CN103898121B - Hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED and its application - Google Patents
Hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED and its application Download PDFInfo
- Publication number
- CN103898121B CN103898121B CN201410153314.5A CN201410153314A CN103898121B CN 103898121 B CN103898121 B CN 103898121B CN 201410153314 A CN201410153314 A CN 201410153314A CN 103898121 B CN103898121 B CN 103898121B
- Authority
- CN
- China
- Prior art keywords
- med
- bemisia tabaci
- bttrp
- hidden
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to genetic engineering field, and in particular to hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED and its application, its nucleotide sequence is as shown in SEQ ID No.1.The present invention is cloned into the cDNA of transient receptor ion channel TRP (MED BtTrp) gene from the hidden kinds of Bemisia tabaci MED, and causes the hidden kinds of Bemisia tabaci MED survival rate under high temperature stress to significantly reduce by feeding MEDBtTrp gene dsRNA results.Result of the present invention is significant for clear and definite hidden kind of temperature sensing mechanism of Bemisia tabaci MED, is desired for the further Acclimation temperature mechanism of research Bemisia tabaci and the method for controlling Bemisia tabaci to endanger by thermal adaptability in the future provides foundation.
Description
Technical field
The present invention relates to genetic engineering field, and in particular to hidden kind of transient receptor ion channel gene MED of Bemisia tabaci MED
BtTrp and its application.
Background technology
Bemisia tabaci Bemisia tabaci (Gennadius) belong to Semiptera (Hemiptera) Aleyrodidae
(Aleyrodidae), small Aleyrodes Bemisia, is polyphagous sucking insect, with being mainly distributed on Perenniporia martius
Area.Bemisia tabaci is invaded and the mechanism for the expansion that succeeds includes many-sided, multi-level content, and in the environment of whole world change, it is raw
It is one of its key link that state, which is adapted to,.The factor that ecologic adaptation is related to mainly includes biological factor and abiotic factor, in non-life
In thing factor, temperature is to influence the key factor of its population dynamic and diffusion profile.There are some researches show Bemisia tabaci invasion mechanism
It is closely related with Bemisia tabaci thermal adaptability.
The hidden kinds of MED to temperature have stronger resistance be its can be diffused as whole world important pests key factor it
One, be its invade and the expansion that succeeds one of important mechanisms.The hidden kinds of MED have very strong heat-resisting ability, make it in sweltering heat
Season can Rampant damage；And in cold season, the protecting field gradually expanded is provided for hibernacle so that it accumulates a large amount of
Insect population number is so that break out.The acquisition of insect heat resistance and the molecular chaperones of heat shock protein (heat shock proteins, HSP)
Effect is relevant, and heat shock protein plays an important role on biological heat stress ecology adapts to and evolved.Early-stage Study shows heat shock egg
White gene plays key effect in Bemisia tabaci heat resistance, to be better understood from Bemisia tabaci Acclimation temperature ability, studies tobacco powder
Lice how to perceive ambient temperature and to be passed to internal temperature sensing mechanism particularly important.There are some researches show instantaneous sense
Receiver ion channel TRP (transient receptor potential) is the biological critical passage for perceiving ambient temperature.
Transient receptor ion channel（transient receptor potential,TRP）It is to be located on cell membrane
The important ion channel of one class, is found in the vision system of drosophila earliest.When being activated, it is allowed to the sun including calcium ion
Ion carries out transdermal delivery.TRP plays a part of external environment condition and nervous system intermediary as the gate molecule in receptor,
Thermostimulation, chemical stimulation and mechanical stimulus etc. can be changed into inward electric current.TRP is studied more in model organism drosophila
Thoroughly, mainly should be with the biological function such as biochemical response with photoinduction, temperature sensing, mechanical sense.
RNA is disturbed（RNA interference,RNAi）Refer to endogenous or exogenous dsRNA（double-
stranded RNA,dsRNA）Selective degradation occurs for the intracellular mRNA of mediation, so as to cause target cell expression silencing, produces
The phenomenon of raw corresponding function phenotype missing.RNAi, as the new technology for closing specific gene function, is the research of gene function
There is provided a quick, easy method, the research for insect serves highly important effect.RANi technologies are in gene work(
Research in terms of energy is a technology that can inactivate target gene that is quick, efficient, being easy to operation.In recent years, RNAi technology
More and more applied in insect research, by some genes in RNAi technology silence insect bodies, make some of insect
Ability strengthens or lost, and can also suppress the expression of its functional gene in special time makes the development of insect rest on some stage, enters
And reach the purpose for utilizing or preventing and treating its harm.RNAi technology is generally moved using feeding, injection, immersion, electroporation, stem cell
Plant, method is prepared etc. by transgenic technology.In insect is studied, RNAi effects are generally carried out using injection and feeding method
Research, the dsRNA of target gene or siRNA are imported in insect bodies, and then realize interference.Due to Bemisia tabaci body volume
It is small, the injection dsRNA limitations such as not easy to operate, time-consuming, and feeding dsRNA is the features such as have easy, easily operated and in Bemisia tabaci
Applied in research.
