CN103911377B - A kind of molecular markers for identification relevant to Carnis Sus domestica pH value character and application thereof - Google Patents

Abstract

The invention belongs to technical field of livestock molecular marker preparation, be specifically related to two SNP marker relevant to Carnis Sus domestica pH value character and the haplotype location being made up of the two SNP and application.This SNP marker is obtained by whole-genome association, and its nucleotide sequence is respectively as shown in SEQ ID NO:1 2 and Fig. 23.SNP obtained by recycling obtains a corresponding haplotype as shown in Figure 4 through haplotype analysis.The labelling of the present invention and haplotype can be used in Carnis Sus domestica pH value character coherent detection.

Description

A kind of molecular markers for identification relevant to Carnis Sus domestica pH value character and application thereof

Technical field

The invention belongs to technical field of livestock molecular marker preparation, be specifically related to two relevant to Carnis Sus domestica pH value character The qualification of the haplotype that SNP marker and the two SNP are constituted and application.

Background technology

In recent years, pig breeding work in, improve lean meat content and reduce the thickness of backfat always by breeder as mainly educating Plant target, and achieve significant effect.But the heredity of this selection-breeding mode selects to ultimately result in the decline of intramuscular fat content, And then cause the decline of meat quality.Along with meat requirement is improved constantly by consumer, improve the genetic research of meat quality Become the study hotspot of animal husbandry.

Meat Quality is a complicated character.Affect meat qualitative factor a lot, including heredity, nutrition, environmental health, Tu Management before government official, Dead weight and the processed after butchering.The index of evaluation meat quality quality specifically includes that intramuscular fat Content, marble grain, pH, yellowish pink, it is in waterpower, drip loss, muscle fiber characteristic (type, diameter, area ratio etc.) and meat The composition etc. of fatty acid.

PH value is one of most important index of meat mensuration.PH value directly represent muscle acidity, to meat quality Affect the biggest.The multiplex pH meter of meat pH value directly measures.The motion function of body muscle after slaughter is terminated and is in anoxia State, but metabolism still consumes ATP continuing, and in the short time, phosphagen is made ADP become ATP by creatine kinase, except this it Outward will not regeneration ATP, at this moment glycolysis produce lactic acid make muscle pH value reduce, but along with ATP decompose generate amine amass Tired and pH value reduction makes the enzymatic activity of glycolysis weaken even to inactivate, ultimately result in glycolysis and stop, and the pH value of muscle reaches Steady statue (Kocwin-Podsiadla, Przybylski et al.1995).

Owing to the mensuration of Meat Quality can only be carried out and relative difficulty after slaughter, therefore take traditional breeding method Carry out meat improvement to be subject to certain restrictions.Additionally, at present research on the gene affecting Meat Quality, and these genes it Between path research the most not thorough, limit Advances in Breeding equally.And molecular breeding can overcome these difficulties, for improving Meat quality provides another Research approach, directly analyzes quantitative genetic variation from DNA level, makes individual gene the most single The detection of quantity affect trait is possibly realized by site.Therefore, use molecular genetics methods inherently to improve meat quality Increasingly receive publicity, have become as the important research approach of this research direction.

Although candidate gene approach and QTL location have been used for pig flesh characters genetic marker in pig marker assisted selection Finding, and achieve certain effect, QTL as relevant to all character in pig has 8421.But candidate gene approach can only be retrieved Preset candidate gene, and new gene can not be identified；It is very big that what QTL positioned is limited in the general span in QTL region, is difficult to do To fine location.Nowadays, whole-genome association (Genome-wide Association Study, GWAS) has become knowledge The New Policy of the candidate gene the most relevant with Important Economic character or specifically genome area.Candidate gene approach and QTL relatively Location, GWAS can position more accurately and identify new gene.It has been widely used in cattle breeding, as improved Milk production of cow etc..Along with the highdensity SNP of pig (Single nucleotide polymorphism, single nucleotide polymorphism) The exploitation of chip, and pig gene order-checking work complete (Groenen, Archibald et al.), GWAS be pig point Sub-breeding opens a frontier.

