CN103834686B - High-efficient cloning screening expression vector, Preparation Method And The Use - Google Patents
High-efficient cloning screening expression vector, Preparation Method And The Use Download PDFInfo
- Publication number
- CN103834686B CN103834686B CN201210483844.7A CN201210483844A CN103834686B CN 103834686 B CN103834686 B CN 103834686B CN 201210483844 A CN201210483844 A CN 201210483844A CN 103834686 B CN103834686 B CN 103834686B
- Authority
- CN
- China
- Prior art keywords
- expression vector
- carrier
- sequence
- itr5
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of high-efficient cloning screening expression vector, this carrier is inserted in mammalian expression vector and is obtained by the ITRs sequence of piggyBac transposon system. The invention also discloses the preparation method and its usage of above-mentioned carrier. The present invention utilizes the ITRs sequence construct high-efficient cloning screening expression vector of piggyBac transposon system, codon is optimized simultaneously can be in mouse the transcriptase Gene cloning of high efficient expression to another one carrier for expression of eukaryon, by containing the expression vector of ITRs sequence with containing the coexpression of the carrier of transcriptase, selection markers and genes of interest are together incorporated in the genome of host cell, thereby have greatly improved the efficiency of transfection and the screening rate of positive colony.
Description
Technical field
The present invention relates to field of biology, particularly relate to the efficient of a kind of ITRs sequence construct with piggyBac transposon systemColony screening expression vector, construction method of this carrier and uses thereof.
Background technology
Transposons is one section of DNA sequence dna movably in genome, can be by a series of processes such as cutting, reintegrate from baseBecause arriving another position in a position " jump " of group. Transposons account for the more than 40% of people and mouse genome sequence (Nature,2001,409,860–921；Nature,2002,420,520–562）。
(Proc.Natl.Acad.Sci.1950, USA since McClintock finds first transposons from corn36,344 – 345), transposable element has become a lot of biological valuable genetic analysis instruments. In prokaryotes, utilize transposonsThe mutation research carrying out found harmful microorganism cause a disease time play an important role gene (Science, 1999,286,2165 – 2169; J.Virol.2003,77,123 – 134). In eucaryote, use the P factor (a kind of transposons)Transgenosis and insertion mutation technology greatly promoted the development of Drosophila genetics. Many transposons including the P factor are at itIn organism beyond natural host, there is no activity, illustrate that swivel base process relates to some host's factor (Arch.InsectBiochem.Physiol.1993,22,373 – 384). Tc1/Mariner family has been applied to mouse and spot at interior several transposon systemsHorse fish. A kind of artificial synthetic Tc1 class transposons SleepingBeauty (SB) of comparison system auxology means that utilizes is demonstrate,provedBright have activity (Cell1997,91 a, 501-510 in mouse and people's cell; Proc.Natl.Acad.Sci.1998,USA95,10769 – 10773). Although the transposons such as SB and Minos has carried out insertion mutation test in Mice Body,But because new insertion point concentrates on around original site, swivel base inefficiency and carry the reasons such as DNA limited length, theseTransposons is not widely used (Genomics2003,81,108-111; Mol.Cell.Biol.2003,23,9189-9207）。
The PB factor is a kind of DNA transposons deriving from moth wild cabbage looper, 2472 bases of total length. Its two ends contains 13The inverted terminal repeat (ITR) of individual base, and 594 the amino acid whose transposases of encoding. PB is successfully usedIn the genetic analysis of Drosophila melanogaster and other insect. It inserts four base TTAA sites specifically, and forms in insertion point both sidesTTAA repeats (Virology1989,172,156 – 169; Virology1995,211,397 – 407; InsectMol.Biol.1996,5,141 – 151). Due to its distinctive transposase and TTAA target sequence, PB becomes a new DNAThe representative (InMobileDNAII, 2002, pp.1093 – 1110) of transposons family---piggyBac family. PB doesFor system genitale transgenosis instrument be