The present invention is cloned into transient receptor ion channel TRP (MED BtTrp) gene from the hidden kinds of Bemisia tabaci MED
CDNA, and the Bemisia tabaci MED cloning process of hidden kind of transient receptor ion channel TRP gene cDNA is provided, and by feeding MED
BtTrp gene dsRNA results cause the hidden kinds of Bemisia tabaci MED survival rate under high temperature stress to significantly reduce.Result of the present invention for
Specify that hidden kind of temperature sensing mechanism of Bemisia tabaci MED is significant, be desired for the Acclimation temperature mechanism of further research Bemisia tabaci
The method for controlling Bemisia tabaci to endanger by thermal adaptability in the future provides foundation.
The content of the invention
The purpose of the present invention is that MED BtTrp genes are cloned into from the hidden kinds of Bemisia tabaci MED.
Another object of the present invention is to demonstrate the work that MED BtTrp genes rise under the conditions of Bemisia tabaci high temperature stress
With there is provided the application of above-mentioned MED BtTrp genes.
According to the MED BtTrp genes of the present invention, the MED BtTrp gene cDNA full length nucleotides sequence such as SEQ ID
Shown in No.1：
ATGGGGAGGCCGACGGAGCGGGCCACCCGAGCCGGACAGTCTGTGCTTGCTTGTCGTTTTCGCCACGATGGAGTAAT
CCGTTCCATCCCAGTTTTGGGTAGTGCTCCATTTTTTGGATAACGCTTTTTCCCAGGTGCGAGGGGCAGGATGAAGC
CGACGGAATCGAAGGAGGACCTCCTGGGGTCGAAGGAGAACCTAAAAAATCCCCGAGAGTCCTTGCAGTCGACCGGC
GGCGAGGTTGCCCTCACCCAGATCGAGAAAAGGTTCCTCTTGCTCAGCGAAAGGGGAGATATCGCCTCGGTCAAAAG
GATAATCGCTGAGCACAAAGATCACCCAGAACTATTGAACATCAACTGCGTTGATCCTCTGAACAGGTCAGCACTCA
TCGCAGCGATCGAAAATGAAAATATAGAGTTAATAAGAGTCCTCCTCGAACTTGGGATTGAAGTCAAGGATGCTCTT
CTGCACGCAATTAAGGAAGAGTACGTTGAAGCTGTGGAGATTCTACTTGAATGGGAAGAAAAAATCCACAAACCTGG
GCAGCCTTATAGTTGGGAAGCTGTTGACGGGAGCTCTTCGACATTTACACCGGACATAACACCGCTCATATTGGCTG
CTCACATGAACAATTACGAAATCCTGAAAATTTTGTTGGATCGAGGCGCCACACTCCCCGCGCCACACGATGTTAGG
TGTGGCTGCGACGAATGTGTAACTTCAAGTGAGCAGGATTCTTTGCGACATTCACAAGCTCGGATCAACGCGTACAG
AGCTTTAACCGCACCATCCCTCATAGCCCTCTCTTCCAGGGATCCCCTCCTTACCGCCTTCGAGTTATCATGGGAGC
TGCGCAGACTCAGCAAGATGGAAGCGGAATTCCGCTCTGAATATAATGAAATGAGAGGTATTTGTCAGACATTTGCA
ACCTCCTTGCTAGACCACGCGCGAACCTCGTATGAACTGGAGGTGATGCTTAATCATAATCCTGATGGAGAGTCGTG
GGAACCAGGAGAGAGGCAAACTCTGGAGAGACTGAAGCTAGCTATCAAATACAAACAAAAAGCGTTTGTTGCTCATC
CAAATGTACAACAGCTGCTGGCAGCTATTTGGTATGATGGTCTCCCCGGATTTCGACGAAAAGGGATGATTGGTCAA
GCTTTTGAGTGTGGAAAGTTAGGTGCAATGTTTCCTGTCTACGCAACCGTGTATTTGACAGCGCCTGAATCGGAGAT
GGGCCAGTTCATGAAAAAACCCTTTGTAAAGTTCATCTGTAATTCAACCTCCTACGCTTTCTTCCTGATGTTATTGG
CCTTGGCATCACAAAGAGCGGAATTTCTTGCAATCGAATGGTTTGGACCCGACTGGATGAAAGAGATACTGAAAGAG
TGGACTCGAAAGGAAAGAGGATCAATACCTGGTCTCATAGAATCCTTTATTATTTTGTATATCATAAGTTTGATTTG
GGGTGAAATGAGAGCATTGTGGTCTGGTGGCTTAGAGGACTATGTTTCAGATTTGTGGAATATAGTGGATTTCATCA
CCAATGTATTCTATATGATATGGATTTGTCTCAGAGGAACTGCGTATATCATTGTGCAAAGAGAGCATAAAAGTGGC
CTCGATCCATGGTATCCTCGTGATAAGTGGGACATGTTTGATCCTCATCTTCTATCAGAAGGTGCGTTTGCAGCCAG
TATGATCTTCAGTTTCTTAAAATTGGTTCATATCTTCAGTATCAATCCTCATCTTGGTCCACTGCAAATTTCGTTGG
GACGAATGATTGTCGACATCATCAAATTTTTCTTCATCTACACATTGGTCCTTTTCGCTTATGGTTGTGGTATGAAT
CAGTTACTTTGGTACTATGCTGATCTTGAGAGGAAAAAGTGTTATCATCTGAACGAGGATTATGCTGATTTTGATGG
TCAAGATAAAGCCTGTACAACATGGAGACGTTTTGCAAATTTATTTGAAACATCTCAGTCTCTGTTCTGGGCCAGTT
TCGGTTTAGTTGATCTTGTATCGTTTGATCTGACTGGTATTAAGAGTTTCACCCGGTTTTGGGCTCTTCTGCTTTTC
GGATCATACTCCGTTATCAATATCATTGTCCTGCTCAACATGTTGATTGCCATGATGTCCAACAGTTACCAAATCAT
CTCTGAACGATCCGATACTGAATGGAAATTTGCTCGAAGTGACCTATGGATCAGTTACTTTGAGGATGGCGACACTG
TTCCTCCACCATTCAACCTATCACCATCTGTTAAATCTATGAAAAGAATGATGGGAATCAAAACTGGGAAAATCAGC
ACTGGTTCGATGAAGAACAAAAGTCGAGCTAAAGCTATGGAGCGTCACGAAGCAGTCATGAAACTATTGGTCAGGCG
ATATGTTGTGGCTGAGCAAAGGAAGAGAGATGAGTTCGGCATCACAGAAGATGATGTTATGGAAATTCGACAAGATA
TTTCAACCCTTCGTTTTGAACTGATCGATATCCTCCGAACAAACGGAATGAAGACACCGAGCGTGGACAAAGAGGAT
CAAGCAGTGGGCAAGAAAGGTCGTGTGATGGAGCGTCGTTTGCTGAAGGACTTCCAGATCGGCCTGGTTGAGGGTAT
AATTAGTGATGTCATATCTTCTGAGAAAGAGCCAAGGGATGTCTTCAGCAAGATTGCTCGTGCAATTGGTAAGGACT
CAAGTGCAAAGAAAAAGGACTGGAACGCTATTGCCGCCAAGAAAGCATCCAGCCGCGAACTTATTGGAAGCACCAGC
GAGGCTGTGGAGCGTCGGCAATCACGCCAGAGTTTGCGCCGGCACATCCTCGAACATCAAGGATCAGCAATGGCAAA
TATGGATCCCGAGAAGCTGGTTGAGTACAATCCCAAGTTGCAAGAATATGCACCTGCTGCTCGAATCGCCTATGCCA
AATTCAAGATCTCCAAGATCAAGCAAGAATATGACGATAAAGGAAATGAAGAAGAAGGCAAAGACGATGTTTTCGAG
CCTGCTACAGTAACAACGAAGGACGAAACAAAACCATCCCAAAGTGGCTCCATCGCACGGCCGAGACCCAAAAGCAC
CAAGAAACCACCCGCACCTGGAGCCATTCCAGGTCCCGACGATGGCAAGAAAGACTTCCGGTCGCGAACTCCGATCC
AAGAAGATCCAAGAGAGGCTGGCCGCACTCCAACGCCAGAACCAATCAAAATGCTCAAGACATCGATTTCCTCTCTC
AAGCAAGTATCAGTCGATCAAAAAGCTGGGCCATCAGACAAAAAACCCGCCGCCCCGGGGGCTCCGGCTCCGAAAGT
AGAGGTCACCGCAGCTAAATCACCTGCAAAAACAGAGGCAGCCCCGGCAAAACCTGAAGAAAAGAAGCCCACACCTG
CTAAACCAGAGGAAAAGAAGCCTGCCGCTGCTGCTGCTACGCCTAAAGCAGACGAAAAGAAGGACGAGAAGAAAGAA
GAAAAGAAGGACGAGAAGAAAGATGAGAAGAAAGAGGAAAAGAAAGACGATAAAAAGCCGGGCCCTGCTCCGAAAAA
ACCAGATGATAAGGATAAGCCTCCCTCGCCGAAGAAAACGATGATCCACACAAAACCTGGTGGTAAATCAACAGTCA
CCGGCGAAGTACTGACTGGATGGTTGTAAGTATTTCAAAAGAGTAACGTGTACTGGCTGCAAAAACTGATTAGTTTA
ATATTTCACTTCAGTGGTTTTTTTTAAACTAGCAAATTTTCTGTCTTAAAATTCTTTTTCAATTGGCAGAAACGGAG
TTCTTGCATGCGTGAGGGATTTGTGATTTAAGTATTTGTTCTTACATAAAAGTTCGCGAGCAACGAGTTGCGGTGCC
CCTGGTTTTCTCTGAAATCAACTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA。
Used invention further provides described hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED
In the application for preventing and treating Bemisia tabaci
The result that the present invention is obtained is effect of the clear and definite MED BtTrp genes in hidden kind of temperature sensing of Bemisia tabaci MED
Lay the foundation, also for the interaction between discussion MED BtTrp genes and heat shock protein gene is to insect temperature sensing and fits
Answering property provides theoretical foundation.
Brief description of the drawings
The dsRNA of Fig. 1 MED BtTrp genes handles the influence to hidden kind of adult heat resistance of Bemisia tabaci MED：Compare feeding
Hidden kind of death rate of Bemisia tabaci MED after MED BtTrp genes dsRNA, 10% sucrose solution 3h of feeding.All data are used
SPSS16.0 statistical softwares carry out data statistic analysis, and level of significance test is P<0.05.
Embodiment
Embodiment 1：Hidden kind of MED BtTrp full length genes cDNA sequence clone of Bemisia tabaci MED
1st, total serum IgE is extracted：
Take the adult 200 of the hidden kinds of Bemisia tabaci MED to be put into sterilized mill, add 1mL Trizol solution,
After grinding fully, it is added in 1.5mL centrifuge tube.Fully vibration is mixed, and room temperature places 5min；Add 0.2mL's after standing
Chloroform, fully vibration mix 15s, and room temperature places 5min, and 15min is centrifuged using high speed low temperature centrifugal machine 12000rpm；Take supernatant
Liquid adds isometric isopropanol in another centrifuge tube, rocks mixing, and room temperature places 10min.12000rpm is centrifuged at 4 DEG C
15min；Supernatant is abandoned, the ethanol 1mL of concentration 75% is added, 12000rpm centrifuges 10min at 4 DEG C；Supernatant is abandoned, and super
Net workbench places 5min, adds 50 μ L DEPC water, 5min makes RNA precipitate fully dissolve in 55-60 DEG C of water, and -80 DEG C surpass
Low temperature refrigerator is preserved with standby.
2nd, hidden kind of cDNA synthesis of Bemisia tabaci MED：
Using reverse transcription reagent box (the Super Script First-Strand Synthesis of Transgen companies
System) illustrate to carry out, it is specific as follows：
（1）Following reagent is sequentially added in 0.2mL PCR pipe：
（2）Above solution is gently mixed, 42 DEG C of incubations 30min, 85 DEG C of incubation 5min.Reaction is placed on -20 DEG C of ice after terminating
Case is saved backup.
3rd, PCR expands the intermediate segment of Bemisia tabaci hidden kind of MED BtTrp gene of MED：
（1）Design primer MED BtTrp-F and MED BtTrp-R：
MED BtTrp-F:5’-CGCACCATCCCTCATAGCC-3’；
MED BtTrp-R:5 '-GTCGGGTCCAAACCATTCG-3 ' give birth to work biotechnology by Shanghai and service limited public affairs
Department's synthesis.
（2）Using cDNA as template, PCR expands the intermediate segment of Bemisia tabaci hidden kind of MED BtTrp gene of MED：
Reaction system is 25 μ L：10 × PCR reaction buffer2.5 μ L, dNTP Mix (10mM) 0.5 μ L, Taq gather
The μ L of synthase (2.5U) 0.5, sense primer and each μ L of 1.0 μ L, cDNA template 0.5 of anti-sense primer (10 μM), sterilizing ddH2O19.0μ
L。
Reaction condition is：94℃5min;94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 35 circulations；72℃10min.
（3）PCR primer is purified：Utilize the EasyPureTM Quick Gel Extraction Kit of Transgen companies
Kit carries out PCR primer to cut glue purification.Specially：The Ago-Gel containing target DNA band is cut, 1.5mL is put into
Centrifuge tube is weighed；The GSB solution of 3 times of volumes is added, 6-10min, interruption mixing are bathed in 55 DEG C；Treat that blob of viscose melts completely, add
Appropriate sodium acetate, adjustment color is identical with GSB colors；The gel solution of thawing is down to after room temperature, is added in adsorption column and is stood
1min, 12000rpm centrifuge 1min, abandon efflux；650 μ L WB solution is added, 12000rpm centrifugation 1min abandon efflux；
12000rpm centrifuges 1min, removes residual WB；Adsorption column is placed in a clean centrifuge tube, standing of uncapping 1min makes residual
Ethanol volatilization it is clean, add 20 μ L deionized water in the center of post, be stored at room temperature 1min；12000rpm centrifuges 1min, washes
De- DNA, -20 DEG C of refrigerator preservations are put in by the DNA of elution.
（4）PCR primer connection, conversion and identification
Connection：Following reagent is added in 0.2mL centrifuge tube：The above-mentioned μ of 4 μ L, pEASY-T1 carrier of PCR purified products 1
L, is gently mixed, and reacts at room temperature 20min, and reaction is placed on ice after terminating.
Conversion：Connection product is added in the Transl-T1 competent cells that volume is 50 μ L, flicks mixing, ice bath
20min；42 DEG C of heat shock 30s, are immediately placed on 2min on ice；500 μ L LB liquid mediums are added, 200rmp, 37 DEG C of shaking tables are incubated
1h；Take 40 μ L X-gal（20mg/mL）With 8 μ L IPTG（500mM）, LB solid plate culture mediums are equably applied to after mixing
On, 37 DEG C of incubators place 30min；200 μ L bacterium solutions are taken to apply flat board, 37 DEG C of overnight incubations.
Identification：Picking white single bacterium falls within shaking table culture 10h in the LB fluid nutrient mediums containing Amp, and bacterium solution carries out bacterium colony
PCR.Bacterium colony PCR reaction systems are 10 μ L：2×EasyTaq SuperMix5μL、M13F upstream and downstreams primer (10 μM) each 1.0
The μ L of μ L, cDNA template 1.0, sterilizing ddH2O2.0μL。
Bacterium colony PCR reaction conditions are：94℃10min;94 DEG C of 30s, 55 DEG C of 30s, 72 DEG C of 1min, 30 circulations；72 DEG C,
10min。
Agarose gel electrophoresis detects bacterium colony PCR primer size, selects recombinant clone, serves the raw work biotechnology in sea
Services Co., Ltd is sequenced.
4th, hidden kind of MED BtTrp gene 5 ' RACE and 3 ' RACE of Bemisia tabaci MED is obtained
The intermediate segment sequence of the hidden kind of MED BtTrp gene of Bemisia tabaci MED obtained according to step 3, designs 5 ' RACE
With 3 ' RACE specific primers, PCR expands 5 ' and 3 ' terminal sequences of MED BtTrp genes：
5’RACE Outer Primer:5’-TTGGCGGCAATAGCGTTCCAGTCC-3’
5’RACE Inner Primer:5’-CTCTTTGTCCACGCTCGGTGTCTT-3’
3’RACE Outer Primer:5’-ACACCGAGCGTGGACAAAGAGGA-3’
3’RACE Outer Primer:5’-CTATTGCCGCCAAGAAAGCATCCAG-3’
Using SMARTerTM RACE cDNA Amplification Kit（Clonetch）Kit, and in strict accordance with
Kit specification is operated, and amplification obtains purpose band, and the sequence after cloning and sequencing is spelled using DNAMAN and GENtle softwares
Obtain TRP genes cDNA sequence total length, obtain MED BtTrp gene 3906bp sequences, the gene of gained has such as SEQ
Sequence shown in ID No.1.
ATGGGGAGGCCGACGGAGCGGGCCACCCGAGCCGGACAGTCTGTGCTTGCTTGTCGTTTTCGCCACGATGGAGTAAT
CCGTTCCATCCCAGTTTTGGGTAGTGCTCCATTTTTTGGATAACGCTTTTTCCCAGGTGCGAGGGGCAGGATGAAGC
CGACGGAATCGAAGGAGGACCTCCTGGGGTCGAAGGAGAACCTAAAAAATCCCCGAGAGTCCTTGCAGTCGACCGGC
GGCGAGGTTGCCCTCACCCAGATCGAGAAAAGGTTCCTCTTGCTCAGCGAAAGGGGAGATATCGCCTCGGTCAAAAG
GATAATCGCTGAGCACAAAGATCACCCAGAACTATTGAACATCAACTGCGTTGATCCTCTGAACAGGTCAGCACTCA
TCGCAGCGATCGAAAATGAAAATATAGAGTTAATAAGAGTCCTCCTCGAACTTGGGATTGAAGTCAAGGATGCTCTT
CTGCACGCAATTAAGGAAGAGTACGTTGAAGCTGTGGAGATTCTACTTGAATGGGAAGAAAAAATCCACAAACCTGG
GCAGCCTTATAGTTGGGAAGCTGTTGACGGGAGCTCTTCGACATTTACACCGGACATAACACCGCTCATATTGGCTG
CTCACATGAACAATTACGAAATCCTGAAAATTTTGTTGGATCGAGGCGCCACACTCCCCGCGCCACACGATGTTAGG
TGTGGCTGCGACGAATGTGTAACTTCAAGTGAGCAGGATTCTTTGCGACATTCACAAGCTCGGATCAACGCGTACAG
AGCTTTAACCGCACCATCCCTCATAGCCCTCTCTTCCAGGGATCCCCTCCTTACCGCCTTCGAGTTATCATGGGAGC
TGCGCAGACTCAGCAAGATGGAAGCGGAATTCCGCTCTGAATATAATGAAATGAGAGGTATTTGTCAGACATTTGCA
ACCTCCTTGCTAGACCACGCGCGAACCTCGTATGAACTGGAGGTGATGCTTAATCATAATCCTGATGGAGAGTCGTG
GGAACCAGGAGAGAGGCAAACTCTGGAGAGACTGAAGCTAGCTATCAAATACAAACAAAAAGCGTTTGTTGCTCATC
CAAATGTACAACAGCTGCTGGCAGCTATTTGGTATGATGGTCTCCCCGGATTTCGACGAAAAGGGATGATTGGTCAA
GCTTTTGAGTGTGGAAAGTTAGGTGCAATGTTTCCTGTCTACGCAACCGTGTATTTGACAGCGCCTGAATCGGAGAT
GGGCCAGTTCATGAAAAAACCCTTTGTAAAGTTCATCTGTAATTCAACCTCCTACGCTTTCTTCCTGATGTTATTGG
CCTTGGCATCACAAAGAGCGGAATTTCTTGCAATCGAATGGTTTGGACCCGACTGGATGAAAGAGATACTGAAAGAG