So far, it has been acknowledged that the major gene resistance for pig flesh characters has halothane, acid meat gene and PRKAG3 base Cause.

Halothane (Halothane gene, Hal) is the vital signs affecting meat quality being found the earliest Gene.It is positioned at undergoing mutation of Lamb wave mode 1 gene (Ryanodinereceptor1, the RYR1) of No. 6 chromosomes of pig, its Allogene causes adverse effect to meat quality, causes white muscles (pale, soft and exudative, PSE meat) Produce (Hradecky, Hruban et al.1980；Reik,Rempel et al.1983；Hamilton,Ellis et al.2000).Acid meat (RN) gene is positioned at No. 15 chromosomes, and its disadvantageous sudden change RN is found at first in Hampshire, makes pig Slaughter postmortem muscle pH value on the low side, affect meat quality.PRKAG3 (AMP-activatedProteinKinase3) gene is main Affect the pH value of Carnis Sus domestica, yellowish pink and drip loss.In this gene, R200Q undergos mutation is to cause RN effect, makes pig butcher Within latter 24 hours, muscle pH value reduces, and drip loss increases (Milan, Jeon et al.2000；Lindahl,Enf？lt et al.2004；Lindahl,Enf？lt et al.2004；Zamaratskaia,Madej et al.2005).For Meat The candidate gene of shape, has at present many cases report, wherein study relatively to be clear that H-FABP, MC4R, IGF2, MyoG, Myostatin, ACSL, PPAR γ, AMPD1, ADD1 and CAST.

Forefathers' research shows, the albumen of DNAJC3 (P58IPK) gene code people and mice institute in a organized way in have table Reach, especially high expressed (Korth, Lyons et al.1996) in pancreas and liver.Beta Cell of islet have powerful Endoplasmic reticulum is responsible for folding, transporting and process newly synthesized insulin (Harding and Ron2002).Various destruction endoplasmic reticulum merits The stimulation of energy is referred to as er stress, and unfolded protein can be caused to accumulate (Schr in endoplasmic reticulum？der and Kaufman2005).DNAJC3 is the important component in negative feedback loop, can suppress eIF-2 alpha signal path, and weakens and do not roll over Folded albumino reaction (Schr？der and Kaufman2005).In mice, after knockout dna JC3 gene, Mouse Weight reduces, i.e. Make free choice feeding 10～12 months, and the body fat of mice < 10%, and then reduce fat generation.The mechanism causing body fat to reduce can Can be apoptosis and the minimizing of available insulin of β cell, so stop glucose to fat conversion and store (Ladiges, Knoblaugh et al.2005).Insulin resistant when beta Cell of islet can not compensate suitable insulin secretion, just produces Type-II diabetes.

In the pancreas of the type-II diabetes people of people, find that the protein level of DNAJC3 raises.The generation of type-II diabetes with The damage of insulin signaling pathway is relevant.And insulin controls the dynamic of glucose and lipid in liver, muscle and fatty tissue State balances.In liver, insulin promotes glucose and the synthesis of fatty acid.In muscle and fatty tissue, insulin is permissible Stimulate the absorption (Stiles, Wang et al.2004) of glucose.When butchering, in muscle, content and the glycolysis of glucose are determined The height (Fernandez and Tornberg1991) of Carnis Sus domestica pH value after having determined to butcher latter 24 hours.

At present, the report of research pig DNA JC3 gene function is little, and applicant uses the method for whole-genome association The part of intron of this gene is carried out association analysis and polymorphic research, and intron at pig DNA JC3 gene has been looked for first The Meat Quality SNP marker arrived and haplotype thereof.

Summary of the invention

It is an object of the invention to overcome the defect of prior art, it is provided that two SNPs relevant to Carnis Sus domestica pH value character divide The qualification of the haplotype that sub-labelling and the two SNP are constituted and application.The present invention uses the method for whole-genome association to seek Look for the SNP marker relevant to Carnis Sus domestica pH value character and haplotype, in this, as the SNP molecule mark that Carnis Sus domestica pH value character is relevant Note and haplotype application in marker assisted selection.

The present invention is achieved through the following technical solutions:

Applicant obtains a SNP marker relevant to Carnis Sus domestica pH value character, the core of this molecular marker by clone Nucleotide sequence is as follows:

AGACGTGGCTTGGACCTGGCGTTGCTCTATGTCTGTGGTGTAGACCGGTGGCTGCAGCTCCGGTTCAACCCCTGGCC TGG GATCCTCCATAGGCTGCAGGTGCAGTCCTAAAACAAAAACACTCTTTGTTTTAATTTAACAATCCTCTAAATT AAATTTT TGTTTGATTTTGGGTAAATCAGCTCTGTGGCTACAAAAAATAAAAGATCGTTCTAGGGCTGCCACTG ACTTGAGCTTG TTATTTTCTCTCTGTAAGTGCTCTAATGTGCTCAACAGAATCTATCCCAGTGTCCCAGCCC

Base R of above-mentioned sequence 172 is C or T, causes polymorphism.

The present invention obtains another SNP marker relevant to Carnis Sus domestica pH value character by clone, this molecular marker Nucleotide sequence is as follows:

AGAGAGGACCAGGGCCAGGAGCTGAGTCTCTACAGCCGTGGAAGGTTTGGGCTGGGAGTGTCATGACAGGTGGGCTT TGA GGGAAACAGGTAGACATTTAGAACGTTAGATAAGGAAAGATGCCATGACTGGAGAAGGGAGAAGGAAGAATTA AGTAAGATGCCCAGTTTTTGGAGTGTTCAAATTGGTATGTGTTCAAGCTGTTCCCTGAGAAATTATTTAGAGGAG AAGAAAGGGTACAAAAAATACAGCTCTCATAAAGACTTCCTGATTCTCAGCAGTTTATTTAATAATTTCTA

Base R in 167 of above-mentioned sequence is A or G, causes polymorphism.

The molecular marker of above-mentioned preparation can be used alone or in combination the application in Carnis Sus domestica pH character detects.

Applicant providing the preparation method of a kind of SNP marker relevant to Carnis Sus domestica pH value character, it is following Step:

1) pig genomic DNA is extracted；

2) gather the longissimus dorsi muscle of pig, measure the pH value of three test pig longissimus dorsi muscle meat samples with pH meter, take three times and surveyed The meansigma methods of result is as the pH value of this meat sample；

3) pig genome DNA sample is done gene type on full-length genome chip；

) use PLINK software to carry out whole-genome association；Therefrom choose and butcher the Carnis Sus domestica pH value of latter 24 hours The SNP of notable association, uses Ensembl websiteVariant Effect PredictorInstrument, annotates this SNP；Then profit With bioinformatics method, the gene in target area is carried out functional annotation；Whether fallen by this site of QTLdb retrieved web In the QTLs relevant with Carnis Sus domestica pH value character of report, further determine that the SNPs being associated with Carnis Sus domestica pH value character；Utilize Haploview carries out linkage disequilibrium value and haplotype analysis.

The present invention by the method for whole-genome association (GWAS) obtain the part Meat Quality with pig particularly with The SNP marker that Carnis Sus domestica pH value character is associated, the molecular marker assisted selection for pig provides two new molecular markers With a haplotype.

More detailed technical scheme sees " detailed description of the invention ".

Accompanying drawing explanation

Sequence table SEQ ID NO:1 be from NCBI website download with pork quality trait related gene DNAJC3 intron I Partial nucleotide sequence, analyzes first molecular marker obtaining the present invention through detection, and sequence length is 300bp, in this sequence There is an allelic sudden change at the 172bp of row, i.e. sported T by C.

Sequence table SEQ ID NO:2 be from NCBI website download with pork quality trait related gene DNAJC3 intron IV Partial dna sequence.Analyze second molecular marker obtaining the present invention through detection, sequence length is 300bp, in this sequence There is an allelic sudden change at 167bp, i.e. sported G by A.

Fig. 1: be the techniqueflow chart of the present invention.

The partial sequence of the pig DNA JC3 gene intron I of Fig. 2: present invention clone, is wherein positioned at No. 11 chromosomes of pig At the 1st intron the 23633rd bit base of DNAJC3 gene in the i.e. bracket of (at the 172bp in the fragment that this is cloned) it is Allelic mutational site.

The partial sequence of the pig DNA JC3 gene intron IV of Fig. 3: present invention clone, is wherein positioned at No. 11 chromosomes of pig At the 4th intron the 8181st bit base of DNAJC3 gene in the i.e. bracket of (at the 167bp in the fragment that this is cloned) it is Allelic mutational site.

The list being made up of pleomorphism site rs80855156 and rs80882127 that Fig. 4: analysis of the present invention obtains times Type.

Detailed description of the invention

One, laboratory sample collection

Experiment swinery (is castrated from 233 purebred Large White boars on gold woods original seed herding company limited's kind pig farm, Hubei Cutting, body weight is about 90kg).Swinery free choice feeding, drinking-water, whole feed mode, rearing conditions etc. are always consistent, for often Rule method.

Before butchering, gather the ear tissue sample of all test pig, put in 75% ethanol and preserve, for extracting pig genome DNA (description that the genomic DNA kit that concrete grammar produces with reference to Beijing Tian Gen biochemical technology company limited provides) is standby With.After having butchered, between thoracolumbar vertebrae, break apart by chopping spinal column and eye muscle.Then cutting left half trunk longissimus dorsi muscle is meat sample, for muscle Quality determination.

Two, longissimus dorsi muscle pH value measures

24h after test pig death, scratches an osculum with scalpel on trunk, is inserted by electronic thermometer in sample and surveys Fixed temperature, and according to the titer of room temperature pH=4.0 at that time and pH=7.0, acidometer is demarcated；In the minimum 1cm of sample Meat sample is smashed to pieces by depths scalpel or shears；Insert a probe into carefully in the meat sample smashed to pieces, allow probe fully connect with meat sample Touch；When acidometer stable reading, write down pH value；Then select else at two at sampling sites, survey by above-mentioned same method Fixed；Take the meansigma methods of three testing results, as the pH value of this meat sample.

Three, the extraction of pig genomic DNA and detection

Test uses genomic DNA kit (the TIANamp Genomic that Beijing Tian Gen biochemical technology company limited produces DNA Kit) from pig ear tissue, extract pig genomic DNA, concrete operation step is as follows:

1) cut (by front alcohol swab wiped clean) with ophthalmologic operation to take from Large White ear sample and be cut into pasty state, add 200 μ l and delay Punching

Liquid GA (this test kit carries), vibrates to thoroughly suspending.

2) 20 μ l Proteinase K Solution (this test kit carries) are added, mixing, it is placed in 56 DEG C of water-baths and digests overnight.

3) 200 μ l buffer GB (this test kit carries) are added, the most reverse mixing, to place 10 minutes for 70 DEG C, solution should Becoming limpid, brief centrifugation is to remove the globule of cap wall.

4) 200 μ l dehydrated alcohol are added, fully vibration mixing 15 seconds, now it is possible that flocculent deposit, brief centrifugation To remove the globule of cap wall.

5) previous step gained solution and flocculent deposit are all added in an adsorption column CB3 that (adsorption column puts into collecting pipe In), 12000rpm (～13,400 × g) centrifugal 30sec, outwells waste liquid, is put back in collecting pipe by adsorption column CB3.

6) adding 500 μ l buffer GD (this test kit carries) in adsorption column CB3,12000rpm is centrifuged 30 seconds, outwells Waste liquid, puts into adsorption column CB3 in collecting pipe.

7) adding 600 μ l rinsing liquid PW (this test kit carries) in adsorption column CB3,12000rpm is centrifuged 30 seconds, outwells Waste liquid, puts into adsorption column CB3 in collecting pipe.

8) repetitive operation step 7.

9) putting back in collecting pipe by adsorption column CB3,12,000rpm are centrifuged 2 minutes, outwell waste liquid.Adsorption column CB3 is placed in Room temperature places several minutes, thoroughly dries rinsing liquid remaining in adsorbing material.

10) adsorption column CB3 is proceeded in a clean centrifuge tube, the unsettled dropping 50-200 to the middle part of adsorbed film μ l elution buffer TE, room temperature placement 2-5 minute, 12,000rpm are centrifuged 2 minutes, are collected in centrifuge tube by solution.

11) take 2 μ L previous step gained solution D NA solution and the mixing of 1 μ L sample loading buffer, be splined on the agarose of 1.2% Gel, 120V electrophoresis about 20 minutes, observe electrophoresis result under uviol lamp and take pictures, to judge the integrity of DNA.With NanoDrop2000 nucleic acid-protein analyser (Thermo Fisher Scientific, USA) carries out quality to the DNA after extracting Detection, the ratio of A260/A280 is between 1.7-2.1, and it is qualified that A260/A230 is judged as between 1.8-2.2.To qualified DNA carries out concentration mensuration, is then diluted to 200ng/ μ L by unified for concentration, and the refrigerator putting into-20 DEG C is deposited.Underproof DNA Sample then needs again to extract.

Four, SNP chip genotype judges and the Quality Control of genotype data

The genome DNA sample extracted in 233 pig ear samples is developed in Illumina company Hybridize on PorcineSNP60BeadChip full-length genome chip.This chip comprises 61177 SNP site.

PLINK software is used the original gene type data of all individualities to be carried out Quality Control inspection, with SNP genotype recall rate (SNP call rate) > 90%, minimum gene frequency (minor allele frequency, MAF) > 0.01, Hardy- P value < the 10-6 and sample recall rate (sample that Weinberg equilibrium (Hardy-Weinberg Equilibrium, HWE) is checked Call rate) > index such as 90% is standard.

Five, data compilation and analysis

1) phenotypic data analysis

Utilize SAS9.2 statistical analysis software, to butchering the pH measured value of latter 24 hours, being described property statistical analysis, bag Include the calculating meansigma methods of this character, standard deviation, maximum and minima.

2) whole-genome association

Use PLINK software, carry out GWAS analysis.Applicant uses following mixed model analytical data.Model is:

Yij=μ+Genotypei+ ε ij

Wherein, Yij is the character value after processing；μ is the average of each character；Genotypei is genotype effects；εij For stochastic effect.

3) inspection SNP and the significance of trait associations.

When certain SNP meets P < 10-4 condition, we are considered as this SNP and have reached the genomic level of full-length genome Significantly.

4) SNP annotation

According to chip SNP information, at the Sus scrofa Buid10.2 number of Ensembl website (www.ensembl.org) According in storehouse, use Variant Effect Predictor instrument, annotate this SNP, i.e. determine SNP site designation of chromosome and Physical location on chromosome, and the inside of known is also in Ensembl data base to thereby determine that these notable SNPs In being flank region.Then utilize bioinformatics method, according to Ensembl, NCBI (www.ncbi.nlm.nih.gov), The letters such as gene structure, gene type, gene function and the path that the websites such as DAVID (david.abcc.ncifcrf.gov) provide Breath, carries out functional annotation to the gene in target area.Finally by QTLdb (cn.animalgenome.org/cgi-bin/ QTLdb/index) whether this site of retrieved web falls in the QTLs relevant with Meat Quality reported for work, further determine that with The SNPs that pig flesh characters is associated.

5) haplotype analysis

Comprise the region of all notable SNPss relevant to pH value character on selected chromosome, and utilize Haploview (Version4.2) linkage disequilibrium value and haplotype analysis are carried out.Specifically comprise the following steps that the SNP being analysed to is corresponding Map file and ped file import to Haploview software analysis.Wherein, map file has two row, and string is No. ID of SNP, and one Row are this SNP positions (with reference to the genome of ncbi database pig 10.2 editions) on chromosome；The first six row of ped file are solid Fixed, it is followed successively by family ID, individual ID, male parent ID, maternal ID, (" 1 " represents male animal to sex；" 2 " represent female animal), phenotypic number, Next to that genotype.

Six, interpretation of result

To pig DNA JC3 gene intron I pleomorphism site rs80855156 (ASGA0051428) genotype call results Showing that AA (TT) genotype has 7 in 233 individualities, AB (TC) genotype has 61, and BB (CC) genotype has 165.Institute The Meat Quality analyzed is the pH butchered latter 24 hours.Obtained correlated traits is the pH butchered latter 24 hours.The results are shown in Table 2。

Table 1DNAJC3 gene intron I pleomorphism site rs80855156 genotype and associating of butchering latter 24 hours pH Analyze

Note: * represents significant difference, P < 0.05；* represents the extremely notable P < 0.01 of difference；In table, character value is average ± mark Standard is by mistake.(same in below table)

As shown in Table 1: SNP site rs80855156 of DNAJC3 gene intron I with butcher latter 24 hours pH in the most aobvious Write relevant (p < 0.01).To butchering SNP site in the DNAJC3 gene intron I that latter 24 hours pH value have a significant impact Rs80855156 genotype and pig are butchered the detailed results of pH association analysis in latter 24 hours and are shown in Table 2.

Table 2SNPs site rs80855156 (DNAJC3) genotype butchers the least squares means of latter 24 hours pH value

As shown in Table 2, the latter 24 hours pH value of butchering of BB genotype are significantly higher than AB genotype (p < 0.01) and AA gene Type (p < 0.01).Therefore B allele (T allele) is the favourable labelling that pig butchers latter 24 hours pH value.

To pig DNA JC3 gene intron IV pleomorphism site rs80882127 (ASGA0051431) genotype call results Showing that AA (AA) genotype has 7 in 233 individualities, AB (AG) genotype has 61, and BB (GG) genotype has 165.Institute The Meat Quality analyzed is the pH butchered latter 24 hours.Obtained correlated traits is the pH butchered latter 24 hours.The results are shown in Table 3。

Table 3DNAJC3 gene intron IV pleomorphism site rs80882127 genotype and associating of butchering latter 24 hours pH Analyze

As shown in Table 3: SNP site rs80882127 of DNAJC3 gene intron VI with butcher latter 24 hours pH in the most aobvious Write relevant (p < 0.01).

To butchering SNP site rs80882127 base in the DNAJC3 gene intron IV that latter 24 hours pH value have a significant impact Because the least squares means of type is shown in Table 4.

Table 4SNPs site rs80882127 (DNAJC3) genotype butchers the least squares means of latter 24 hours pH value

As shown in Table 4, the latter 24 hours pH value pole of butchering of BB genotype is significantly higher than AB genotype (p < 0.01) and AA base Because of type (p < 0.01), BB genotype to butcher latter 24 hours pH value the highest.Therefore B allele (G allele) is that pig is butchered The favourable labelling of latter 24 hours pH value.

From haplotype analysis, the linkage disequilibrium coefficient of the two SNP (rs80855156 and rs80882127) (D ') it is 1, i.e. there is complete linkage between the two site uneven, wherein the frequency of haplotype CA is 0.839, haplotype TG's Frequency is 0.161.According to butcher the association analysis result of latter 24 hours pH, haplotype TG is that pig butchers latter 24 hours pH The favourable labelling of value.The haplotype of the two SNP marker and composition thereof can apply to the molecular marker assisted selection of pig In, and then the selection to meat quality can be improved.

Leading reference

Fernandez,X.and E.V.A.Tornberg(1991)."A review of the causes of variation in muscle glycogen content and ultimate pH in pigs."Journal of Muscle Foods2(3):209-235.

Groenen,M.A.M.,A.L.Archibald,et al."Analyses of pig genomes provide insight into porcine demography and evolution."Nature491(7424):393-398.

Hamilton,D.N.,M.Ellis,et al.(2000)."The effect of the Halothane and Rendement Napole genes on carcass and meat quality characteristics of pigs." Journal of animal science78(11):2862-2867.

Harding,H.P.and D.Ron(2002)."Endoplasmic reticulum stress and the development of diabetes a review."Diabetes51(suppl3):S455-S461.

Hradecky,J.,V.Hruban,et al.(1980)."Inheritance of sensitivity to halothane in pigs."Reproduction in Domestic Animals15(4):219-225.

Kocwin-Podsiadla,M.,W.Przybylski,et al.(1995)."Muscle glycogen level and meat quality in pigs of different halothane genotypes."Meat science40(1): 121-125.

Korth,M.J.,C.N.Lyons,et al.(1996)."Cloning,expression,and cellular localization of the oncogenic58-kDa inhibitor of the RNA-activated human and mouse protein kinase."Gene170(2):181-188.

Ladiges,W.C.,S.E.Knoblaugh,et al.(2005)."Pancreaticβ-cell failure and diabetes in mice with a deletion mutation of the endoplasmic reticulum molecular chaperone gene P58IPK."Diabetes54(4):1074-1081.

Lindahl,G.,A.-C.Enf？lt,et al.(2004)."A second mutant allele(V199I)at the<i>PRKAG3(RN)</i>locus—II.Effect on colour characteristics of pork loin." Meat science66(3):621-627.

Lindahl,G.,A.-C.Enf？lt,et al.(2004)."A second mutant allele(V199I)at the<i>PRKAG3</i>(<i>RN</i>)locus—I.Effect on technological meat quality of pork loin."Meat science66(3):609-619.

Milan,D.,J.-T.Jeon,et al.(2000)."A mutation in PRKAG3associated with excess glycogen content in pig skeletal muscle."Science288(5469):1248-1251.

Reik,T.R.,W.E.Rempel,et al.(1983)."Further evidence on the inheritance of halothane reaction in pigs."Journal of animal science57(4): 826-831.

Schr？der,M.and R.J.Kaufman(2005)."The mammalian unfolded protein response."Annu.Rev.Biochem.74:739-789.

Stiles,B.,Y.Wang,et al.(2004)."Live-specific deletion of negative regulator Pten results in fatty liver and insulin hypersensitivity." Proceedings of the National Academy of Sciences of the United States of America 101(7):2082-2087.

Zamaratskaia,G.,A.Madej,et al.(2005)."Free oestrone in adipose tissue and its relation to androstenone and skatole in entire male pigs." Reproduction in Domestic Animals40(2):156-160.

Claims (2)

1. SNP marker application in Carnis Sus domestica pH value detects, it is characterised in that the nucleotide of described molecular marker Sequence is as follows:

AGACGTGGCTTGGACCTGGCGTTGCTCTATGTCTGTGGTGTAGACCGGTGGCTGCAGCTCCGGTTCAACCCCT GGCCTGGGATCCTCCATAGGCTGCAGGTGCAGTCCTAAAACAAAAACACTCTTTGTTTTAATTTAACAATCCTCTAA ATTAAATTTTTGTTTGATTTTRGGGTAAATCAGCTCTGTGGCTACAAAAAATAAAAGATCGTTCTAGGGCTGCCACT GACTTGAGCTTGTTATTTTCTCTCTGTAAGTGCTCTAATGTGCTCAACAGAATCTATCCCAGTGTCCCAGCCC

Base R of above-mentioned sequence 172 is C or T, causes polymorphism.

2. SNP marker application in Carnis Sus domestica pH value detects, it is characterised in that the nucleotide of described molecular marker Sequence is as follows:

AGAGAGGACCAGGGCCAGGAGCTGAGTCTCTACAGCCGTGGAAGGTTTGGGCTGGGAGTGTCATGACAGGTGG GCTTTGAGGGAAACAGGTAGACATTTAGAACGTTAGATAAGGAAAGATGCCATGACTGGAGAAGGGAGAAGGAAGAA TTAAGTAAGATGCCCARGTTTTTGGAGTGTTCAAATTGGTATGTGTTCAAGCTGTTCCCTGAGAAATTATTTAGAGG AGAAGAAAGGGTACAAAAAATACAGCTCTCATAAAGACTTCCTGATTCTCAGCAGTTTATTTAATAATTTCTA

Base R in 167 of above-mentioned sequence is A or G, causes polymorphism.