applied to four objects more than ten plant insect (InsectBiochem.Mol.Biol.2003,33,449 – 458). As mutagens, the swivel base efficiency of PB in Drosophila melanogaster at least with the P factor quite (Nat.Genet.2004,36,283 – 287). In red flour beetle Triboliumcastaneum, PB also can efficiently turn between nonhomologous chromosomeSeat (InsectMol.Biol.2003,12,433 – 440). Mould is different to many Phylogenetics such as mammalsIn species gene group, all find that there is the sequence of a lot of similar PB, further indicated that the activity of PB may and not only be confined to insectIn (Mol.Genet.Genomics, 2003,270,173 – 180). In fact, recent findings PB also can be at turbellarian worm GirardiaIn tigrina, mammal and cell thereof, there is efficient transposition activity, in Animal genome functional study, transgenosis andThe fields such as induced multi-potent stem cells be widely applied (Proc.Natl.Acad.Sci.2003, USA100,14046–14051）。
Although PB system has host's property widely, and efficient transfection efficiency, and extensive in mammalian cellFor gene therapy (MolecularTherapy, 2007,15,139-145), but it is also studied and did not have in vitro at presentRelevant report.
Summary of the invention
One of the technical problem to be solved in the present invention is to provide a kind of high-efficient cloning screening expression vector, and it can improve transfection greatlyThe screening rate of efficiency and positive colony.
For solving the problems of the technologies described above, high-efficient cloning screening expression vector of the present invention, by the ITRs of piggyBac transposon systemSequence is inserted in mammalian expression vector and obtains.
Two of the technical problem to be solved in the present invention is to provide the preparation method of above-mentioned high-efficient cloning screening expression vector.
For solving the problems of the technologies described above, the preparation method of high-efficient cloning screening expression vector of the present invention, comprises the following steps:
1) taking pGH as cloning vector, the synthetic 5 ' ITR of full gene and 3 ' ITRDNA fragment, two of fragment adds EcoRVRestriction enzyme site, obtain carrier pGH-ITR5 and pGH-ITR3;
2) taking pGH as cloning vector, the transcriptase genetic fragment that the synthetic GeneBank sequence number of full gene is EF587698, andTwo of fragment adds respectively the restriction enzyme site of EcoRI and HindIII, obtains carrier pGH-Transposase;
3) cut carrier pGH-ITR5 and pGH-ITR3 with EcoRV enzyme, EcoRI and HindIII enzyme are cut carrierpGH-Transposase；
4) NruI enzyme is cut mammalian expression vector, and EcoRI and HindIII enzyme are cut expression vector pTriEx2 simultaneously;
5) fragment ITR5 is connected to the mammalian expression vector of cutting through NruI enzyme, obtains carrying containing the expression of ITR5 fragmentBody;
6) fragment Transposase is connected to the expression vector pTriEx2 cutting through EcoRI and HindIII enzyme simultaneously,To new expression vector pTriEx2-Transposase;
7) Bstz17I enzyme is cut the expression vector containing ITR5 fragment that step 5) obtains;
8) fragment ITR3 is connected to the expression vector that step 7) obtains.
Three of the technical problem to be solved in the present invention be to provide above-mentioned high-efficient cloning screening expression vector at transfection mammalian cell andThe application in destination protein clone is expressed in screening.
The ITRs sequence construct high-efficient cloning screening expression vector of piggyBac transposon system for the present invention, simultaneously will be through passwordWhat son was optimized can be in mouse the transcriptase Gene cloning of high efficient expression to another one carrier for expression of eukaryon, by containing ITRs orderThe expression vector of row and containing the coexpression of the carrier of transcriptase, is together incorporated into selection markers and genes of interest the base of host cellIn group, thereby the efficiency of transfection and the screening rate of positive colony are greatly improved, also for building surely turning of multiple subunit coexpressionsClone provides possibility, for the function of Study of Exogenous gene in mammalian cell provides favourable condition.
Brief description of the drawings
Fig. 1 is the structural representation of expression vector pcDNA3.1 (+)-ITRs.
Fig. 2 is the structural representation of expression vector pcDNA4/TO-ITRs.
Detailed description of the invention
Understand for technology contents of the present invention, feature and effect being had more specifically, existing in conjunction with illustrated embodiment, describe in detail asUnder:
The preparation of embodiment 1pcDNA3.1 (+)-ITRs carrier
The structure of pcDNA3.1 (+)-ITRs expression vector as shown in Figure 1, taking pcDNA3.1 (+) as carrier, according to DNA sequence dnaCorrect direction (see figure 1) is inserted into ITRs sequence on carrier, obtains the carrier for expression of eukaryon containing ITRs sequencePcDNA3.1 (+)-ITRs. This expression vector pcDNA3.1 (+)-ITRs can carry mammalian promoter in the time of swivel base(CMV) genes of interest that, MCS (MCS) is located and screening-gene (Neomycin) are incorporated into host cell togetherIn genome.
Concrete preparation method is as follows:
(1), from commercial pXL-BacII plasmid vector, find out the concrete sequence of its 5 ' ITR and 3 ' ITR; From reportingIn the document (NucleicAcidsResearch, 2007,35, e87) in road, find codon optimize can be in mouseTranscriptase (Transposase) gene order (GeneBank sequence number: EF587698) of high efficient expression. Wherein,
5 ' ITR sequence (SEQIDNo:1) is:
TATAACAAGAAAATATATATATAATAAGTTATCACGTAAGTAGAACATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAATCATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTGACACTTACCGCATTGACAAGCACGCCTCACGGGAGCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGATTCGCGCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAATCTAGCTGCATCAGGATCATATCGTCGGGTCTTTTTTCCGGCTCAGTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGCCCGTGCCTTTTCCCGCGAGGTTGAAGCGGCATGGAAAGAGTTTGC
3 ' ITR sequence (SEQIDNo:2) is:
TAAAACGACGGCCAGTGAGCGCGCCTCGTTCATTCACGTTTTTGAACCCGTGGAGGACGGGCAGACTCGCGGTGCAAATGTGTTTTACAGCGTGATGGAGCAGATGAAGATGCTCGACACGCTGCAGAACACGCAGCTAGATTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATGTGTTTTATCGGTCTGTATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTATTATATTTACACTTACATACTAATAATAAATTCAACAAACAATTTATTTATGTTTATTTATTTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAACAAAACTTTTATCGATATCGTC
(2) taking pGH as cloning vector, synthetic required inverted terminal repeat 5 ' ITR and 3 ' the ITRDNA sheet of full geneSection, and two of fragment all adds the restriction enzyme site (GATATC) of EcoRV, obtains respectively carrier pGH-ITR5 and pGH-ITR3.
Meanwhile, taking pGH as cloning vector, the synthetic required transcriptase genetic fragment of full gene, and two of fragment adds respectivelyEcoRI(5 ' GAATTC) and HindIII(3 ' AAGCTT) restriction enzyme site, obtain carrier pGH-Transposase.
(3) cut carrier pGH-ITR5 and pGH-ITR3 with EcoRV enzyme, EcoRI and HindIII enzyme are cut carrierpGH-Transposase。
(4) NruI enzyme is cut expression vector pcDNA3.1 (+), and EcoRI and HindIII enzyme are cut expression vector pTriEx2 simultaneously.
(5) fragment ITR5 is connected to the expression vector pcDNA3.1 (+) cutting through NruI enzyme, obtains new expression vectorITR5-pcDNA3.1(+)。
(6) fragment Transposase is connected to the expression vector pTriEx2 cutting through EcoRI and HindIII enzyme simultaneously,Obtain new expression vector pTriEx2-Transposase.
(7) Bstz17I enzyme is cut expression vector ITR5-pcDNA3.1 (+).
(8) fragment ITR3 is connected to the expression vector ITR5-pcDNA3.1 (+) cutting through Bstz17I enzyme, obtains new supportITR5-pcDNA3.1(+)-ITR3。
The sequence (SEQIDNo:3) of carrier ITR5-pcDNA3.1 (+)-ITR3 is:
GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGATCTATAACAAGAAAATATATATATAAT AAGTTATCACGTAAGTAGAACATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAAT CATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTGACACTTACCGCATTGACAAGCACGCCTCACGGGA GCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGATTCGCGCTATTTAGAAAGAGAGAGCAATATTTCAAGA ATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAATCTAGCTGCATCAGGATCATATCGTCGGGTCTTTTTTC CGGCTCAGTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGCCCGTGCCTTTTCCCGCGAGGTTGAAGC GGCATGGAAAGAGTTTGCGATCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACG GGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACTAGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGACCCAAGCTGGCTAGCGTTTAAACTTAAGCTTGGTACCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGGATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCA TGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGCCTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGACCAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTAATCGATAAAAGTTTTGTTACTTTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATAAATAAACA TAAATAAATTGTTTGTTGAATTTATTATTAGTATGTAAGTGTAAATATAATAAAACTTAATATCTATTCAAATTAATAAA TAAACCTCGATATACAGACCGATAAAACACATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATT ATCTTTCTAGGGTTAATCTAGCTGCGTGTTCTGCAGCGTGTCGAGCATCTTCATCTGCTCCATCACGCTGTAAAACACAT TTGCACCGCGAGTCTGCCCGTCCTCCACGGGTTCAAAAACGTGAATGAACGAGGCGCGCTCACTGGCCGTCGTTTTAGATTACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATC TTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
The preparation of embodiment 2pcDNA4/TO-ITRs carrier
The construction method of pcDNA4/TO-ITRs carrier as shown in Figure 2, taking pcDNA4/TO as carrier, according to DNA sequence dna justTrue direction (see figure 2) is inserted into ITRs sequence on carrier, obtains the carrier for expression of eukaryon containing ITRs sequencePcDNA4/TO-ITRs. This expression vector pcDNA4/TO-ITRs in the time of swivel base, can carry mammalian promoter (CMV),The genes of interest that MCS (MCS) is located and screening-gene (Zeocin) are incorporated in the genome of host cell together.
Concrete preparation method is as follows:
(1)～(3) are with embodiment 1.
(4) NruI enzyme is cut expression vector pcDNA4/TO, and EcoRI and HindIII enzyme are cut expression vector pTriEx2 simultaneously.
(5) fragment ITR5 is connected to the expression vector pcDNA4/TO cutting through NruI enzyme, obtains new expression vector ITR5-pcDNA4/TO。
(6) fragment Transposase is connected to the expression vector pTriEx2 cutting through EcoRI and HindIII enzyme simultaneously,Obtain new expression vector pTriEx2-Transposase.
(7) Bstz17I enzyme is cut expression vector ITR5-pcDNA4/TO.
(8) fragment ITR3 is connected to the expression vector ITR5-pcDNA4/TO cutting through Bstz17I enzyme, obtains new supportITR5-pcDNA4/TO-ITR3。
The sequence (SEQIDNo:4) of carrier ITR5-pcDNA4/TO-ITR3 is:
GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTGAGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTGCATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGATCTATAACAAGAAAATATATATATAAT AAGTTATCACGTAAGTAGAACATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGTAAAAGATAAT CATGCGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTGACACTTACCGCATTGACAAGCACGCCTCACGGGA GCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGATTCGCGCTATTTAGAAAGAGAGAGCAATATTTCAAGA ATGCATGCGTCAATTTTACGCAGACTATCTTTCTAGGGTTAATCTAGCTGCATCAGGATCATATCGTCGGGTCTTTTTTC CGGCTCAGTCATCGCCCAAGCTGGCGCTATCTGGGCATCGGGGAGGAAGAAGCCCGTGCCTTTTCCCGCGAGGTTGAAGC GGCATGGAAAGAGTTTGCGATCGATGTACGGGCCAGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTACCATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGAACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCCCTATCAGTGATAGAGATCTCCCTATCAGTGATAGAGATCGTCGACGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGGACTCTAGCGTTTAAACTTAAGCTTGGTA CCGAGCTCGGATCCACTAGTCCAGTGTGGTGGAATTCTGCAGATATCCAGCACAGTGGCGGCCGCTCGAGTCTAGAGGGCCCGTTTAAACCCGCTGATCAGCCTCGACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTTGACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCATCGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACAGCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGCTCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAGCACGTGTTGACAATTAATCATCGGCATAGTATATCGGCATAGTATAATACGACAAGGTGAGGAACTAAACCATGGCCAAGTTGACCAGTGCCGTTCCGGTGCTCACCGCGCGCGACGTCGCCGGAGCGGTCGAGTTCTGGACCGACCGGCTCGGGTTCTCCCGGGACTTCGTGGAGGACGACTTCGCCGGTGTGGTCCGGGACGACGTGACCCTGTTCATCAGCGCGGTCCAGGACCAGGTGGTGCCGGACAACACCCTGGCCTGGGTGTGGGTGCGCGGCCTGGACGAGCTGTACGCCGAGTGGTCGGAGGTCGTGTCCACGAACTTCCGGGACGCCTCCGGGCCGGCCATGACCGAGATCGGCGAGCAGCCGTGGGGGCGGGAGTTCGCCCTGCGCGACCCGGCCGGCAACTGCGTGCACTTCGTGGCCGAGGAGCAGGACTGACACGTGCTACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTCATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTAATCGATAAAAGTTTTGTTACT TTATAGAAGAAATTTTGAGTTTTTGTTTTTTTTTAATAAATAAATAAACATAAATAAATTGTTTGTTGAATTTATTATTA GTATGTAAGTGTAAATATAATAAAACTTAATATCTATTCAAATTAATAAATAAACCTCGATATACAGACCGATAAAACAC ATGCGTCAATTTTACGCATGATTATCTTTAACGTACGTCACAATATGATTATCTTTCTAGGGTTAATCTAGCTGCGTGTT CTGCAGCGTGTCGAGCATCTTCATCTGCTCCATCACGCTGTAAAACACATTTGCACCGCGAGTCTGCCCGTCCTCCACGG GTTCAAAAACGTGAATGAACGAGGCGCGCTCACTGGCCGTCGTTTTAGATTACCGTCGACCTCTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTG TCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTC
The application of embodiment 3pcDNA3.1 (+)-ITRs carrier in Hela cell
1. experimental technique:
(1) recovery Hela(human cervical carcinoma cell) cell, for transfection, culture medium is: RM1640+10% hyclone+1%Streptococcus (PenStrep).
(2) transfection the previous day, with the quantity in 4 × 105/ holes, Hela cell kind is entered to six orifice plates. Be 80%-90% in cell coverage rateTime, change into without any antibiotic culture medium.
(3) prepare two 1.5mlEP pipe (3810 type microcentrifugal tubes), add respectively following two kinds of combinationsPlasmid:
Combination 1:2 μ gpcDNA3.1 (+)-EGFP
Combination 2:1.5 μ gpcDNA3.1 (+)-ITRs-EGFP and 0.5 μ g transcriptase
Use respectively again OPTI-MEM culture medium polishing to 100 μ l volume.
(4) in above-mentioned two EP pipes, carefully add 5 μ lFugeneHD transfection reagents respectively, mix with the careful piping and druming of rifle head,Room temperature leaves standstill 15 minutes.
(5) mixed solution is dropwise joined in six orifice plates that have been covered with cell equably, mix gently. 37 DEG C of baking ovens are cultivated.
(6) after transfection 48 hours, with 6 × 103Cell is laid on 96 orifice plates that black wall is transparent by the quantity in/hole, each combination fourIndividual multiple hole, remaining cell is layered in 6cm culture dish again by identical quantity, and adding final concentration is 400 μ g/mlG418 sievesChoosing.
(7) next day, after transfection 72 hours, carry out ArrayScan(array scanning), detect the signal value of its fluorescence.
(8) screening is after 2 days, with 6 × 103Cell is laid on 96 orifice plates that black wall is transparent by the quantity in/hole, and four of each combinations are multipleHole, carries out ArrayScan detection, and remaining cell is layered on 6cm training again in initial cell is identical separately ratio (70%)Support in ware, adding final concentration is 400 μ g/mlG418 screenings.
(9) screen after 6 days, after 11 days, carry out same processing according to step (8) respectively.
2. experimental result:
Experimental result is as shown in table 1, as can be seen from Table 1, along with the increase of screening number of days, the cell number of combination in 1 byDecrescence few, arrive screening latter 11 days time, the number of cell reaches minimum, is 3.1E+05, the number of this and cellular control unit(1.8E+05) suitable; And the cell number combining in 2 presents the trend increasing progressively, the cell number while screening latter 11 days reachesTo maximum, be 5.7E+06, be 18 times of combination 1 cell number, be 32 times of cellular control unit number.
The quantity of different time cell after table 1 transfection
3. conclusion:
Can find out cell (combination 2) the Green fluorescin that contains PB swivel base sequence (ITRs) carrier by this experiment(GFP) expression rate and the survival rate of cell (as table 1) are significantly higher than the cell of transfection without transformation carrier, show this yearPhysical efficiency improves the screening rate of positive colony greatly, and this system has also successfully built monogenic ionophorous protein TRPV3 simultaneouslyWith the calcium channel PROTEIN C av1.2 of three subunit coexpressions surely turn clone, specific experiment scheme is not just repeating here.
Claims (3)
1. a high-efficient cloning screening expression vector, is characterized in that, this carrier is by the ITRs sequence of piggyBac transposon systemBe inserted in mammalian expression vector and obtain, described mammalian expression vector is pcDNA3.1 (+) or pcDNA4/TO, described inITRs sequence is inserted into the carrier obtaining in described pcDNA3.1 (+) carrier and has the sequence as shown in SEQIDNo:3, described inITRs sequence is inserted into the carrier obtaining in described pcDNA4/TO carrier and has the sequence as shown in SEQIDNo:4.
2. the preparation method of carrier described in claim 1, is characterized in that, comprises the following steps:
1) taking pGH as cloning vector, the synthetic 5 ' ITR of full gene and 3 ' ITRDNA fragment, two of fragment adds EcoRVRestriction enzyme site, obtain carrier pGH-ITR5 and pGH-ITR3; The sequence of described 5 ' ITR as shown in SEQIDNo:1, instituteState the sequence of 3 ' ITR as shown in SEQIDNo:2;
2) cut carrier pGH-ITR5 and pGH-ITR3 with EcoRV enzyme;
3) NruI enzyme is cut mammalian expression vector;
4) fragment ITR5 is connected to the mammalian expression vector of cutting through NruI enzyme, obtains carrying containing the expression of ITR5 fragmentBody;
5) Bstz17I enzyme is cut step 4) obtain containing the expression vector of ITR5 fragment;
6) fragment ITR3 is connected to step 5) expression vector that obtains.
3. method according to claim 2, is characterized in that, described mammalian expression vector comprises pcDNA3.1 (+)Or pcDNA4/TO.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210483844.7A CN103834686B (en) | 2012-11-23 | 2012-11-23 | High-efficient cloning screening expression vector, Preparation Method And The Use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201210483844.7A CN103834686B (en) | 2012-11-23 | 2012-11-23 | High-efficient cloning screening expression vector, Preparation Method And The Use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103834686A CN103834686A (en) | 2014-06-04 |
| CN103834686B true CN103834686B (en) | 2016-05-25 |
Family
ID=50798581
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210483844.7A Active CN103834686B (en) | 2012-11-23 | 2012-11-23 | High-efficient cloning screening expression vector, Preparation Method And The Use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103834686B (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11299748B2 (en) * | 2016-03-25 | 2022-04-12 | GenomeFrontier Therapeutics, Inc. | Kit for constructing transposon and use thereof |
| CN106480081A (en) * | 2016-09-22 | 2017-03-08 | 苏州泓迅生物科技有限公司 | A kind of CRISPRi carrier of single pUC pUC and preparation method thereof |
| CN106755096A (en) * | 2016-12-20 | 2017-05-31 | 上海药明生物技术有限公司 | The method for obtaining the stable cell mass of expression target protein in Chinese hamster ovary celI using piggyBac transposon |
| WO2020034097A1 (en) | 2018-08-14 | 2020-02-20 | Wuxi Biologics (Shanghai) Co., Ltd. | Transcriptional regulatory element and its use in enhancing the expression of exogenous protein |
| CN109628488A (en) * | 2018-12-28 | 2019-04-16 | 赛业（苏州）生物科技有限公司 | The method for constructing gene overexpression based on piggyBAC system or interfering stable cell strain |
| CN111471714A (en) * | 2020-05-07 | 2020-07-31 | 西南大学 | Eukaryotic transgenic cell line mediated by Minos transposon system and construction method |
| CN116144705B (en) * | 2022-12-28 | 2024-01-30 | 昭衍（苏州）新药研究中心有限公司 | Method for efficiently preparing voltage-dependent calcium ion channel cell model |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1362520A (en) * | 2001-01-02 | 2002-08-07 | 成都天友发展有限公司 | Constitution process of blank expression system for transferring spider's dragline protein gene into Bombyx mori |
-
2012
- 2012-11-23 CN CN201210483844.7A patent/CN103834686B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1362520A (en) * | 2001-01-02 | 2002-08-07 | 成都天友发展有限公司 | Constitution process of blank expression system for transferring spider's dragline protein gene into Bombyx mori |
Non-Patent Citations (3)
| Title |
|---|
| piggyBac共转染系统的构建以及转座活性的验证;缪辉，等;《四川大学学报（自然科学版）》;20110731;第48卷(第4期);摘要，第944－947页 * |
| piggyBac转座子及其转基因昆虫的应用;唐丽莉，等;《安徽农业科学》;20100228;第38卷(第6期);2809－2811 * |
| 哺乳动物转基因载体——piggyBac转座子;宋利军，等;《畜牧与兽医》;20120531;第44卷(第5期);92－95 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103834686A (en) | 2014-06-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103834686B (en) | High-efficient cloning screening expression vector, Preparation Method And The Use | |
| US20200291395A1 (en) | Novel crispr-associated transposon systems and components | |
| ES2629509T3 (en) | Site Specific Integration | |
| CN108342480A (en) | A kind of genetic mutation detection Quality Control object and preparation method thereof | |
| CN107502608A (en) | Construction method and application for sgRNA, ALDH2 gene delection cell line for knocking out people's ALDH2 genes | |
| CN106893739A (en) | For the new method and system of target gene operation | |
| US20230407281A1 (en) | Novel crispr-associated systems and components | |
| US20200370035A1 (en) | Methods for in vitro site-directed mutagenesis using gene editing technologies | |
| US11795442B2 (en) | CRISPR DNA targeting enzymes and systems | |
| AU2020248911B2 (en) | Method for identifying functional elements | |
| CN110343724A (en) | Method for screening and identifying functional lncRNA | |
| WO2019046636A1 (en) | Double selection hdr crispr-based editing | |
| US20220315913A1 (en) | Novel crispr dna targeting enzymes and systems | |
| US20070243616A1 (en) | In vivo alteration of cellular dna | |
| CN109735501A (en) | The N2a cell line and its construction method and kit of knockout zDHHC17 gene | |
| CN105695509B (en) | Method for obtaining high-purity myocardial cells | |
| WO2023050158A1 (en) | Method for achieving multi-base editing | |
| CN111748848B (en) | Method for identifying functional elements | |
| CN102533741B (en) | Swine pseudo attp site and use of swine pseudo attp site | |
| Weber et al. | Precise and Scarless Insertion of Transposable Elements by Cas9-Mediated Genome Engineering | |
| CN118109464A (en) | Downstream regulatory element of lily bulbil formation transcription factor LlWOX11 | |
| CN103849640A (en) | Method for carrying out point mutations on essential genes on escherichia coli by using co-transformation of oligonucleotide and eliminable plasmids | |
| Campbell et al. | DNA technology and genomics | |
| CN113234759A (en) | Preparation method of NAMPT gene modified human umbilical cord mesenchymal stem cell exosome | |
| Chaudhury et al. | Use of the pBUTR Reporter System for Scalable Analysis of 3′ UTR-Mediated Gene Regulation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB02 | Change of applicant information |
Address after: 200131 Shanghai City, Pudong New Area Waigaoqiao Free Trade Zone Foote Road No. 288 Building No. 1 Applicant after: Wuxi AppTec Co.,Ltd. Applicant after: Suzhou Wuming Kant New Drug Development Co.,Ltd. Address before: 200131 Shanghai City, Pudong New Area Waigaoqiao Free Trade Zone Foote Road No. 288 Building No. 1 Applicant before: Wuxi AppTec Co.,Ltd. Applicant before: WUXI APPTEC (SUZHOU) CO.,LTD. |
|
| ASS | Succession or assignment of patent right |
Owner name: WUXI APPTEC CO.,LTD. Free format text: FORMER OWNER: SHANGHAI YAOMING KANGDE NEW MEDICINE DEVELOPMENT CO., LTD. Effective date: 20150112 Free format text: FORMER OWNER: SUZHOU YAOMING KANGDE NEW DRUG DEVELOPMENT CO., LTD. WUXI APPTEC CO.,LTD. Effective date: 20150112 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| COR | Change of bibliographic data |
Free format text: CORRECT: ADDRESS; FROM: 200131 PUDONG NEW AREA, SHANGHAI TO: 214092 WUXI, JIANGSU PROVINCE |
|
| TA01 | Transfer of patent application right |
Effective date of registration: 20150112 Address after: 214092, Wuxi, Jiangsu province Binhu District Ma Shan Mei Liang West Road, No. 88 Applicant after: WUXI APPTEC CO.,LTD. Address before: 200131 Shanghai City, Pudong New Area Waigaoqiao Free Trade Zone Foote Road No. 288 Building No. 1 Applicant before: Wuxi AppTec Co.,Ltd. Applicant before: Suzhou Wuming Kant New Drug Development Co.,Ltd. Applicant before: Wuxi AppTec Co.,Ltd. |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| CB02 | Change of applicant information |
Address after: 214092, Wuxi, Jiangsu province Binhu District Ma Shan Mei Liang West Road, No. 88 Applicant after: WUXI APPTEC BIOTECHNOLOGY CO.,LTD. Address before: 214092, Wuxi, Jiangsu province Binhu District Ma Shan Mei Liang West Road, No. 88 Applicant before: WUXI APPTEC CO.,LTD. |
|
| COR | Change of bibliographic data | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20150922 Address after: 200131 Shanghai city Chinese (Shanghai) free trade zone 2 Huajing Road No. 7 room 701 Applicant after: WUXI BIOLOGICS (SHANGHAI) Co.,Ltd. Address before: 214092, Wuxi, Jiangsu province Binhu District Ma Shan Mei Liang West Road, No. 88 Applicant before: WUXI APPTEC BIOTECHNOLOGY CO.,LTD. |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |