNo:7 shown in SEQIDNo:6;
(2) after, improved gene 5 ' end and 3 ' end being added EcoRI and XhoI restriction site respectively, be cloned in pUC57 plasmid, recycling EcoRI and XhoI restriction endonuclease respectively enzyme is cut, obtain the internally-cut enzyme segment containing modifying gene, be cloned in mammalian cell expression vector pCDNA3.1 (+) plasmid, obtained carrier pCDNA-pBgA and pCD-pEGX respectively;
(3), remove pEGX gene N and hold pig parotid gland protein signal peptide sequence, with whole subcipher of pBgA gene C end, the rigidity peptide A3 being SEQIDNo:10 by sequence number connects, pEGX gene is connected to pBgA gene C end, and add flag-tag label at pEGX gene/C terminal, obtain restructuring beta-glucanase pBgA3pEG, its nucleotides sequence is classified as SEQIDNo:1, and aminoacid sequence is SEQIDNo:2;
(4) the restructuring dextranase pBgA3pEG, by step (3) obtained is cloned in pCDNA3.1 (+) carrier, obtains pCD-pBgA3pEG; Take pCD-pBgA3pEG as template, SEQIDNo:11 and SEQIDNo:12 be primer carry out first time amplification obtain pBgA-2A; Then with the carrier pCD-pEGX in step (2) for template, SEQIDNo:13 and SEQIDNo:14 be primer carry out second time amplification obtain 2A-pEGX;
(5), using SEQIDNo:11 and SEQIDNo:14 as primer, pBgA-2A and 2A-pEGX obtained with step (4) is for template, carry out the amplification of gene overlap extension PCR, obtain restructuring beta-glucanase pBg2ApEG, its nucleotides sequence is classified as SEQIDNo:3, and aminoacid sequence is SEQIDNo:4.
4. according to claim 3ly at the recombination method of the restructuring dextranase of zooblast secreting, expressing, can it is characterized in that, described in step (4) and (5), pcr amplification condition is: 98 DEG C of 10s; 60 DEG C of 5s; 72 DEG C of 10 ~ 20s; 35 circulations; 72 DEG C of 2min.
5. described in claim 1 or 2, the application in bioreactor can prepared at the restructuring dextranase of zooblast secreting, expressing.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410161721.0A CN103966188B (en) | 2014-02-12 | 2014-04-22 | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410049384 | 2014-02-12 | ||
| CN2014100493846 | 2014-02-12 | ||
| CN201410049384.6 | 2014-02-12 | ||
| CN201410161721.0A CN103966188B (en) | 2014-02-12 | 2014-04-22 | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103966188A CN103966188A (en) | 2014-08-06 |
| CN103966188B true CN103966188B (en) | 2016-04-20 |
Family
ID=51236195
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410161721.0A Expired - Fee Related CN103966188B (en) | 2014-02-12 | 2014-04-22 | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966188B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086068B (en) * | 2016-06-06 | 2019-11-08 | 温氏食品集团股份有限公司 | A kind of polycistron, the specific expressed polycistronic carrier of salivary gland and its construction method |
| WO2023225459A2 (en) | 2022-05-14 | 2023-11-23 | Novozymes A/S | Compositions and methods for preventing, treating, supressing and/or eliminating phytopathogenic infestations and infections |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005003319A2 (en) * | 2003-07-02 | 2005-01-13 | Diversa Corporation | Glucanases, nucleic acids encoding them and methods for making and using them |
| CN101134949A (en) * | 2006-08-30 | 2008-03-05 | 中国农业科学院饲料研究所 | Beta-glucanase, encoding gene thereof, recombinant plasmid and bacterial strain and uses thereof |
| CN101838637A (en) * | 2009-12-31 | 2010-09-22 | 中国农业科学院饲料研究所 | Wide-temperature applicability acidic dextranase AGL9A, and gene and application thereof |
-
2014
- 2014-04-22 CN CN201410161721.0A patent/CN103966188B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005003319A2 (en) * | 2003-07-02 | 2005-01-13 | Diversa Corporation | Glucanases, nucleic acids encoding them and methods for making and using them |
| CN101134949A (en) * | 2006-08-30 | 2008-03-05 | 中国农业科学院饲料研究所 | Beta-glucanase, encoding gene thereof, recombinant plasmid and bacterial strain and uses thereof |
| CN101838637A (en) * | 2009-12-31 | 2010-09-22 | 中国农业科学院饲料研究所 | Wide-temperature applicability acidic dextranase AGL9A, and gene and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103966188A (en) | 2014-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Co-fermentation using recombinant Saccharomyces cerevisiae yeast strains hyper-secreting different cellulases for the production of cellulosic bioethanol | |
| Hooker et al. | Leveraging anaerobic fungi for biotechnology | |
| CN103890180A (en) | Methods for producing multiple recombinant polypeptides in a filamentous fungal host cell | |
| CN102428170A (en) | Improved endoglucanases | |
| CN109182360B (en) | Micromolecular cellulose endonuclease gene and protein and application thereof | |
| CN105238704A (en) | Method for rapidly improving enzyme activity of Trichoderma reesei cellulase | |
| Kim et al. | Heterologous expression of family 10 xylanases from Acidothermus cellulolyticus enhances the exoproteome of Caldicellulosiruptor bescii and growth on xylan substrates | |
| CN109971784A (en) | Heterogenous expression endoglucanase EG II in a kind of Pichia pastoris, the construction method of EG IV, EG V | |
| CN106687586A (en) | Polypeptides having xylanase activity with a high conversion rate of xylose-containing polysaccharides | |
| ES2727390T3 (en) | Expression of recombinant beta-xylosidases enzymes | |
| CN103966188B (en) | Can in the restructuring dextranase of animal cell expression secretion and recombination method and application | |
| Wilson et al. | LacI transcriptional regulatory networks in Clostridium thermocellum DSM1313 | |
| CN106086068B (en) | A kind of polycistron, the specific expressed polycistronic carrier of salivary gland and its construction method | |
| CN112899294B (en) | Multifunctional enzyme gene HG27 and application thereof | |
| Zou et al. | Function analysis of 5′-UTR of the cellulosomal xyl-doc cluster in Clostridium papyrosolvens | |
| CN112852845A (en) | Novel multifunctional enzyme gene HG32 and application thereof | |
| CN105063078A (en) | Construction method of recombinant bacillus subtilis for integration and expression of foreign protein by virtue of Tn7 transposable element | |
| US10738291B2 (en) | Variants of exoglucanases having improved activity and uses thereof | |
| CN104334716A (en) | Bacteria with reconstructed transcriptional units and the uses thereof | |
| CN103562216A (en) | Enhanced fermentation of cellodextrins and beta-D-glucose | |
| US9765315B2 (en) | Cellulose and/or hemicelluloses degrading enzymes from Macrophomina phaseolina and uses thereof | |
| CN108841810B (en) | Multifunctional cellulase gene and application thereof | |
| RU2646136C2 (en) | Recombinant strain of mycelial fungus penicillium verruculosum (versions) and a method of producing enzyme preparation with its use (variants) | |
| Ramos et al. | Effective application of immobilized second generation industrial Saccharomyces cerevisiae strain on consolidated bioprocessing | |
| CN117264861B (en) | Bacillus subtilis for coexpression of multi-cellulase genes, construction method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160420 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |