CN103849640A - Method for carrying out point mutations on essential genes on escherichia coli by using co-transformation of oligonucleotide and eliminable plasmids - Google Patents

Abstract

The invention relates to a method for carrying out point mutations on essential genes on escherichia coli genomes by using the co-transformation of oligonucleotide and eliminable plasmids. Specifically, front four basic groups express recombinase in escherichia coli by using the co-transformation of oligonucleotide connected by sulfur phosphoryl, with a length of 91 basic groups, and having a mutation site in the middle, and eliminable plasmids. The eliminable plasmids contain homologous sequences of 50 bp lacZ genes, ampicillin resistance genes, I-SceI genes, two I-SceI cleavage sites and R6K replicators. In strains which are integrated with a 50 bp lacZ homologous fragment of a genome due to the catalysis of recombinase so as to express the amicillin resistance, the strains with point mutations are screened. Integrated strains can be induced to express I-SceI under the action of chlortetracycline subjected to heat inactivation, the I-SceI acts on cleavage sites thereof, and through the homologous recombination of two 50 bp lacZ fragments, the eliminable plasmids are eliminated.

Description

A kind of oligonucleotide and can eliminate the method for plasmid cotransformation for the point mutation of intestinal bacteria indispensable gene

Technical field

The present invention relates to genetically engineered field, specifically relate to a kind of method of utilizing oligonucleotide and eliminable plasmid cotransformation to realize the point mutation of intestinal bacteria indispensable gene.

Background technology

Intestinal bacteria are the most thorough of research, are also the microorganism strains with important biomolecule purposes and industrial practice purposes.Indispensable gene refers to the organism necessary genoid of surviving.The point mutation of the indispensable gene on genome of E.coli is research gene function, changes the catalytic characteristics of the expressed enzyme of gene and build the important means of new engineering strain.

The method of classical indispensable gene point mutation is first to build a recombinant clone containing point mutation fragment, and both sides, mutational site are containing the homologous fragment that is useful on homologous recombination.The carrier adopting is R6K replicon or the responsive to temperature type replicon for needing Pir albumen to copy usually, utilize the former in intestinal bacteria, to copy and at high temperature not reproducible feature of the latter again, be integrated in escherichia coli chromosome by the homologous fragment of mutational site one side.Carrier still needs to contain negative selection markers, as the sacB gene of encoding sucrose 6-fructose-transferring enzyme.Utilize the method for adding 10% sucrose in substratum, SacB is virose ficoll by sucrose inversion, impels like this thalline to carry out secondary homologous recombination by the homologous fragment of the other side in mutational site and removes plasmid skeleton.After this, pcr amplification object region, confirms to obtain the bacterial strain of point mutation by sequencing.This method complex steps is consuming time, relates to the step of multiple gene clones, and final step when screening, may return to the genotype of former strain, and the probability that obtains mutant strain differs larger.And in the time that indispensable gene suddenlys change, the probability that obtains former strain is far longer than the probability of mutant strain, may need to screen a large amount of clones and could obtain the mutant strain of object.

Last century Mo development the recombined engineering of being used widely gradually provide novel thinking for the point mutation of intestinal bacteria indispensable gene.Recombinate homologous recombination between enzymatic DNA fragmentation and carry out modification and the clone of DNA of recombined engineering utilization.Use at present recombinase widely to come from lambda phage, be respectively the red α gene of coding DNA 5' → 3 excision enzyme, Red α acts on double-stranded DNA and obtains the DNA molecular that 3' distal process goes out; The red β gene of coding DNA single strand binding protein, it is combined in Red β on the DNA molecular that 3' distal process goes out, and Red β is also crucial recombinase, i.e. homologous recombination between catalysis homologous fragment; Red γ genes encoding suppresses the Gam albumen of endogenous nuclease, and the DNA fragmentation of Gam protection external source is avoided the degraded of endogenous dna enzyme.Compare with modification with more traditional DNA clone, the most significant advantage of recombined engineering shows: can catalysis be as short as the homologous recombination between the homologous fragment of 36 bases, and short base can obtain by the PCR primer of chemosynthesis, without the step of multiple gene clones, this has just simplified operating process greatly; Can modify and operate for multiple genes, multiple site simultaneously.

For single stranded oligonucleotide, independent red β gene can be exercised recombination function.The point mutation that utilizes oligonucleotide to modify genome of E.coli and to realize indispensable gene is the means of development in recent years.But owing to there is no selection markers, mutation efficiency is extremely low (being everlasting below 0.1%) generally, be difficult to obtain by conventional method screening, need expensive high-throughput instrument and a large amount of screening could use these means.Have researchist to utilize the method for two oligonucleotide cotransformations to realize sudden change, one is sudden change oligonucleotide, another one for genome on can just exercise the oligonucleotide that screens (as antibiotics resistance) after site restructuring.But this mutational site need be introduced in advance, and can not reuse, this has just restricted multiple mutation.

The researchist of present patent application once proposed to utilize recombined engineering means, first introduce resistant gene box by PCR, then the method for the double-strand break reparation mediating by huge nuclease I-SceI realizes genomic point mutation (patent publication No.: CN102703424A).Although have higher mutation efficiency, this method to the modification of indispensable gene method be difficult to carry out, because introduce resistant gene will destroy indispensable gene open reading frame and make gene inactivation, bacterial strain can not be survived.

Summary of the invention

For the problems referred to above, the invention provides a kind of by oligonucleotide and eliminable plasmid cotransformation the method to the point mutation of intestinal bacteria indispensable gene.

Concrete experimental principle is as follows.Four bases are above connected taking sulphur phosphoryl, the oligonucleotide of length as 91 bases, centre as mutational site and eliminable plasmid pLS1755 cotransformation be to the intestinal bacteria of expressing recombinase.The Nucleotide that phosphorothioate linkages connects can be avoided the degraded of the inner nuclease of thalline.PLS1755 contains homologous sequence, the ampicillin resistance gene of 50bp and lacZ gene, the I-SceI gene of abduction delivering and two I-SceI restriction enzyme sites, and replicon is R6K.Oligonucleotide and cotransformation are when expressing the intestinal bacteria of recombinase, because pLS1755 can not self-replicating, under penbritin screening, homologous fragment generation homologous recombination on the recombinate contained 50bp of enzymatic pLS1755 and genome, obtains the integrated bacterial strain of pLS1755.Oligonucleotide is also the substrate of recombinase simultaneously, in the bacterial strain of therefore integrating at amicillin resistance, pLS1755, contains a certain proportion of mutant strain.So can screen and obtain being suddenlyd change and the bacterial strain of the indispensable gene point mutation that causes by oligonucleotide.

A method of utilizing oligonucleotide and eliminable plasmid cotransformation the indispensable gene on genome of E.coli to be carried out to point mutation, comprises the following steps: by oligonucleotide and eliminable plasmid pLS1755 cotransformation to the intestinal bacteria of expressing recombinase; Screening amicillin resistance bacterial strain, then from amicillin resistance bacterial strain, screen oligonucleotide generation restructuring and the point mutation bacterial strain of realization; Then by the plasmid pLS1755 eliminating again in point mutation bacterial strain; Described oligonucleotide length is 91 bases, and the 46th base is mutational site, and four bases above of oligonucleotide connect with sulphur phosphoryl; Described plasmid pLS1755 obtains by following structure: taking pST98-AS as template, forward primer is containing the I-SceI restriction enzyme site of restriction enzyme site, 50bp LacZ fragment and 18 bases, reverse primer is containing the I-SceI restriction enzyme site of restriction enzyme site and 18 bases, pcr amplification obtains the fragment of tetR-ptetA-I-SceI, and enzyme is cut the carrier of rear clone to R6K replicon and ampicillin resistance gene.

Eliminable plasmid pLS1755 containing the homologous sequence of 50bp and lacZ gene, ampicillin resistance gene, can abduction delivering I-SceI gene and two I-SceI restriction enzyme sites, replicon is R6K.

The method of the described point mutation bacterial strain that screens oligonucleotide generation restructuring and realize in the bacterial strain of amicillin resistance is: random choose amicillin resistance clone, respectively taking as template, to carry out bacterium colony PCR according to the designed primer of the sequence of both sides, object site, to the PCR product obtaining, check order with one end PCR primer, screen and obtain the clone who undergos mutation in object site by sequential analysis.

In described elimination point mutation bacterial strain, the method for plasmid pLS1755 is: (heating makes it to lose anti-microbial activity in nutrient solution, to add heat inactivation, but retain and the combination activity that regulates albumen TetR) the expression of Uromycin induction I-SceI gene, I-SceI acts on because pLS755 is integrated into two I-SceI restriction enzyme sites that genome of E.coli obtains, cause the double-strand break of genome of E.coli, now bacterial strain utilizes the recombination system of self, the homologous recombination between two 50bp LacZ fragments of catalysis and remove pLS755 part.Therefore pLS1755 also can reuse.

TetR in pLS1755 is suppressor gene, and TetR suppresses the expression of ptetA promotor.In the time containing tsiklomitsin or derivatives thereof in environment, these inductors and TetR combine and remove the restraining effect of TetR, and therefore ptetA brings into play the effect of promotor, drive the expression of downstream I-SceI gene.This inducible expression has good preciseness, when I-SceI only has inductor to exist, could express.

Huge nuclease I-SceI sets 5'-TAGGGATAA ↓ CAGGGTAAT that sequence is 18 base pairs, ↓ represent cutting position.This sets sequence and only in the yeast saccharomyces cerevisiae of finding I-SceI gene, exists, and other organism genomes (comprising intestinal bacteria) that checked order used are all without this site.Therefore the I-SceI of abduction delivering only cuts by pLS1755 and integrates and two I-SceI restriction enzyme sites introducing and can not destroy colibacillary genome structure.

Two indispensable gene rpsL in preferred embodiment and the point mutation in rpoB site have shown the suitability of present method.Can obtain mutant strain by 20～30 bacterial strains of PCR primary screening.The advantage of present method is: sudden change oligonucleotide can be by synthesizing to come; Plasmid pLS1755 can extract in a large number by cultivating thalline; Expend few; Integrated bacterial strain can be eliminated plasmid by inducing culture simply, so repeatedly modifies; The former strain of intestinal bacteria can operate, without any transformation.The potentiality that present method has the indispensable gene on pair genome of E.coli to modify down to any gene.

Brief description of the drawings

Fig. 1 is the plasmid the eliminated pLS1755 restriction map for carrying out indispensable gene point mutation with oligonucleotide cotransformation of 3027 base pairs.Wherein:

25-74 is that 50bp lacZ is the 50bp homologous fragment consistent with sequence on intestinal bacteria lacZ gene;

Two I-SceI restriction enzyme sites that S is 18 base pairs, are respectively 75-92 and 1500-1717 on plasmid;

93-716 is the open reading frame sequence of suppressor gene tetR;

760-766 is the promotor ptetA sequence that regulated by tetR;

798-1499 is the open reading frame sequence of nuclease I-SceI;

1579-1965 is R6K replicon sequence;

2035-2895 is the open reading frame sequence of ampicillin resistance gene Ap;

The direction of arrow of each gene is the direction of reading frame; ClaI, EcoRI, KpnI, SpeI and NdeI etc. is the restriction enzyme site of conventional mark, the position of the numeral restriction enzyme site in bracket on plasmid.

Fig. 2 .pLS1755 integrates and eliminates the gel electrophoresis of the gene type assay of bacterial strain

1.DL2000DNA molecular weight standard: 2.0,1.0,0.75,0.5,0.25,0.1kb;

2. the 262bp of the former strain NI3-NI6PCR amplification of intestinal bacteria MG1655;

3.ApR the 567bp of resistant strain upstream NI3-NI4PCR amplification;

4.ApR the 302bp of resistant strain downstream NI5-NI6PCR amplification;

5.pLS1755 eliminate the 262bp of bacterial strain NI3--NI6PCR amplification.

Fig. 3. oligonucleotide and can eliminate plasmid pLS1755 cotransformation and realize the schematic diagram of point mutation

Sudden change oligonucleotide (stain represent sudden change base site) and can eliminate plasmid pLS1755 cotransformation intestinal bacteria, homologous recombination refers to the homologous recombination between two 50bp LacZ fragments of recombinase while catalysis and between oligonucleotide and genome homologous fragment.Under penbritin (Ap) screening, obtain amicillin resistance (Ap ^r) mutant strain.The Uromycin induction I-SceI enzyme of thereafter heat inactivation is cut its action site,

Producer group double-strand break, between two 50bp LacZ fragments of homologous recombination function catalysis of bacterial strain, homologous recombination is removed carrier part subsequently, repairs genome and surviving.

Fig. 4 .rpsL point mutation sequencer map

Top is divided into the former strain rpsL of MG1655 region sequencer map, and former site is A; Bottom is divided into the rpsL region sequencer map of MG1655rpsL point mutation bacterial strain, and mutational site is G, and codon (representing with underscore) sports AGA by AAA.Mutational site is G, and codon (representing with underscore) sports AGA by AAA.

Fig. 5 .rpoB point mutation sequencer map

Top is divided into the former strain rpoB of MG1655 region sequencer map, and former site is C; Bottom is divided into the rpoB region sequencer map of MG1655rpoB point mutation bacterial strain, and mutational site is T, and codon (representing with underscore) sports CTT by CCT.

Embodiment

The term that used in the present invention, unless there is other explanation, generally has the implication that those of ordinary skill in the art understand conventionally.

Below in conjunction with specific embodiment, and comparable data is described the present invention in further detail.Should be understood that these embodiment just in order to demonstrate the invention, but not limit the scope of the invention by any way.

In following embodiment, various processes and the method do not described in detail are ordinary methods as known in the art.Source, the trade(brand)name of agents useful for same and be necessary to list its moiety person, all indicates in the time occurring first, identical reagent used is if no special instructions, all identical with the content of indicating first thereafter.

Bacterial strain used and plasmid in embodiment, be published bacterial strain and plasmid:

1.Escherichia?coli?MG1655。Genotype F ^-lAM-rph-1, from U.S.'s intestinal bacteria preservation center.

2.Escherichia?coli?DH10B。Genotype F ^-mcrA Δ (mrr-hsdRMS-mcrBC) φ 80dlacZ Δ M15 Δ lacX74deoRrecA1araD139 Δ (ara, leu) 7697galUgalKrpsLendA1nupG.Document: Life Technologies, Inc.Focus, 1990,12:19.Purchased from American I nvitrogen company.

3.Escherichia?coli?BW25141。Containing the coli strain of Pir gene, it is the Host Strains of the plasmid containing R6K replicon.

Document: Datsenko KA, Wanner BL.One-step inactivation of chromosomal genes in Escherichia coli K-12using PCR products.ProcNatlAcadSci U S A.2000,97 (12): 6640-5.Teach from the Barry Wanner of Purdue university of the U.S..

4.pKD4。Document: Datsenko KA, Wanner BL.One-step inactivation of chromosomal genes in Escherichia coli K-12using PCR products.ProcNatlAcadSci U S A.2000,97 (12): 6640-5.From the professor of the Barry Wanner of Purdue university of the U.S..

5.pST98-AS。Document: Posfai G., Kolisnychenko V., Bereczki Z, Blattner FR.Markerless gene replacement in Escherichia coli stimulated by a double-strand break in the chromosome.Nucleic Acids Res.1999,27 (22): 4409-15.Teach from the U.S. Madison of Wisconsin university branch school Frederick Blattner.

6.pBluescript?II(KS-)。Document: Alting-Mees, M.A.and Short, J.M. (1989) pBluescript II:gene mapping vectors.Nucleic Acids Res, 17,9494.Gene clone carrier, purchased from Stratagene company of the U.S..

7.pSC101-BAD-gbaA。Document: Wang, J., Sarov, M., Rientjes, J., Fu, J., Hollak, H., Kranz, H., Xie, W., Stewart, A.F.and Zhang, Y. (2006) An improved recombineering approach by adding RecA to lambda Red recombination.Mol Biotechnol, 32,43-53.From Youming doctor Zhang of German Dresden university.

Embodiment

the structure of embodiment 1. integrative plasmid pLS1755, is integrated into bacillus coli gene and elimination

the structure of 1.1pLS1755

Design primer LSKD7:5'-GGG aTCGATGAATTCGGTACCACTAGTtATGGACAGCAAGCGAACCGG-3', (SEQ ID NO.1), underscore is ClaI, EcoRI, KpnI and SpeI restriction enzyme site; LSKD8:5'-GGG gCTCATGCGAGACCCCATGGGAGCTCCACC gCGGTGGCGGCCGCTCTAGAACTAGTtCAGAAGAACTCGTCAAGAAG-3', (SEQ ID NO.2), underscore is XhoI, BsaI, NcoI, SacI, SacII, NotI, BamHI and SpeI restriction enzyme site.Taking pKD4 as template, LSKD7 and LSKD8PCR amplification obtain that mould resistant gene neo fragment of card of 1.5kb, neo fragment cut with ClaI-BsaI enzyme after with pKD4 with the segment of ClaI-NcoI enzyme and separate the 1.4kb carrier part that obtains and be connected, transform the competent cell of BW25141, screening obtains recombinant clone pLSKD2.

Design primer NI1:5'-GGG aCTAGTttaccctgttatccctaTTATTTCAGGAAAGTTTCGGAG-3', (SEQ ID NO.3), NI2:5'-GGG aCTAGTgACCGTAATGGGATAGGTCACGTTGGTGTAGATGGGCGCATCGTAACCGTtaggga taacagggtaatTTAAGACCCACTTTCAC-3', (SEQ ID NO.4), underscore is SpeI restriction enzyme site, small letter is I-SceI restriction enzyme site (being reverse complementary sequence in NI2), and italic is 50bp lacZ sequence.Taking pST98-AS as template, NI1 and NI2 amplification obtain 1.5kb tetR-ptetA-I-SceI fragment, after cutting, are cloned into the SpeI site of pBluecript II KS (-) with SpeI enzyme, after order-checking is correct, and recombinant clone called after pLS1754.PLS1754 cuts with SpeI enzyme, reclaims object fragment, and the carrier cutting back to close with SpeI enzyme with 1.6kb pLSKD2 is connected, and transforms the competent cell of BW25141, and screening obtains recombinant clone pLS1755.PLS1755 be object integrated, can eliminate plasmid, its restriction map is as shown in Figure 1.

the 1.2 intestinal bacteria MG1655/pSC101-BAD-gbaA electricity preparation of transformed competence colibacillus and the corotation of oligonucleotide and plasmid change

First pSC101-BAD-gbaA is converted into intestinal bacteria MG1655, in the LB solid culture of 10 μ g/ml tsiklomitsins, obtains bacterial strain MG1655/pSC101-BAD-gbaA in 30 DEG C of screenings.LB liquid nutrient medium by bacterial strain list colony inoculation 3ml containing 10 μ g/ml tsiklomitsins, cultivates approximately 20 hours for 30 DEG C, and by the volume switching 100ml same medium of 1:50,30 DEG C of shaking culture are to OD ₆₀₀be about at 0.2 o'clock, adding final concentration is the expression of 0.15% L-arabinose induction recombinase, and 37 DEG C of shaking culture approximately 1 hour are to OD ₆₀₀be about 0.4.After ice bath 10 minutes, 4 DEG C, centrifugal 5 minutes of 7000rpm, abandons supernatant.Thalline, with 10% ice-cold glycerine washing precipitation twice lightly, is finally suspended in 10% glycerine that 200 μ l are ice-cold, and every pipe 50 μ l packing are used.

the integration of 1.3pLS1755 and elimination

100ng pLS1755 electricity is converted into the competent escherichia coli cell of expressing recombinase, is screening containing on 50 μ g/ml solid plates.Design primer NI3:5'-CATCAACATTAAATGTGAGCG-3', (SEQ ID NO.5), NI4:5'-CATACTCACTTTTGCCCTTTAG-3', (SEQ ID NO.6), NI5:5'-AGCGGATACATATTTGAATG-3', (SEQ ID NO.7), NI6:5'-ACCGATCGCCCTTCCCAACAG-3', (SEQ ID NO.8).NI3 is positioned at the upstream 114bp of integration site, and NI4 is arranged in tetR, and NI5 is arranged in ampicillin resistance gene, and NI6 is positioned at the downstream 148bp of integration site.Random picking clone carries out bacterium colony PCR checking.The NI3-NI4PCR upstream fragment 567bp that increases, the NI5-NI6PCR downstream fragment 302bp that increases.

Gained resistant strain but bacterium colony are forwarded in the 3ml LB containing the cTc of 25 μ g/ml heat inactivations and cultivate approximately 16 hours, and 10 ^-4after dilution, paving cloth LB flat board, random 50 bacterial colony photographic reprintings of picking are to the LB flat board that contains or do not contain penbritin, find that 42 clones are penbritin susceptibility, show that pLS1755 is eliminated, obtained strains is taking NI3-NI6 amplification lacZ region as 262bp, and genotype is all consistent with former strain with sequencing analysis.The gel electrophoresis result that pLS1755 is analyzed by the enzymatic mutational site that is integrated into genome gained mutant and the rear obtained strains of plasmid elimination of recombinating as shown in Figure 2.

1.4 the cotransformation of oligonucleotide and pLS1755

5pmol oligonucleotide and 100ng pLS1755 are added in Electroporation-competent cells jointly, and piping and druming mixes gently.Mixed solution is transferred in the 1mm electricity revolving cup of precooling on ice, and electric shock transforms.Condition: 200 Ω, 1800V, the Gene Pulser II of Bio-Rad company ^relectricity conversion instrument.After electric shock, add immediately 1ml SOC liquid nutrient medium to electric revolving cup, piping and druming mixes, suspension is transferred to aseptic 1.5ml eppendorf pipe, 37 DEG C of shaking culture are after 70 minutes, and conversion fluid is coated in the resistant panel containing the penbritin of 50 μ g/ml, cultivate approximately 20 hours for 37 DEG C.The bacterium colony that picking grows after resistance checking enlarged culturing, carries out colony PCR amplification object fragment with the primer of both sides, mutational site on the solid plate of the penbritin of 50 μ g/ml, and the sudden change situation in sequencing analysis object site.Obtain mutant strain, eliminate pLS1755 by " 1.3 " described method.Oligonucleotide and can eliminate schematic diagram that plasmid pLS1755 cotransformation realizes the point mutation of genome of E.coli indispensable gene as shown in Figure 3, P1 and P2 are PCR primer and the sequencing primer of amplification Sudden change region, as R511 and the R512 of the R509 of rpsL mutational site analysis and R510 and the analysis of rpoB mutational site.

the point mutation of embodiment 2. indispensable gene rpsL genes

The gene numbering of rpsL gene on genome of E.coli is b3342, design oligonucleotides R507:5'-G*T*C*A*GACGAACACGGCATACTTTACGCAGCGCGGAGTTCGGTTT T ctAGGAGTGGTAGTATATACACGAGTACATACGCCACGTTTTTGCG-3', (SEQ ID NO.9), * is expressed as phosphorothioate linkages and connects, and underscore is mutational site.5pmol R507 and 100ng pLS1755 are carried out to electricity as the method in embodiment 1 and transform, 100 amicillin resistance bacterium colony amplification cultivation.Design primer R509:5'-CAGGATTGTCCAAAACTCTAC-3', (SEQ ID NO.10), R510:5'-GGCATCGCCCTAAAATTCGG-3', (SEQ ID NO.11).Random 30 clones of picking, obtain 540bp taking R509 and R510 as primer carries out colony PCR amplification.Check order taking R510 as primer pair 540bp product, obtain the clone of two desired point sudden changes.Appended Fig. 4 of sequencer map of rpsL point mutation shows, the 128th bit base of open reading frame sports G by A, and codon sports AGA by AAA, and the 43rd coded lysine mutation is arginine.Transform separately in oligonucleotide R507 institute DCRP, random 30 clones of picking carry out pcr analysis, do not find the sudden change of expection, are the genotype of former strain.

the point mutation of embodiment 3. indispensable gene rpoB genes

The gene numbering of rpoB on genome of E.coli is b3987, design oligonucleotides R508:

5'-A*C*G*T*ACACCCGACTCACTACGGTCGCGTATGTCCAATCGAAACCC ttGAAGGTCCGAACATCGGTCTGATCAACTCTCTGTCCGTGTACGC-3', (SEQ ID NO.12), * is that phosphorothioate linkages connects, underscore is mutational site.5pmol R508 and 100ng pLS1755 are carried out to electricity as the method in embodiment 1 and transform, 100 amicillin resistance bacterium colony amplification cultivation.

Design primer R511:5'-GTAGAGCGTGCGGTGAAAGAG-3', (SEQ ID NO.13), R512:5'-GGATACGTCCATGTAGTCAAC-3', (SEQ ID NO.14).Random 20 clones of picking, taking R511 and R512 as primer carries out colony PCR amplification, obtain 557bp.Carry out p order-checking taking R511 as primer pair 557b product, find that the point mutation of expection occurs two clones.The appended Fig. 5 of rpoB point mutation sequencer map shows, the 1691st bit base of open reading frame sports T by C, and codon sports CTT by CCT, and the 564th coded proline(Pro) sports leucine.Identical with rpsL experiment, transform separately in oligonucleotide R508 institute DCRP, random 20 clones of picking carry out pcr analysis, do not find the sudden change of expection, are the genotype of former strain.

Claims (4)

1. a method of utilizing oligonucleotide and eliminable plasmid cotransformation to carry out point mutation for the indispensable gene on genome of E.coli; it is characterized in that, comprise the following steps: by oligonucleotide and eliminable plasmid pLS1755 cotransformation to the intestinal bacteria of expressing recombinase; Screening amicillin resistance bacterial strain, then from amicillin resistance bacterial strain, screen oligonucleotide generation restructuring and the point mutation bacterial strain of realization; Then by the plasmid pLS1755 eliminating again in point mutation bacterial strain; Described oligonucleotide length is 91 bases, and the 46th base is mutational site, and four bases above of oligonucleotide connect with sulphur phosphoryl; Described plasmid pLS1755 obtains by following structure: taking pST98-AS as template, forward primer is containing the I-SceI restriction enzyme site of restriction enzyme site, 50bp LacZ fragment and 18 bases, reverse primer is containing the I-SceI restriction enzyme site of restriction enzyme site and 18 bases, pcr amplification obtains the fragment of tetR-ptetA-I-SceI, and enzyme is cut the carrier of rear clone to R6K replicon and ampicillin resistance gene.

2. the method for claim 1, it is characterized in that, eliminable plasmid pLS1755 containing the homologous sequence of 50bp and lacZ gene, ampicillin resistance gene, can abduction delivering I-SceI gene and two I-SceI restriction enzyme sites, replicon is R6K.

3. the method for claim 1, it is characterized in that, the method of the point mutation bacterial strain that screens oligonucleotide generation restructuring and realize in the bacterial strain of amicillin resistance is: random choose amicillin resistance clone, respectively taking as template, to carry out bacterium colony PCR according to the designed primer of the sequence of both sides, object site, to the PCR product obtaining, check order with one end PCR primer, screen and obtain the clone who undergos mutation in object site by sequential analysis.

4. the method for claim 1, it is characterized in that, in described elimination point mutation bacterial strain, the method for plasmid pLS1755 is: the expression that adds the Uromycin induction I-SceI gene of heat inactivation in nutrient solution, I-SceI acts on because pLS755 is integrated into two I-SceI restriction enzyme sites that genome of E.coli obtains, cause the double-strand break of genome of E.coli, now bacterial strain utilizes the recombination system of self, the homologous recombination between two 50bp LacZ fragments of catalysis and remove pLS755 part.

Images