CN103911377A - Molecular marker identification relevant to pH value character of pork and applications thereof - Google Patents

Abstract

The invention belongs to the technical field of preparation of livestock molecular markers, and particularly relates to two SNP (Single Nucleotide Polymorphism) molecular markers relevant to the pH value character of pork, and location and applications of a haplotype consisting of the two SNPs. The SNP molecular markers can be obtained through whole genome correlation analysis, and the nucleotide sequence of the SNP molecular markers are respectively shown in SEQ ID NO:1-2 and figures 2-3. The corresponding haplotype shown in a figure 4 can be obtained by utilizing the obtained SNPs through haplotype analysis. The markers and the haplotype can be used for related detection of the pH value character of pork.

Description

A kind of molecular markers for identification and the application thereof relevant to pork pH value proterties

Technical field

The invention belongs to domestic animal molecule marker preparing technical field, be specifically related to qualification and the application of the haplotype of two SNP molecule markers relevant to pork pH value proterties and this two SNP formations.

Background technology

In recent years, in pig breeding work, improve lean meat content and reduce the thickness of backfat always by breeder as main breeding objective, and obtained significant effect.But the heredity of this seed selection mode is selected finally to cause the decline of intramuscular fat content, and then causes the decline of meat quality.Along with improving constantly that human consumer requires meat, the genetic research that improves meat quality has become the study hotspot of livestock industry.

Meat Quality is a complicated character.Affect meat qualitative factor a lot, comprise heredity, nutrition, environmental health, on the hoof management, butcher technique and butcher after processing treatment.The index of evaluation meat quality quality mainly comprises: intramuscular fat content, marble grain, pH, yellowish pink, be the composition etc. of lipid acid in waterpower, drip loss, myofiber characteristic (type, diameter, Area Ratio etc.) and meat.

PH value is one of most important index of meat mensuration.PH value has directly embodied muscle acidity, very large on meat quality impact.The multiplex pH meter of meat pH value is directly measured.Body is slaughtering that the motion function of postmortem muscle is terminated and in anoxic condition, but metabolism is still continuing to consume ATP, in short period of time, phosphocreatine makes ADP become ATP by creatine kinase, in addition can regeneration ATP, at this moment the lactic acid that glycolysis-produces reduces muscle pH value, but along with decomposing the accumulation of amine and the reduction of pH value that generate, ATP make the enzymic activity of glycolysis weaken even inactivation, finally cause glycolysis-to stop, the pH value of muscle reaches steady state (Kocwin-Podsiadla, Przybylski et al.1995).

Because the mensuration of Meat Quality can only be carried out and difficulty relatively after butchering, therefore take traditional breeding method to carry out meat improvement and be subject to certain restrictions.In addition, at present on affect the research of gene of Meat Quality, and path research between these genes is not still comprehensively thoroughly, has limited equally Advances in Breeding.And molecular breeding can overcome these difficulties, provide another research approach for improving meat quality, directly analyze quantitative inheritance variation from DNA level, make individual gene even Single locus the detection of quantity affect trait is become to possibility.Therefore, adopt molecular genetics method more and more to receive publicity from improving in essence meat quality, become the important research approach of this research direction.

Although candidate gene method and QTL location in pig marker assisted selection for the discovery of pig flesh characters genetic marker, and obtained certain effect, QTL as relevant to all proterties in pig has 8421.But candidate gene method can only be retrieved and preset candidate gene, and can not identify new gene; QTL location to be limited in the general span in QTL region very large, be difficult to accomplish Fine Mapping.Nowadays, whole-genome association (Genome-wide Association Study, GWAS) has become the identification candidate gene relevant with Important Economic character or the New Policy of genome area specifically.Candidate gene method and QTL location relatively, GWAS can locate and identify new gene more accurately.It is widely used in cattle breeding, as improved milk production of cow etc.Along with the highdensity SNP of pig (Single nucleotide polymorphism, single nucleotide polymorphism) exploitation of chip, and the work of pig gene order-checking complete (Groenen, Archibald et al.), the molecular breeding that GWAS is pig has been opened up a frontier.

So far, the major gene of having confirmed as pig flesh characters has halothane, sour meat gene and PRKAG3 gene.

Halothane (Halothane gene, Hal) is a found vital signs gene that affects meat quality the earliest.It is positioned at No. 6 chromosomal Lan Niding receptor 1 gene (Ryanodinereceptor1 of pig, undergoing mutation RYR1), its allogene has caused disadvantageous effect to meat quality, cause white muscles (pale, soft and exudative, PSE meat) generation (Hradecky, Hruban et al.1980; Reik, Rempel et al.1983; Hamilton, Ellis et al.2000).Acid meat (RN) gene is positioned at karyomit(e) No. 15, and its disadvantageous sudden change RN is found at first in hampshire, makes pig Tu postmortem muscle pH value on the low side, affects meat quality.PH value, yellowish pink and the drip loss of PRKAG3 (AMP-activatedProteinKinase3) gene major effect pork.In this gene, to undergo mutation be to have caused RN effect to R200Q, makes pig butcher latter 24 hours muscle pH values and reduce, and drip loss increases (Milan, Jeon et al.2000; Lindahl, Enf? lt et al.2004; Lindahl, Enf? lt et al.2004; Zamaratskaia, Madej et al.2005).For the candidate gene of pig flesh characters, existing many cases report at present, wherein studies to such an extent that be clear that H-FABP, MC4R, IGF2, MyoG, Myostatin, ACSL, PPAR γ, AMPD1, ADD1 and CAST.

Forefathers research shows, the albumen of DNAJC3 (P58IPK) genes encoding has expression, especially high expression level (Korth, Lyons et al.1996) in pancreas and liver in the institute of people and mouse in a organized way.In beta Cell of islet, there is powerful endoplasmic reticulum to be responsible for folding, to transport and the new synthetic Regular Insulin (Harding and Ron2002) of processing.The stimulation of various destruction endoplasmic reticulum functions is called er stress, can cause the protein not folding in endoplasmic reticulum, to accumulate (Schr? der and Kaufman2005).Does is DNAJC3 the important component in negative feedback loop, can suppress eIF-2 signal α path, and weakens unfolded protein reaction (Schr? der and Kaufman2005).In mouse, after knockout dna JC3 gene, Mouse Weight reduces, though free choice feeding 10～12 months, the body fat <10% of mouse, and then reduce fat generation.The mechanism that causes body fat to reduce may be the minimizing of apoptosis and the available Regular Insulin of β cell, and then stops glucose to fatty conversion and storage (Ladiges, Knoblaugh et al.2005).Insulin resistant in the time that beta Cell of islet can not compensate suitable insulin secretion, just produces type-II diabetes.

The protein level of finding DNAJC3 in people's type-II diabetes people's pancreas raises.The generation of type-II diabetes is relevant with the damage of insulin signaling pathway.And the running balance of glucose and lipid in liver, muscle and fatty tissue in Regular Insulin control.In liver, Regular Insulin promotes the synthetic of glucose and lipid acid.In muscle and fatty tissue, Regular Insulin can stimulate the absorption (Stiles, Wang et al.2004) of glucose.In the time butchering in muscle the content of glucose and glycolysis-determined to butcher after the height (Fernandez and Tornberg1991) of pork pH value after 24 hours.

At present, the report of research pig DNA JC3 gene function is little, applicant uses the method for whole-genome association to carry out association analysis and polymorphic research to the part intron of this gene, and the Meat Quality SNP molecule marker and the haplotype thereof that find at the intron of pig DNA JC3 gene first.

Summary of the invention

The object of the invention is to overcome the defect of prior art, qualification and the application of the haplotype of two SNP molecule markers relevant to pork pH value proterties and this two SNP formations are provided.The present invention uses the method for whole-genome association to find SNP molecule marker and the haplotype relevant to pork pH value proterties, using this as the relevant SNP molecule marker of pork pH value proterties and the application of haplotype in marker assisted selection.

The present invention is achieved through the following technical solutions:

Applicant obtains a SNP molecule marker relevant to pork pH value proterties by clone, and the nucleotide sequence of this molecule marker is as follows:

AGACGTGGCTTGGACCTGGCGTTGCTCTATGTCTGTGGTGTAGACCGGTGGCTGCAGCTCCGGTTCAACCCCTGGCCTGG?GATCCTCCATAGGCTGCAGGTGCAGTCCTAAAACAAAAACACTCTTTGTTTTAATTTAACAATCCTCTAAATTAAATTTT?TGTTTGATTTT GGGTAAATCAGCTCTGTGGCTACAAAAAATAAAAGATCGTTCTAGGGCTGCCACTGACTTGAGCTTG?TTATTTTCTCTCTGTAAGTGCTCTAATGTGCTCAACAGAATCTATCCCAGTGTCCCAGCCC

The base R that above-mentioned sequence is 172 is C or T, causes polymorphism.

The present invention obtains another SNP molecule marker relevant to pork pH value proterties by clone, and the nucleotide sequence of this molecule marker is as follows:

AGAGAGGACCAGGGCCAGGAGCTGAGTCTCTACAGCCGTGGAAGGTTTGGGCTGGGAGTGTCATGACAGGTGGGCTTTGA?GGGAAACAGGTAGACATTTAGAACGTTAGATAAGGAAAGATGCCATGACTGGAGAAGGGAGAAGGAAGAATTAAGTAAGA?TGCCCA GTTTTTGGAGTGTTCAAATTGGTATGTGTTCAAGCTGTTCCCTGAGAAATTATTTAGAGGAGAAGAAAGGGT?ACAAAAAATACAGCTCTCATAAAGACTTCCTGATTCTCAGCAGTTTATTTAATAATTTCTA

Base R in 167 of above-mentioned sequence is A or G, causes polymorphism.

The molecule marker of above-mentioned preparation can be used alone or in combination the application in pork pH proterties detects.

Applicant provides a kind of preparation method of the SNP molecule marker relevant to pork pH value proterties, and it is the following step:

1) extract pig genomic dna;

2) longissimus dorsi muscle of collection pig, by the pH value of three test pig longissimus dorsi muscle meat samples of pH meter measurement, gets the mean value of three measured results as the pH value of this meat sample;

3) pig genome DNA sample is done to gene type on full genome chip;

4) adopt PLINK software to carry out whole-genome association; Therefrom choose the SNP significantly associated with the pork pH value of butchering latter 24 hours, utilization Ensembl website variant Effect Predictorinstrument, annotates this SNP; Then utilize bioinformatics method, the gene in target area is carried out to functional annotation; Whether drop on by this site of QTLdb retrieved web in the QTLs relevant with pork pH value proterties of report, further determine the SNPs being associated with pork pH value proterties; Utilize Haploview to carry out linkage disequilibrium analysis and haplotype analysis.

The present invention obtains the SNP molecule marker being particularly associated with pork pH value proterties with the part Meat Quality of pig by the method for whole-genome association (GWAS), for the molecular marker assisted selection of pig provides two new molecule markers and a haplotype.

More detailed technical scheme is referring to " embodiment ".

Brief description of the drawings

Sequence table SEQ ID NO:1 be from NCBI website download with pork quality trait related gene DNAJC3 intron I partial nucleotide sequence, obtain first molecule marker of the present invention through detecting to analyze, sequence length is 300bp, there is an allelic sudden change in the 172bp place in this sequence, sports T by C.

Sequence table SEQ ID NO:2 be from NCBI website download with pork quality trait related gene DNAJC3 intron IV partial dna sequence.Obtain second molecule marker of the present invention through detecting to analyze, sequence length is 300bp, has an allelic sudden change at the 167bp place of this sequence, sports G by A.

Fig. 1: be techniqueflow chart of the present invention.

Fig. 2: the partial sequence of the present invention clone's pig DNA JC3 gene intron I, what be wherein arranged in the 1st intron the 23633rd bit base place of No. 11 chromosomal DNA JC3 genes of pig (at the 172bp place of this clone's fragment) is that bracket is allelic mutational site.

Fig. 3: the partial sequence of the present invention clone's pig DNA JC3 gene intron IV, what be wherein arranged in the 4th intron the 8181st bit base place of No. 11 chromosomal DNA JC3 genes of pig (at the 167bp place of this clone's fragment) is that bracket is allelic mutational site.

Fig. 4: the haplotype being formed by pleomorphism site rs80855156 and rs80882127 that analysis of the present invention obtains.

Embodiment

One, laboratory sample collection

Experiment swinery is planted 233 purebred Large White boars (castrate, body weight is 90kg left and right) on pig farm from Hubei gold woods original seed herding company limited.Swinery free choice feeding, drinking-water, the whole mode of feeding, raising condition etc. remain unanimously, are ordinary method.

Before butchering, gather the ear tissue sample of all test pig, put into 75% ethanol and preserve, for subsequent use for extracting pig genomic dna (specification sheets that concrete grammar provides with reference to the genomic dna test kit of Beijing Tian Gen biochemical technology company limited production).After having butchered, break apart by chopping backbone and eye muscle between chest, lumbar vertebrae.Then cutting left half trunk longissimus dorsi muscle is meat sample, measures for meat quality.

Two, longissimus dorsi muscle pH pH-value determination pH

24h after test pig death scratches an osculum on trunk with scalpel, electronic thermometer is inserted and in sample, measures temperature, and acidometer is demarcated with the reference liquid of pH=4.0 and pH=7.0 according to room temperature at that time; Meat sample is smashed to pieces with scalpel or scissors in the minimum 1cm of sample depths; Carefully probe is inserted in the meat sample of smashing to pieces, allow probe fully contact with meat sample; In the time of acidometer stable reading, write down pH value; Then select two places else at sampling position, measure by above-mentioned same method; Get the mean value of three detected results, as the pH value of this meat sample.

Three, the extraction of pig genomic dna and detection

The genomic dna test kit (TIANamp Genomic DNA Kit) that test adopts Beijing Tian Gen biochemical technology company limited to produce extracts pig genomic dna from pig ear tissue, and concrete operation step is as follows:

1) cut (by front alcohol swab wiped clean) with ophthalmologic operation and will take from Large White ear sample and be cut into pasty state, add 200 μ l bufferings

Liquid GA (this test kit carries), vibration is to thoroughly suspending.

2) add 20 μ l Proteinase K solution (this test kit carries), mix, be placed in 56 DEG C of water-bath digestion and spend the night.

3) add 200 μ l damping fluid GB (this test kit carries), fully put upside down and mix, place 10 minutes for 70 DEG C, solution strain is limpid, brief centrifugal to remove the globule of cap wall.

4) add 200 μ l dehydrated alcohols, fully vibration mixes 15 seconds, now may occur flocks, brief centrifugal to remove the globule of cap wall.

5) previous step gained solution and flocks are all added in an adsorption column CB3 (adsorption column is put into collection tube), (～13,400 × g) centrifugal 30sec, outwells waste liquid to 12000rpm, and adsorption column CB3 is put back in collection tube.

6) in adsorption column CB3, add 500 μ l damping fluid GD (this test kit carries), centrifugal 30 seconds of 12000rpm, outwells waste liquid, and adsorption column CB3 is put into collection tube.

7) in adsorption column CB3, add 600 μ l rinsing liquid PW (this test kit carries), centrifugal 30 seconds of 12000rpm, outwells waste liquid, and adsorption column CB3 is put into collection tube.

8) repetitive operation step 7.

9) adsorption column CB3 is put back in collection tube, centrifugal 2 minutes of 12,000rpm, outwells waste liquid.Adsorption column CB3 is placed in to room temperature and places several minutes, thoroughly dry rinsing liquid remaining in sorbing material.

10) adsorption column CB3 is proceeded in a clean centrifuge tube, to the unsettled dropping in the middle part 50-200 μ l elution buffer TE of adsorption film, room temperature is placed 2-5 minute, and centrifugal 2 minutes of 12,000rpm, collects solution in centrifuge tube.

11) get 2 μ L previous step gained solution D NA solution and 1 μ L sample loading buffer and mix, be splined on 1.2% sepharose, 120V voltage electrophoresis, about 20 minutes, is observed electrophoresis result and takes pictures under ultraviolet lamp, to judge the integrity of DNA.With NanoDrop2000 nucleic acid-protein analyser (Thermo Fisher Scientific, USA) to extract after DNA carry out quality examination, the ratio of A260/A280 is between 1.7-2.1, it is qualified that A260/A230 is judged as between 1.8-2.2.Qualified DNA is carried out to concentration determination, then concentration unification is diluted to 200ng/ μ L, put into the refrigerator of-20 DEG C and deposit.Underproof DNA sample needs again to extract.

Four, the Quality Control of the judgement of SNP chip gene type and genotype data

The genome DNA sample extracting in 233 pig ear samples is hybridized on the full genome chip of PorcineSNP60BeadChip of Illumina company development.In this chip, comprise 61177 SNP sites.

Adopt PLINK software to carry out Quality Control inspection to the original gene type data of all individualities, with SNP genotype recall rate (SNP call rate) >90%, minimum gene frequency (minor allele frequency, MAF) index such as P value <10-6 and sample recall rate (sample call rate) >90% of >0.01, Hardy-Weinberg balance (Hardy-Weinberg Equilibrium, HWE) inspection is standard.

Five, data preparation and analysis

1) phenotypic data analysis

Utilize SAS9.2 statistical analysis software, to butchering the pH measured value of latter 24 hours, the statistical study of being described property, comprises mean value, standard deviation, maximum value and the minimum value of calculating this proterties.

2) whole-genome association

Adopt PLINK software, carry out GWAS analysis.Applicant uses following mixture model analytical data.Model is:

Yij＝μ+Genotypei+εij

Wherein, Yij is character value after treatment; μ is the average of each proterties; Genotypei is genotype effect; ε ij is stochastic effect.

3) the inspection SNP significance associated with proterties.

In the time that certain SNP meets P<10-4 condition, it is remarkable that we just think that this SNP has reached complete genomic genomic level.

4) SNP annotation

According to chip SNP information, in the Sus scrofa of Ensembl website (www.ensembl.org) Buid10.2 database, use Variant Effect Predictor instrument, annotate this SNP, determine SNP site designation of chromosome and the physical location on karyomit(e) thereof, and determine thus in the inside or flank region of these remarkable SNPs known in Ensembl database.Then utilize bioinformatics method, the information such as gene structure, gene type, gene function and the path providing according to websites such as Ensembl, NCBI (www.ncbi.nlm.nih.gov), DAVID (david.abcc.ncifcrf.gov), carry out functional annotation to the gene in target area.Finally whether drop in the QTLs relevant with Meat Quality having reported for work by this site of QTLdb (cn.animalgenome.org/cgi-bin/QTLdb/index) retrieved web, further determine the SNPs being associated with pig flesh characters.

5) haplotype analysis

The region that comprises all remarkable SNPss relevant to pH value proterties on selected karyomit(e), and utilize Haploview (Version4.2) to carry out linkage disequilibrium analysis and haplotype analysis.Concrete steps are as follows: corresponding SNP to be analyzed map file and ped file are imported to Haploview software analysis.Wherein, map file has two row, and row are No. ID of SNP, and row are this SNP positions (with reference to the genome of ncbi database pig 10.2 editions) on karyomit(e); The first six row of ped file are fixed, and are followed successively by family ID, individual ID, male parent ID, maternal ID, (" 1 " represents male animal to sex; " 2 " represent dam), phenotypic number, be secondly genotype.

Six, interpretation of result

Pig DNA JC3 gene intron I pleomorphism site rs80855156 (ASGA0051428) genotype detection result is shown to AA (TT) genotype has 7 in 233 individualities, AB (TC) genotype has 61, and BB (CC) genotype has 165.The Meat Quality of analyzing is the pH butchering latter 24 hours.The correlated character obtaining is the pH butchering latter 24 hours.The results are shown in Table 2.

Table 1DNAJC3 gene intron I pleomorphism site rs80855156 genotype and the association analysis of butchering latter 24 hours pH

Note: * represents significant difference, P<0.05; * represents extremely significantly P<0.01 of difference; In table, character value is mean number ± standard error.(same in following form)

As shown in Table 1: the SNP site rs80855156 of DNAJC3 gene intron I with butcher latter 24 hours pH and be utmost point significant correlation (p<0.01).There is detailed results that in the DNAJC3 gene intron I of remarkably influenced, SNP site rs80855156 genotype and pig are butchered pH association analysis in latter 24 hours to butchering latter 24 hours pH values in table 2.

Table 2SNPs site rs80855156 (DNAJC3) genotype is butchered the least squares means of latter 24 hours pH values

As shown in Table 2, BB is genotypic butchers latter 24 hours pH values and is significantly higher than AB genotype (p<0.01) and AA genotype (p<0.01).Therefore B allelotrope (T allelotrope) is the favourable mark that pig is butchered latter 24 hours pH values.

Pig DNA JC3 gene intron IV pleomorphism site rs80882127 (ASGA0051431) genotype detection result is shown to AA (AA) genotype has 7 in 233 individualities, AB (AG) genotype has 61, and BB (GG) genotype has 165.The Meat Quality of analyzing is the pH butchering latter 24 hours.The correlated character obtaining is the pH butchering latter 24 hours.The results are shown in Table 3.

Table 3DNAJC3 gene intron IV pleomorphism site rs80882127 genotype and the association analysis of butchering latter 24 hours pH

As shown in Table 3: the SNP site rs80882127 of DNAJC3 gene intron VI with butcher latter 24 hours pH and be utmost point significant correlation (p<0.01).

There is in the DNAJC3 gene intron IV of remarkably influenced the SNP site genotypic least squares means of rs80882127 to butchering latter 24 hours pH values in table 4.

Table 4SNPs site rs80882127 (DNAJC3) genotype is butchered the least squares means of latter 24 hours pH values

As shown in Table 4, BB is genotypic to butcher the latter 24 hours pH value utmost points and is significantly higher than AB genotype (p<0.01) and AA genotype (p<0.01), and BB is genotypic, and to butcher latter 24 hours pH values the highest.Therefore B allelotrope (G allelotrope) is the favourable mark that pig is butchered latter 24 hours pH values.

From haplotype analysis, the linkage disequilibrium coefficient of this two SNP (rs80855156 and rs80882127) (D ') be 1, be to have complete linkage imbalance between these two sites, wherein the frequency of haplotype CA is 0.839, and the frequency of haplotype TG is 0.161.According to known with the association analysis result of butchering latter 24 hours pH, haplotype TG is the favourable mark that pig is butchered latter 24 hours pH values.The haplotype of these two SNP molecule markers and formation thereof can apply in the molecular marker assisted selection of pig, and then can improve the selection to meat quality.

Main reference

Fernandez,X.and?E.V.A.Tornberg(1991)."A?review?of?the?causes?of?variation?in?muscle?glycogen?content?and?ultimate?pH?in?pigs."Journal?of?Muscle?Foods2(3):209-235.

Groenen,M.A.M.,A.L.Archibald,et?al."Analyses?of?pig?genomes?provide?insight?into?porcine?demography?and?evolution."Nature491(7424):393-398.

Hamilton,D.N.,M.Ellis,et?al.(2000)."The?effect?of?the?Halothane?and?Rendement?Napole?genes?on?carcass?and?meat?quality?characteristics?of?pigs."Journal?of?animal?science78(11):2862-2867.

Harding,H.P.and?D.Ron(2002)."Endoplasmic?reticulum?stress?and?the?development?of?diabetes?a?review."Diabetes51(suppl3):S455-S461.

Hradecky,J.,V.Hruban,et?al.(1980)."Inheritance?of?sensitivity?to?halothane?in?pigs."Reproduction?in?Domestic?Animals15(4):219-225.

Kocwin-Podsiadla,M.,W.Przybylski,et?al.(1995)."Muscle?glycogen?level?and?meat?quality?in?pigs?of?different?halothane?genotypes."Meat?science40(1):121-125.

Korth,M.J.,C.N.Lyons,et?al.(1996)."Cloning,expression,and?cellular?localization?of?the?oncogenic58-kDa?inhibitor?of?the?RNA-activated?human?and?mouse?protein?kinase."Gene170(2):181-188.

Ladiges,W.C.,S.E.Knoblaugh,et?al.(2005)."Pancreaticβ-cell?failure?and?diabetes?in?mice?with?a?deletion?mutation?of?the?endoplasmic?reticulum?molecular?chaperone?gene?P58IPK."Diabetes54(4):1074-1081.

Lindahl,G.,A.-C.Enf？lt,et?al.(2004)."A?second?mutant?allele(V199I)at?the<i>PRKAG3(RN)</i>locus—II.Effect?on?colour?characteristics?of?pork?loin."Meat?science66(3):621-627.

Lindahl,G.,A.-C.Enf？lt,et?al.(2004)."A?second?mutant?allele(V199I)at?the<i>PRKAG3</i>(<i>RN</i>)locus—I.Effect?on?technological?meat?quality?of?pork?loin."Meat?science66(3):609-619.

Milan,D.,J.-T.Jeon,et?al.(2000)."A?mutation?in?PRKAG3associated?with?excess?glycogen?content?in?pig?skeletal?muscle."Science288(5469):1248-1251.

Reik,T.R.,W.E.Rempel,et?al.(1983)."Further?evidence?on?the?inheritance?of?halothane?reaction?in?pigs."Journal?of?animal?science57(4):826-831.

Schr？der,M.and?R.J.Kaufman(2005)."The?mammalian?unfolded?protein?response."Annu.Rev.Biochem.74:739-789.

Stiles,B.,Y.Wang,et?al.(2004)."Live-specific?deletion?of?negative?regulator?Pten?results?in?fatty?liver?and?insulin?hypersensitivity."Proceedings?of?the?National?Academy?of?Sciences?of?the?United?States?of?America?101(7):2082-2087.

Zamaratskaia,G.,A.Madej,et?al.(2005)."Free?oestrone?in?adipose?tissue?and?its?relation?to?androstenone?and?skatole?in?entire?male?pigs."Reproduction?in?Domestic?Animals40(2):156-160.

Claims (5)

1. a SNP molecule marker relevant to pork pH value proterties, is characterized in that, the nucleotide sequence of described molecule marker is as follows:

AGACGTGGCTTGGACCTGGCGTTGCTCTATGTCTGTGGTGTAGACCGGTGGCTGCAGCTCCGGTTCAACCCCTGGCCTGG?GATCCTCCATAGGCTGCAGGTGCAGTCCTAAAACAAAAACACTCTTTGTTTTAATTTAACAATCCTCTAAATTAAATTTT?TGTTTGATTTT GGGTAAATCAGCTCTGTGGCTACAAAAAATAAAAGATCGTTCTAGGGCTGCCACTGACTTGAGCTTG?TTATTTTCTCTCTGTAAGTGCTCTAATGTGCTCAACAGAATCTATCCCAGTGTCCCAGCCC

The base R that above-mentioned sequence is 172 is C or T, causes polymorphism.

2. a SNP molecule marker relevant to pork pH value proterties, is characterized in that, the nucleotide sequence of described molecule marker is as follows:

AGAGAGGACCAGGGCCAGGAGCTGAGTCTCTACAGCCGTGGAAGGTTTGGGCTGGGAGTGTCATGACAGGTGGGCTTTGA?GGGAAACAGGTAGACATTTAGAACGTTAGATAAGGAAAGATGCCATGACTGGAGAAGGGAGAAGGAAGAATTAAGTAAGA?TGCCCA GTTTTTGGAGTGTTCAAATTGGTATGTGTTCAAGCTGTTCCCTGAGAAATTATTTAGAGGAGAAGAAAGGGT?ACAAAAAATACAGCTCTCATAAAGACTTCCTGATTCTCAGCAGTTTATTTAATAATTTCTA

Base R in 167 of above-mentioned sequence is A or G, causes polymorphism.

3. the SNP molecule marker described in claim 1 or 2 forms the mark of a genotypic haplotype of pig.

4. the molecule marker described in claim 1 or 2 is used alone or in combination the application in pork pH value proterties detects.

5. a preparation method for the molecule marker relevant to pork pH value proterties, is characterized in that the following step:

1) extract pig genomic dna;

2) longissimus dorsi muscle of collection pig, by the pH value of three test pig longissimus dorsi muscle meat samples of pH meter measurement, gets the mean value of three measured results as the pH value of this meat sample;

3) pig genome DNA sample is made to gene type on full genome chip;

4) adopt PLINK software to carry out whole-genome association, therefrom choose the SNP significantly associated with the pork pH value of butchering latter 24 hours, use the Variant Effect Predictor instrument of Ensembl website, annotate this SNP, then utilize bioinformatics method, gene in target area is carried out to functional annotation, whether drop on by this site of QTLdb retrieved web in the QTLs relevant with pork pH value proterties of report, further determine the SNPs being associated with pork pH value proterties; Utilize Haploview to carry out linkage disequilibrium analysis and genotypic haplotype analysis.