TGGACTCGAAAGGAAAGAGGATCAATACCTGGTCTCATAGAATCCTTTATTATTTTGTATATCATAAGTTTGATTTG
GGGTGAAATGAGAGCATTGTGGTCTGGTGGCTTAGAGGACTATGTTTCAGATTTGTGGAATATAGTGGATTTCATCA
CCAATGTATTCTATATGATATGGATTTGTCTCAGAGGAACTGCGTATATCATTGTGCAAAGAGAGCATAAAAGTGGC
CTCGATCCATGGTATCCTCGTGATAAGTGGGACATGTTTGATCCTCATCTTCTATCAGAAGGTGCGTTTGCAGCCAG
TATGATCTTCAGTTTCTTAAAATTGGTTCATATCTTCAGTATCAATCCTCATCTTGGTCCACTGCAAATTTCGTTGG
GACGAATGATTGTCGACATCATCAAATTTTTCTTCATCTACACATTGGTCCTTTTCGCTTATGGTTGTGGTATGAAT
CAGTTACTTTGGTACTATGCTGATCTTGAGAGGAAAAAGTGTTATCATCTGAACGAGGATTATGCTGATTTTGATGG
TCAAGATAAAGCCTGTACAACATGGAGACGTTTTGCAAATTTATTTGAAACATCTCAGTCTCTGTTCTGGGCCAGTT
TCGGTTTAGTTGATCTTGTATCGTTTGATCTGACTGGTATTAAGAGTTTCACCCGGTTTTGGGCTCTTCTGCTTTTC
GGATCATACTCCGTTATCAATATCATTGTCCTGCTCAACATGTTGATTGCCATGATGTCCAACAGTTACCAAATCAT
CTCTGAACGATCCGATACTGAATGGAAATTTGCTCGAAGTGACCTATGGATCAGTTACTTTGAGGATGGCGACACTG
TTCCTCCACCATTCAACCTATCACCATCTGTTAAATCTATGAAAAGAATGATGGGAATCAAAACTGGGAAAATCAGC
ACTGGTTCGATGAAGAACAAAAGTCGAGCTAAAGCTATGGAGCGTCACGAAGCAGTCATGAAACTATTGGTCAGGCG
ATATGTTGTGGCTGAGCAAAGGAAGAGAGATGAGTTCGGCATCACAGAAGATGATGTTATGGAAATTCGACAAGATA
TTTCAACCCTTCGTTTTGAACTGATCGATATCCTCCGAACAAACGGAATGAAGACACCGAGCGTGGACAAAGAGGAT
CAAGCAGTGGGCAAGAAAGGTCGTGTGATGGAGCGTCGTTTGCTGAAGGACTTCCAGATCGGCCTGGTTGAGGGTAT
AATTAGTGATGTCATATCTTCTGAGAAAGAGCCAAGGGATGTCTTCAGCAAGATTGCTCGTGCAATTGGTAAGGACT
CAAGTGCAAAGAAAAAGGACTGGAACGCTATTGCCGCCAAGAAAGCATCCAGCCGCGAACTTATTGGAAGCACCAGC
GAGGCTGTGGAGCGTCGGCAATCACGCCAGAGTTTGCGCCGGCACATCCTCGAACATCAAGGATCAGCAATGGCAAA
TATGGATCCCGAGAAGCTGGTTGAGTACAATCCCAAGTTGCAAGAATATGCACCTGCTGCTCGAATCGCCTATGCCA
AATTCAAGATCTCCAAGATCAAGCAAGAATATGACGATAAAGGAAATGAAGAAGAAGGCAAAGACGATGTTTTCGAG
CCTGCTACAGTAACAACGAAGGACGAAACAAAACCATCCCAAAGTGGCTCCATCGCACGGCCGAGACCCAAAAGCAC
CAAGAAACCACCCGCACCTGGAGCCATTCCAGGTCCCGACGATGGCAAGAAAGACTTCCGGTCGCGAACTCCGATCC
AAGAAGATCCAAGAGAGGCTGGCCGCACTCCAACGCCAGAACCAATCAAAATGCTCAAGACATCGATTTCCTCTCTC
AAGCAAGTATCAGTCGATCAAAAAGCTGGGCCATCAGACAAAAAACCCGCCGCCCCGGGGGCTCCGGCTCCGAAAGT
AGAGGTCACCGCAGCTAAATCACCTGCAAAAACAGAGGCAGCCCCGGCAAAACCTGAAGAAAAGAAGCCCACACCTG
CTAAACCAGAGGAAAAGAAGCCTGCCGCTGCTGCTGCTACGCCTAAAGCAGACGAAAAGAAGGACGAGAAGAAAGAA
GAAAAGAAGGACGAGAAGAAAGATGAGAAGAAAGAGGAAAAGAAAGACGATAAAAAGCCGGGCCCTGCTCCGAAAAA
ACCAGATGATAAGGATAAGCCTCCCTCGCCGAAGAAAACGATGATCCACACAAAACCTGGTGGTAAATCAACAGTCA
CCGGCGAAGTACTGACTGGATGGTTGTAAGTATTTCAAAAGAGTAACGTGTACTGGCTGCAAAAACTGATTAGTTTA
ATATTTCACTTCAGTGGTTTTTTTTAAACTAGCAAATTTTCTGTCTTAAAATTCTTTTTCAATTGGCAGAAACGGAG
TTCTTGCATGCGTGAGGGATTTGTGATTTAAGTATTTGTTCTTACATAAAAGTTCGCGAGCAACGAGTTGCGGTGCC
CCTGGTTTTCTCTGAAATCAACTCCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA。
Embodiment 2：The dsRNA of MED BtTrp genes handles the influence to hidden kind of heat resistance of Bemisia tabaci MED
1st, the preparation of dsRNA templates：
Plus T7 promoters（Sequence shown in underscore）Primer sequence afterwards：
T7+ MED BtTrp-F：
TAATACGACTCACTATAGGGAGACCACGAAGACACCGAGCGTGGACAAAG；
T7+MED BtTrp-F：
TAATACGACTCACTATAGGGAGACCACGGCAATAGCGTTCCAGTCCTTTT.Work bioengineering is given birth to by Shanghai
Technology Service Co., Ltd synthesizes.
Total RNAs extraction and cDNA synthesis：Be the same as Example 1.
T7 primer PCRs are expanded：
Reaction system is 50 μ L：10 × PCR buffer5.0 μ L, dNTPs1.0 μ L, cDNA template 1.0 μ L, Primer-
T7F2.0μL、Primer-T7R2.0μL、TransStart Taq DNA Polymerase1μL、ddH2O38.0μL。
Reaction condition：94℃5min；94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, 35 circulations；72℃10min.As a result examine
Survey：It is purpose band to confirm expanded band.
The PCR primer purifying of T7 primers amplification：
It is pure using Qiaquick PCR purification kit (Qiagen, Inc., Hilden, Germany) kit
Change PCR primer, operated according to kit specification.
PCR primer obtained by purifying is the template for synthesizing dsRNA.
2nd, dsRNA synthesis and purifying
UseRNAi Kit kits are synthesized and purifying dsRNA, are grasped according to kit specification
Make
3rd, dsRNA is fed
Parafilm films are in advance with DEPC water process to remove RNase.In the sucrose liquid that concentration is 10%（Sterilization treatment
DEPC ddH2O dissolving saccharoses）Middle addition dsRNA, concentration is 0.3~0.5 μ g/ μ L.According to this experiment demand, to Parafilm
Film presss from both sides nutrient solution method（Miles et al.,1965）It is correspondingly improved：Take the hidden kind of adult of Bemisia tabaci MED just sprouted wings about
200 put in the penetrating glass tube in people two ends（Diameter 3cm, high 8cm）, glass tube upper end is coated with two layers of Parafilm film and two
The 10% μ L of sucrose liquid 200~250 containing dsRNA are added in intermembranous space, glass tube lower end is coated with gauze to keep logical
Around gas, glass tube and lower end is wrapped with black plastic paper bag assembles beneficial to Bemisia tabaci to top Paraflim films, so that more preferably
Take food dsRNA mixed liquors.The glass tube handled well is put into growth cabinet（25 ± 0.2 DEG C of temperature, 24h illumination, relatively
Humidity is 60-70%）, feed 3 hours MED BtTrp genes dsRNA after, Bemisia tabaci is collected in finger-type pipe（Long 5cm, directly
Footpath 1.2cm）, it is put into the high temperature water bath of preheating（Microprocessor Control MPC Huber, Germany）Handle 1h, place
It is 45 DEG C to manage temperature.Adult after processing recovers 1h under 26 DEG C of normal temperature, counts survival rate.DsRNA and sterilizing are free of to feed
The Bemisia tabaci MED of 10% treated sucrose solution is hidden to plant as control, every group of 5 repetitions.Utilize SPSS16.0 statistical softwares
Hidden kind of survival rate of Bemisia tabaci MED after analysis feeding different solutions, as a result as shown in figure 1, feeding MED BtTrp genes dsRNA's
The survival rate of the hidden kinds of Bemisia tabaci MED is substantially less than feeding sucrose group and blank control group survival rate（P<0.001）；Simultaneously in NCBI
（http://blast.ncbi.nlm.nih.gov/）BLAST shows that the target sequence piece degree fed is the distinctive sequence of TRP genes
Row, thus ensure that interference effect produced by the purpose MEDBtTrp genes of the hidden kinds of Bemisia tabaci MED, therefore, explanation of the invention
MED BtTrp genes play key effect in hidden kind of high temperature stress of Bemisia tabaci MED and high temperature are perceived.
Claims (2)
1. hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED, it is characterised in that its nucleotide sequence is such as
Shown in SEQ ID No.1.
2. hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED described in claim 1 is used to prevent and treat Bemisia tabaci
Application.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410153314.5A CN103898121B (en) | 2014-04-16 | 2014-04-16 | Hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410153314.5A CN103898121B (en) | 2014-04-16 | 2014-04-16 | Hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED and its application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103898121A CN103898121A (en) | 2014-07-02 |
| CN103898121B true CN103898121B (en) | 2017-11-07 |
Family
ID=50989690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410153314.5A Active CN103898121B (en) | 2014-04-16 | 2014-04-16 | Hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103898121B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106086008B (en) * | 2016-06-10 | 2019-03-12 | 中国农业科学院植物保护研究所 | The CRISPR/cas9 system and its application of hidden kind of TRP gene of Bemisia tabaci MED |
| CN106047936B (en) * | 2016-06-12 | 2019-12-03 | 中国农业科学院植物保护研究所 | A method of obtaining hidden kind of BtTRP gene mutation system of stable Bemisia tabaci MED |
| CN106884007A (en) * | 2017-03-05 | 2017-06-23 | 中国农业科学院植物保护研究所 | Hidden kind of laccase LAC1 of Bemisia tabaci MED and its gene and application |
| CN111118172A (en) * | 2020-01-06 | 2020-05-08 | 中国农业科学院植物保护研究所 | Specific probe of aleyrodids Asiai II3 cryptophyte transient receptor ion channel gene and application thereof |
| CN111893101B (en) * | 2020-08-17 | 2022-03-25 | 中国农业科学院植物保护研究所 | Bemisia tabaci MED cryptic acetyltransferase gene mof, application thereof and method for reducing low-temperature tolerance of Bemisia tabaci |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103255222B (en) * | 2013-05-22 | 2014-10-22 | 青岛农业大学 | Primers and method for identifying greenhouse trialeurodes vaporariorum and bemisia tabaci by utilizing mitochondria SCAR (sequence characterized amplified regions) marker |
-
2014
- 2014-04-16 CN CN201410153314.5A patent/CN103898121B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103898121A (en) | 2014-07-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898121B (en) | Hidden kind of transient receptor ion channel gene MED BtTrp of Bemisia tabaci MED and its application | |
| Katiyar-Agarwal et al. | A novel class of bacteria-induced small RNAs in Arabidopsis | |
| Borsani et al. | Endogenous siRNAs derived from a pair of natural cis-antisense transcripts regulate salt tolerance in Arabidopsis | |
| Hilbricht et al. | Retrotransposons and siRNA have a role in the evolution of desiccation tolerance leading to resurrection of the plant Craterostigma plantagineum | |
| Yun et al. | The miR156b‐GmSPL9d module modulates nodulation by targeting multiple core nodulation genes in soybean | |
| CN102220343B (en) | Gene silencing technology-based lethal gene fragment Chitinase 7 of laodelphax striatellus and dsRNA (double-stranded RNA) thereof | |
| CN104178490A (en) | Cereal cyst nematode RNAi (ribonucleic acid interference) site sequence for biological control, and vector and application thereof | |
| CN107916264B (en) | dsRNA (double-stranded ribonucleic acid) of wing development related gene vestigial and application of dsRNA in controlling bactrocera dorsalis | |
| CN107267526B (en) | Radix Notoginseng myb transcription factor gene PnMYB2 and its application | |
| CN109957572A (en) | Bemisia tabaci lethal gene and its preparation method and application of application, rnai agent and rnai agent | |
| CN105420255B (en) | Brown tangerine aphid chitin synthetase gene and its dsRNA | |
| CN106916824A (en) | Citrus fruit fly Taiman genes and its variable sheer body detecting method and its dsRNA | |
| CN104861054B (en) | A kind of brown lice protein translation elongation factors NlEF1 γ, encoding proteins and its application | |
| CN109943570B (en) | Bemisia tabaci salivary ferritin gene BtFer1 and application thereof | |
| CN103898122A (en) | Transient receptor potential ion channel gene MEAM1 BtTrap of bemisia tabaci MEAM1 (Middle East Asia Minor1) cryptic species and application thereof | |
| CN105755020A (en) | Radix notoginseng mitogen-activated protein kinase kinase gene PnMAPKK1 and application thereof | |
| CN108823222A (en) | White backed planthopper chitin synthetase 1（SfCHS1）The application of genetic fragment and its dsRNA in control of insect | |
| CN117230065A (en) | dsRNA of aphid FKBP12 gene, and preparation method and application thereof | |
| CN103937819B (en) | A kind of lilium regale wilson glutathione S-transferase gene LrGSTL1 and application thereof | |
| CN114015716B (en) | Virus-induced gene silencing mediated quinoa gene function verification method | |
| CN108949769B (en) | Cotton bollworm ecdysone regulatory factor E78-C gene cDNA and application thereof | |
| CN106884007A (en) | Hidden kind of laccase LAC1 of Bemisia tabaci MED and its gene and application | |
| CN106367428A (en) | Lygus lucorum V-ATPase-D gene cDNA and application thereof | |
| CN105400794A (en) | Gene bHLH93 for synthesizing related transcription factors through tobacco sterol and application | |
| CN105441575B (en) | Method for verifying gene function of brown orange aphid |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |