CN114164225A

CN114164225A - High-throughput screening tool for enabling escherichia coli to obtain effective NHEJ system and application thereof

Info

Publication number: CN114164225A
Application number: CN202111628790.4A
Authority: CN
Inventors: 薛高旭; 夏立军; 方其; 张艳
Original assignee: Genewiz Suzhou Ltd
Current assignee: Genewiz Suzhou Ltd
Priority date: 2021-12-28
Filing date: 2021-12-28
Publication date: 2022-03-11
Anticipated expiration: 2041-12-28
Also published as: CN114164225B

Abstract

The invention provides a high-throughput screening tool for enabling escherichia coli to obtain an effective NHEJ system and application thereof, wherein the high-throughput screening tool comprises the following components: pDual-Cas 9-paretal plasmid vector: contains DNA helicase gene, replicon, antibiotic resistance gene, nuclease gene, araC gene, arabinose promoter and IIs type restriction enzyme recognition site; and a pDual-sgRNA-lacZ plasmid vector: contains sgRNA sequence of target lacZ gene, constitutive expression strong promoter, replicon and antibiotic resistance gene. The high-throughput screening tool can be used for rapidly and high-throughput screening of Ku + ligD combinations effective in escherichia coli, a plurality of groups of Ku + ligD combinations can be obtained through one screening experiment, the time consumption is short, the screening efficiency is high, and conditions are created for gene editing research of escherichia coli.

Description

High-throughput screening tool for enabling escherichia coli to obtain effective NHEJ system and application thereof

Technical Field

The invention belongs to the technical field of gene editing, and particularly relates to a high-throughput screening tool for enabling escherichia coli to obtain an effective NHEJ system and application thereof.

Background

Until the early 21 st century, it was generally accepted by biologists that the immune system of prokaryotes consisted solely of the innate immune system, including the restriction-modification system (restriction-modification system) and various exonucleases, with no adaptive immune system. Thus, the discovery of the prokaryotic adaptive immune system is a huge milestone in the history of biological development. Prokaryotes are unicellular organisms, so the adaptive immune system of prokaryotes must store all immune information in one cell, in contrast to the adaptive immune system of jawed vertebrates (jawed vertebrates) which stores only one immune information per lymphocyte.

CRISPR/Cas is an adaptive immune defense system of prokaryotes that records all immune information at the CRISPR site. The CRISPR group (CRISPR array) located in a genome can be expressed in the form of one transcription product and is composed of a plurality of short repetitive sequences (usually palindromic sequences of 21-40 bp), the repetitive sequences are usually separated by non-repetitive sequences of 25-40 bp, and the names of the non-repetitive sequences are called spacers (CRISPR). Each spacer in the CRISPR population is derived from a once invading host and is capable of perfectly complementary pairing with the host's nucleic acid sequence. Adjacent to the CRISPR population is a series of CRISPR-associated genes (cas), the cas gene encodes a protein that enables prokaryotes to exert adaptive immune functions based on the immune information stored in the CRISPR population.

Cas9 is capable of recognizing and cleaving a target sequence to form a DSB under the direction of the sgRNA. In recent years, CRISPR-Cas9 technology has been widely used for genome editing in eukaryotes and prokaryotes, and is by far the most effective tool for genome editing.

In prokaryotes, only a few bacteria have been identified as existing in the NHEJ system, such as Mycobacterium tuberculosis, Mycobacterium smegmatis, Bacillus subtilis, and Pseudomonas aeruginosa, among others. The prokaryotic NHEJ system is simple in construction and consists only of Ku, a DNA binding protein, and ligD, an ATP-dependent DNA ligase. Ku can bind to the ends of the fragmented DNA as homodimers, protecting the DNA from nuclease digestion, and also recruit LigD, facilitating LigD to end-link the fragmented DNA ends. Ligad is a multifunctional enzyme consisting of three domains, an N-terminal polymerase domain, a middle ligase domain and a C-terminal nuclease domain. The polymerase and nuclease domains enable ligad to handle unpaired bases at the DNA ends, promoting the formation of a stable structure in DNA, and the intermediate ligase domain is responsible for the eventual DSB ligation repair, a process often accompanied by DNA deletions or insertions of varying lengths at DNA breaks.

Most prokaryotes, such as E.coli, lack the NHEJ system and can only repair DSB by homologous recombination. Tianyuan Su et al (T.Su, F.Liu, P.Gu, H.jin, Y.Chang, Q.Wang, Q.Liang, Q.Qi, A CRISPR-Cas9 assisted non-homo-oligonucleotide end-joining strand for one-step engineering of bacterial genome, Sci.Rep.6 (37895.) the first introduction of the NHEJ system into E.coli, successful end-joining of linear plasmids and fragmented genomes, after about half a year Xu.Zong et al (X.Zong, S.Li, G.Zo, J.converting et al (X.Zong, S.Li, G.Zo., J.2017. expressing the DNA of Mycobacterium tuberculosis H37 Ku and strain D proteins, found that repair of Escherichia coli (S.E.coli) by heterologous expression of Mycobacterium tuberculosis H37 Ku and strain DNA (2016) in Escherichia coli strain I.T.Su.sub.S.L.T.E.S.L.G.Zo., J.E.E.T.E.S.T.T.T.S.J.7. E.E.E.E.E.E.E.E.E.E.E.E.C.T.J.E.E.E.E.T.E.E.S.T.T.E.1. 1. repair of Escherichia coli strain by Escherichia coli strain of Mycobacterium strain J.E.E.E.E.E.E.E.E.E.E.E.E.E.1. DNA of Escherichia coli, preferably has the same strain. Although Tianyuan Su, Xuan Zheng et al succeeded in introducing the NHEJ system into E.coli by allowing E.coli to express Ku and ligD proteins derived from other microorganisms, there has been no efficient method available so far for screening a NHEJ system that enables E.coli to be effective.

Therefore, how to provide a product and a method capable of efficiently screening escherichia coli to obtain an effective NHEJ system is a problem to be solved urgently.

Disclosure of Invention

Aiming at the defects and actual requirements of the prior art, the invention provides a high-throughput screening tool for enabling escherichia coli to obtain an effective NHEJ system and application thereof, wherein the screening tool can accurately and rapidly screen a Ku + ligD combination effective in escherichia coli, and provides a new tool for gene editing of escherichia coli.

In order to achieve the purpose, the invention adopts the following technical scheme:

in a first aspect, the present invention provides a high throughput screening tool for obtaining an efficient NHEJ system in e.coli, said high throughput screening tool comprising:

pDual-Cas 9-paretal plasmid vector: contains DNA helicase gene, replicon, antibiotic resistance gene, nuclease gene, araC gene, arabinose promoter and IIs type restriction enzyme recognition site;

and a pDual-sgRNA-lacZ plasmid vector: contains sgRNA sequence of target lacZ gene, constitutive expression strong promoter, replicon and antibiotic resistance gene.

According to the invention, through the cooperation of the pDual-Cas 9-Paratal plasmid vector and the pDual-sgRNA-lacZ plasmid vector, the LacZ gene of host escherichia coli can be edited, the frequency of the LacZ gene editing is counted, the editing efficiency of the corresponding Ku + ligD combination can be judged, and then whether the combination is effective in the escherichia coli is judged.

Preferably, the DNA helicase gene comprises the Rep101 gene.

Preferably, the replicon comprises a pSC101 replicon.

Preferably, the nuclease gene comprises a Cas9 gene.

Preferably, the number of the arabinose promoter is 2.

Preferably, the number of recognition sites of the type IIs restriction enzyme is at least 2, such as 2, 3, 4 or 5, and other specific points within the numerical range can be selected, and are not repeated herein.

Preferably, the type IIs restriction enzyme recognition sites include Bsa I and/or Bbs I.

Preferably, the strong promoter for constitutive expression comprises the J23119 promoter.

Preferably, the antibiotic resistance genes of the pDual-Cas 9-paretal plasmid vector and the pDual-sgRNA-lacZ plasmid vector are different.

Preferably, the antibiotic resistance gene of the pDual-Cas 9-fractional plasmid vector is a kanamycin resistance gene, and the antibiotic resistance gene of the pDual-sgRNA-lacZ plasmid vector is an ampicillin resistance gene.

Preferably, the pDual-Cas 9-fractional plasmid vector is sequentially linked with a DNA helicase gene, a replicon, an antibiotic resistance gene, a nuclease gene, an araC gene, an arabinose promoter and a iis-type restriction enzyme recognition site.

Preferably, the pDual-sgRNA-lacZ plasmid vector is linked in sequence with a sgRNA sequence targeting the lacZ gene, a constitutively expressed strong promoter, a replicon, and an antibiotic resistance gene.

As a preferred technical scheme, the high-throughput screening tool for obtaining the effective NHEJ system of the escherichia coli comprises:

pDual-Cas 9-paretal plasmid vector: sequentially connecting a Rep101 gene, a pSC101 replicon, a kanamycin resistance gene, a Cas9 gene, an araC gene, 2 arabinose promoters, a Bsa I restriction enzyme recognition site for cloning a Ku gene and a Bbs I restriction enzyme recognition site for cloning a ligD gene;

and a pDual-sgRNA-lacZ plasmid vector: the sgRNA sequence targeting lacZ gene, J23119 promoter, replicon and ampicillin resistance gene were sequentially linked.

In a second aspect, the present invention provides a method for constructing a high throughput screening tool for escherichia coli to have an efficient NHEJ system as described in the first aspect, the method comprising:

synthesizing a functional original of a pDual-Cas 9-Parantal plasmid vector and connecting to obtain the pDual-Cas 9-Parantal plasmid vector;

synthesizing a functional element of the pDual-sgRNA-lacZ plasmid vector and connecting to obtain the pDual-sgRNA-lacZ plasmid vector.

Preferably, the means of linkage comprises gene synthesis.

In a third aspect, the present invention provides a high throughput screening method for obtaining an efficient NHEJ system for escherichia coli, comprising:

preparing CDS coding sequences of Ku protein and ligD protein, connecting the CDS coding sequences with the pDual-Cas 9-Paratal plasmid vector in the first aspect to construct a Ku + ligD plasmid library, and preparing positive colonies into competent cells after transformation;

transferring the pDual-sgRNA-lacZ plasmid vector in the first aspect into the prepared competent cells, selecting positive clones for analysis, and judging the gene editing efficiency of different Ku + ligD combinations.

Preferably, the high-throughput screening method further comprises the step of codon optimizing the CDS coding sequence of the Ku protein and the ligD protein.

Preferably, the codon optimised CDS coding sequence of the Ku protein does not contain a Bbs i and/or Bsa i recognition sequence.

Preferably, the codon optimised CDS coding sequence of the ligD protein does not contain a Bbs i recognition sequence.

Preferably, the high throughput screening method further comprises the step of adding a sequence containing a restriction enzyme recognition site to both sides of the CDS coding sequence of the Ku protein and the ligD protein.

Preferably, the nucleotide sequence shown in SEQ ID NO.22 is added to the 5 'end of the CDS coding sequence of the Ku protein, and the nucleotide sequence shown in SEQ ID NO.23 is added to the 3' end.

SEQ ID NO.22：CCCAGTCACGACGGTCTCAAAAA；

SEQ ID NO.23：AAGCCGAGACCTCCTGTGTGAAA。

Preferably, the nucleotide sequence shown in SEQ ID NO.24 is added to the 5 'end and the nucleotide sequence shown in SEQ ID NO.25 is added to the 3' end of the CDS coding sequence of the ligaD protein.

SEQ ID NO.24：CCCAGTCACGACGAAGACGCAAAA；

SEQ ID NO.25：CACAAGGTCTTCTCCTGTGTGAAA。

Preferably, the method for constructing the Ku + ligD plasmid library comprises:

carrying out enzyme digestion connection on the CDS coding sequence of the Ku protein and a pDual-Cas 9-Paratal plasmid vector, extracting a plasmid after transformation, and verifying;

and (3) carrying out enzyme digestion connection on the verified correct plasmid and the CDS coding sequence of the ligD protein, extracting the plasmid after transformation, and verifying.

Preferably, the step of analyzing comprises:

and amplifying the positive clone, and sequencing and analyzing the amplified product.

Preferably, the step of determining comprises:

and counting the gene editing frequency of the corresponding Ku + ligD combination for editing the LacZ gene, and judging the gene editing efficiency of the Ku + ligD combination according to the frequency.

As a preferred technical scheme, the high-throughput screening method for obtaining the effective NHEJ system of the escherichia coli comprises the following steps:

(1) preparation of CDS coding sequences for Ku and ligD proteins:

carrying out codon optimization on CDS coding sequences of Ku protein and ligD protein, wherein the CDS coding sequence of the Ku protein after codon optimization does not contain BbsI and BsaI recognition sequences, and the CDS coding sequence of the ligD protein after codon optimization does not contain BbsI recognition sequences;

adding a nucleotide sequence shown by SEQ ID NO.22 at the 5 'end of the CDS coding sequence of the Ku protein, and adding a nucleotide sequence shown by SEQ ID NO.23 at the 3' end;

SEQ ID NO.22：CCCAGTCACGACGGTCTCAAAAA(Bsai recognition sites);

SEQ ID NO.23：AAGCCGAGACCTCCTGTGTGAAA (Bsa I recognition site);

adding a nucleotide sequence shown as SEQ ID NO.24 to the 5 'end and adding a nucleotide sequence shown as SEQ ID NO.25 to the 3' end of the CDS coding sequence of the ligaD protein;

SEQ ID NO.24：CCCAGTCACGACGAAGACGCAAAA (Bbs i recognition site);

SEQ ID NO.25：CACAAGGTCTTCTCCTGTGTGAAA (Bbs I recognition site).

(2) Constructing a Ku + ligD plasmid library:

digesting the pDual-Cas 9-Paratal plasmid by BsaI, and purifying the digested vector fragment;

carrying out enzyme digestion on the CDS coding sequence of the Ku protein obtained in the step (1) by using Bsa I, and purifying an enzyme digestion product;

mixing the CDS coding sequence of the purified Ku protein according to the number of equal molecules, connecting the CDS coding sequence with the purified restriction enzyme cutting carrier fragment by using T4 DNA ligase, transforming Top10 competent cells by a connecting product, coating a kanamycin-resistant plate, culturing overnight at 30 ℃, extracting plasmids from all cloning scrapers of the plate the next day, and sequencing to analyze the cloning condition of the Ku gene;

verifying that the correct plasmid is cut by Bbs I, and purifying a cut product;

carrying out enzyme digestion on the CDS coding sequence of the ligaD protein obtained in the step (1) by using Bbs I, and purifying an enzyme digestion product;

mixing the CDS coding sequence of the purified ligD protein and the like, connecting the mixture with a vector fragment cut by the purified Bbs I enzyme by using T4 DNA ligase, transforming Top10 competent cells by a connecting product, coating a kanamycin-resistant plate, culturing overnight at 30 ℃, performing scraper extraction on all cloning plates to obtain a Ku + ligD plasmid library, and performing sequencing analysis on the cloning condition of the ligD gene and the coverage condition of the library Ku + ligD combination.

(3) Transferring the correctly verified Ku + ligD plasmid library into MG1655 escherichia coli competent cells, coating a kanamycin-resistant LB plate, and culturing at 30 ℃ overnight;

make the plate standA cloning scraper is arranged and transferred to an LB culture medium for culture at 30 ℃, and when the bacterial liquid OD₆₀₀Electroporation competent cells were prepared when the value reached 0.6.

(4) Transferring a pDual-sgRNA-lacZ plasmid vector into the prepared electrotransformation competent cell, selecting positive clones, analyzing, and judging the gene editing efficiency of different Ku + ligD combinations:

electrotransfering pDual-sgRNA-lacZ plasmid to the electrotransfer competent cells in the step (3), coating an LB plate containing IPTG, X-gal, kanamycin and ampicillin, and culturing overnight at 30 ℃;

selecting white monoclonals, transferring the white monoclonals to an LB (Langerhans) plate for culturing for 8 hours, amplifying Ku, ligD and lacZ gene sequences of each monoclonals by using a colony PCR (polymerase chain reaction) method, and carrying out Sanger sequencing analysis on amplification products;

counting the gene editing frequency of a corresponding Ku + ligD combination for editing the lacZ gene, and judging the gene editing efficiency of the Ku + ligD combination according to the frequency;

among them, the higher frequency indicates that the gene editing efficiency of the Ku + ligD combination is higher, and it can be used as an NHEJ system effective in escherichia coli.

In a fourth aspect, the present invention provides an NHEJ system effective in escherichia coli, which is screened by the high-throughput screening tool for enabling escherichia coli to acquire an effective NHEJ system according to the first aspect and/or the high-throughput screening method for enabling escherichia coli to acquire an effective NHEJ system according to the third aspect.

Preferably, the NHEJ system is a pDual-Cas9-Ku + ligD plasmid vector to which the CDS coding sequence for both Ku and ligD proteins is ligated.

Compared with the prior art, the invention has the following beneficial effects:

according to the invention, through the mutual matching of the pDual-Cas 9-Paratal plasmid vector and the pDual-sgRNA-lacZ plasmid vector, various Ku + ligD combinations can be screened at the same time, the time consumption is short, and the screening efficiency is high; by counting whether the LacZ gene of the host is subjected to gene editing and the frequency of the gene editing, the effective Ku + ligD combination in the escherichia coli is screened out, the NHEJ system is successfully introduced into the escherichia coli, and a new research tool is provided for the gene editing of the escherichia coli.

Drawings

FIG. 1 is a photograph showing the amplification result of lacZ gene in example 3 of the present invention, in which M-standard DNA molecular weight Marker, 1 to 96-number 1 to 96 is the amplification result of colonies;

FIG. 2 is a photograph showing the result of amplification of the Ku gene in example 3 of the present invention, in which M-standard DNA molecular weight Marker, 1 to 96-number 1 to 96 is the result of amplification of the colony;

FIG. 3 is a photograph showing the amplification results of the ligD gene in example 3 of the present invention, in which M-standard DNA molecular weight Marker, 1 to 96-number 1 to 96 are the amplification results of colonies;

FIG. 4 is a picture showing the amplification results of the FhuA gene in example 4 of the present invention, wherein M-standard DNA molecular weight Marker, 1-24-amplification results of 24 colonies transformed with the plasmid pDual-Cas9-Msm-Ku + Msm-ligD, 25-48-amplification results of 24 colonies transformed with the plasmid pDual-Cas9-Msm-Ku + Mtb-ligD, 49-72-amplification results of 24 colonies transformed with the plasmid pDual-Cas9-Msm-Ku + Mfo-ligD, and 73-96-amplification results of 24 colonies transformed with the plasmid pDual-Cas9-Mbr-Ku + Mfo-ligD.

Detailed Description

To further illustrate the technical means adopted by the present invention and the effects thereof, the present invention is further described below with reference to the embodiments and the accompanying drawings. It is to be understood that the specific embodiments described herein are merely illustrative of the invention and are not limiting of the invention.

The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.

Materials:

bsa I, Spe I and Gibson

Master Mix kit was purchased from NEB;

top10 competent cells were purchased from Tiangen Biochemical technology (Beijing) Ltd;

t4 DNA ligase was purchased from seimer feishell science (china) ltd;

MG1655 Escherichia coli competent cells were purchased from ATCC;

x-gal and IPTG were purchased from Merck.

Example 1 construction of a high throughput screening tool for E.coli to obtain an efficient NHEJ System

The present example provides a high-throughput screening tool for escherichia coli to acquire an effective NHEJ system, comprising:

and a pDual-sgRNA-lacZ plasmid vector: the sequence is sequentially connected with sgRNA sequence of target lacZ gene, constitutive expression strong promoter J23119 promoter, replicon and ampicillin resistance gene.

The high throughput screening tool for making escherichia coli to acquire an effective NHEJ system was constructed by the following method:

(1) gene synthesis pDual-Cas 9-Parantal plasmid vector.

And connecting the functional elements of the pDual-Cas 9-partial plasmid vector in sequence through gene synthesis to obtain the pDual-Cas 9-partial plasmid vector.

The plasmid has a nucleotide sequence shown in SEQ ID NO.1 and is synthesized by Jinzhi Biotechnology, Inc., Suzhou.

The plasmid is provided with a Rep101 gene from 151-1101 bp of a 5' end, a pSC101 replicon from 1149-1371 bp, a kanamycin resistance gene from 2023-2838 bp, a Cas9 gene from 3368-7471 bp, an araC gene from 7604-8482 bp, arabinose promoters from 8509-8793 bp and 9243-9527 bp, a reverse complementary sequence from 8838-8843 bp and a Bsa I restriction enzyme recognition site from 8854-8859 bp for cloning Ku genes, a reverse complementary sequence from 9573-9578 bp and a Bbs I restriction enzyme recognition site from 9589-9594 bp for cloning ligD genes.

SEQ ID NO.1：

aaacagacgaagaatccatgggtatggacatgccgctcgccttccatgggtatggacagttttccctttgatatgtaacggtgaacagttgttctacttttgtttgttagtcttgatgcttcactgatagatacaagagccataagaacctcagatccttccgtatttagccagtatgttctctagtgtggttcgttgtttttgcgtgagccatgagaacgaaccattgagatcatacttactttgcatgtcactcaaaaattttgcctcaaaactggtgagctgaatttttgcagttaaagcatcgtgtagtgtttttcttagtccgttatgtaggtaggaatctgatgtaatggttgttggtattttgtcaccattcatttttatctggttgttctcaagttcggttacgagatccatttgtctatctagttcaacttggaaaatcaacgtatcagtcgggcggcctcgcttatcaaccaccaatttcatattgctgtaagtgtttaaatctttacttattggtttcaaaacccattggttaagccttttaaactcatggtagttattttcaagcattaacatgaacttaaattcatcaaggctaatctctatatttgccttgtgagttttcttttgtgttagttcttttaataaccactcataaatcctcatagagtatttgttttcaaaagacttaacatgttccagattatattttatgaatttttttaactggaaaagataaggcaatatctcttcactaaaaactaattctaatttttcgcttgagaacttggcatagtttgtccactggaaaatctcaaagcctttaaccaaaggattcctgatttccacagttctcgtcatcagctctctggttgctttagctaatacaccataagcattttccctactgatgttcatcatctgaacgtattggttataagtgaacgataccgtccgttctttccttgtagggttttcaatcgtggggttgagtagtgccacacagcataaaattagcttggtttcatgctccgttaagtcatagcgactaatcgctagttcatttgctttgaaaacaactaattcagacatacatctcaattggtctaggtgattttaatcactataccaattgagatgggctagtcaatgataattactagtccttttcctttgagttgtgggtatctgtaaattctgctagacctttgctggaaaacttgtaaattctgctagaccctctgtaaattccgctagacctttgtgtgttttttttgtttatattcaagtggttataatttatagaataaagaaagaataaaaaaagataaaaagaatagatcccagccctgtgtataactcactactttagtcagttccgcagtattacaaaaggatgtcgcaaacgctgtttgctcctctacaaaacagaccttaaaaccctaaaggcttaagtagcaccctcgcaagctcggttgcggccgcaatcgggcaaatcgctgaatattccttttgtctccgaccatcaggcacctgagtcgctgtctttttcgtgacattcagttcgctgcgctcacggctctggcagtgaatgggggtaaatggcactacaggcgccttttatggattcatgcaaggaaactacccataatacaagaaaagcccgtcacgggcttctcagggcgttttatggcgggtctgctatgtggtgctatctgactttttgctgttcagcagttcctgccctctgattttccagtctgaccacttcggattatcccgtgacaggtcattcagactggctaatgcacccagtaaggcagcggtatcatcaacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttacgtttccaaccaattaaccaattctgattagaaaaactcatcgagcatcaaatgaaactgcaatttattcatatcaggattatcaataccatatttttgaaaaagccgtttctgtaatgaaggagaaaactcaccgaggcagttccataggatggcaagatcctggtatcggtctgcgattccgactcgtccaacatcaatacaacctattaatttcccctcgtcaaaaataaggttatcaagtgagaaatcaccatgagtgacgactgaatccggtgagaatggcaaaagcttatgcatttctttccagacttgttcaacaggccagccattacgctcgtcatcaaaatcactcgcatcaaccaaaccgttattcattcgtgattgcgcctgagcgagacgaaatacgcgatcgctgttaaaaggacaattacaaacaggaatcgaatgcaaccggcgcaggaacactgccagcgcatcaacaatattttcacctgaatcaggatattcttctaatacctggaatgctgttttcccggggatcgcagtggtgagtaaccatgcatcatcaggagtacggataaaatgcttgatggtcggaagaggcataaattccgtcagccagtttagtctgaccatctcatctgtaacatcattggcaacgctacctttgccatgtttcagaaacaactctggcgcatcgggcttcccatacaatcgatagattgtcgcacctgattgcccgacattatcgcgagcccatttatacccatataaatcagcatccatgttggaatttaatcgcggcctcgagcaagacgtttcccgttgaatatggctcataacaccccttgtattactgtttatgtaagcagacagttttattgttcatgatgatatatttttatcttgtgcaatgtaacatcagagattttgagacacaacgtggctttccctgcagggtttgcagtcagagtagaatagaagtatcaaaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatgctgttttgaatggttccaacaagattattttataacttttataacaaataatcaaggagaaattcaaagaaatttatcagccataaaacaatacttaatactatagaatgataacaaaataaactactttttaaaagaattttgtgttataatctatttattattaagtattgggtaatattttttgaagagatattttgaaaaagaaaaattaaagcatattaaactaatttcggaggtcattaaaactattattgaaatcatcaaactcattatggatttaatttaaactttttattttaggaggcaaaaatggataaaaaatacagtatcggcttagatattggcactaatagcgtgggttgggccgttattaccgatgaatataaagttccgagcaagaaattcaaagttctgggtaataccgatcgccacagtattaagaagaatctgatcggtgcactgctgtttgatagcggcgagacagccgaagccacacgtctgaaacgtaccgcacgtcgccgttatacccgtcgtaaaaatcgtatttgttacctgcaagagatttttagcaatgaaatggccaaagttgatgacagttttttccaccgtctggaagaaagttttttagtggaagaagataagaaacacgaacgccatccgatcttcggcaacatcgttgacgaagttgcctaccacgaaaagtaccctacaatttatcacctgcgcaaaaaactggttgatagcaccgacaaagccgacctgcgcttaatctatctggccctggcccacatgatcaaatttcgcggccactttctgattgaaggtgacttaaaccctgataacagtgacgttgacaaattattcattcagttagttcaaacctataaccagctgtttgaagaaaacccgatcaacgccagtggtgttgacgcaaaagccatcctgagtgcccgcctgagtaaaagccgccgtttagaaaacttaatcgcacaattaccgggtgagaagaaaaatggcttattcggcaacctgattgccctgagtctgggcttaacccctaatttcaaaagtaacttcgacctggccgaggacgccaagttacaactgagtaaagacacttatgatgacgatctggataatttactggcccaaatcggtgaccagtacgccgatctgtttttagccgccaagaatttaagcgatgccatcctgctgagtgatattctgcgtgtgaatacagaaattacaaaagccccgctgagcgcaagcatgattaagcgctatgacgagcaccatcaggacttaaccctgctgaaggccttagttcgccaacagctgccggagaagtataaagaaatcttttttgatcagagcaagaacggttacgccggttatattgacggcggtgccagccaggaagagttttacaagttcatcaaaccgatcctggagaaaatggatggcacagaggaactgttagtgaagctgaaccgtgaagatttactgcgcaagcagcgcaccttcgacaatggcagcattccgcatcaaattcatctgggtgaattacatgccattttacgtcgtcaggaagatttttatccgttcctgaaagacaaccgtgagaagatcgagaagattctgaccttccgcatcccgtactatgtgggcccgttagcacgcggtaacagccgtttcgcatggatgacacgtaaaagtgaagagacaattaccccttggaatttcgaagaggtggtggacaaaggtgccagcgcccagtcttttatcgagcgcatgacaaacttcgataagaatttacctaatgagaaagttttacctaaacatagcctgctgtatgaatacttcacagtttacaatgagttaaccaaagtgaaatatgtgaccgaaggtatgcgtaaaccggccttcttaagcggcgagcaaaagaaggcaatcgtggatctgttattcaaaaccaatcgcaaagttacagtgaaacaactgaaagaggactatttcaagaaaattgaatgcttcgatagcgtggagattagtggcgtggaggaccgttttaatgccagcttaggtacataccatgatctgttaaaaattattaaagataaagattttctggataacgaagaaaatgaagatattctggaagatatcgtgctgaccctgaccctgtttgaagatcgcgaaatgatcgaagagcgtctgaaaacctatgcccatctgttcgacgacaaagtgatgaaacagctgaagcgtcgccgctacaccggttggggtcgcttaagtcgcaagctgatcaacggtattcgtgacaaacagagcggtaaaaccatcctggattttctgaaaagcgatggtttcgccaaccgtaactttatgcagttaatccatgacgatagcctgacatttaaagaagatattcaaaaggcccaggttagcggccaaggtgatagcttacacgaacacattgccaatctggcaggcagtccggccattaaaaaaggtattttacaaaccgttaaggtggttgatgaattagtgaaagtgatgggccgccacaagcctgaaaatatcgtgattgaaatggcccgtgagaaccagaccacccaaaaaggccagaaaaacagtcgtgaacgcatgaagcgtatcgaagaaggtattaaagaactgggcagccaaatcctgaaagagcatccggttgagaacacacagttacaaaacgaaaaactgtatttatactatctgcaaaatggccgcgatatgtatgtggaccaggagctggatattaaccgcctgagtgattatgatgttgatcacattgttccgcagtcttttttaaaggatgatagcatcgacaataaggtgctgacccgtagcgacaagaatcgcggcaagagcgataacgttccgagcgaagaagttgtgaagaaaatgaaaaattactggcgccagttactgaacgccaagctgatcacccaacgcaagttcgacaatctgaccaaagcagagcgtggtggtttaagcgaactggacaaggccggcttcatcaagcgtcagttagtggaaacccgtcagatcacaaaacacgtggcccagattctggatagccgtatgaataccaaatacgacgagaatgataaactgattcgtgaagttaaagttatcaccctgaagagtaagctggtgagcgacttccgtaaagactttcagttctacaaagttcgcgaaattaataattatcatcatgcacatgatgcatacctgaacgccgttgttggcacagccctgatcaagaagtatcctaaactggaaagcgagtttgtttatggcgattacaaggtgtatgatgtgcgcaaaatgatcgccaagagtgagcaggaaatcggtaaagccaccgccaaatactttttctacagtaacattatgaattttttcaagaccgaaatcaccttagcaaacggcgagatccgcaaacgcccgctgatcgaaaccaatggtgaaaccggcgagattgtttgggataagggtcgcgactttgcaaccgttcgcaaggtgctgtctatgcctcaggtgaatattgttaagaaaaccgaagtgcaaaccggcggctttagtaaagaaagcatcctgccgaaacgcaatagcgacaaactgattgcccgtaaaaaagactgggaccctaagaagtacggcggttttgatagccctaccgtggcatacagcgttctggttgtggccaaagtggaaaagggcaagagtaagaagctgaagagtgttaaagagctgctgggcatcaccatcatggaacgtagcagcttcgagaaaaatccgatcgatttcctggaggcaaaaggttacaaagaagttaaaaaagatttaatcatcaaattacctaaatacagcctgttcgagctggagaatggtcgcaaacgtatgctggcaagcgccggcgaattacaaaaaggtaatgaactggcactgccgagcaagtacgttaacttcttatatttagcaagccattacgagaaattaaaaggtagtccggaggataacgagcagaagcagttatttgttgagcagcataaacattacctggatgagattattgagcagattagtgagttcagcaagcgcgtgattctggcagatgccaacctggataaggttctgagcgcctataacaaacaccgcgacaagccgattcgcgaacaagcagagaacattattcatctgttcacactgaccaacctgggcgccccggcagccttcaagtattttgataccaccatcgaccgcaaacgctatacaagcaccaaagaggttctggacgccaccctgattcaccaaagcattaccggcttatatgaaacccgcatcgacctgagtcagttaggcggtgactaaagtatattttagatgaagattatttcttaatctagacatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgcatcgatttattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaagtagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgtgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggaattcgagctctaaggaggttataaaaaagagaccattccattccggtctcaaagcttgggcccgaacaaaaactcatctcagaagaggatctgaatagcgccgtcgaccatcatcatcatcatcattgagtttaaacggtgtccagcttggctgttttggcggatgagagaagattttcagcctgatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtgtccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaactggatccttactcgagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgtttttttgggaattcgagctctaaggaggttataaaaaaagtcttcattccattccgaagacaacacaaagcatcttctgttgagttaagaacgagtatcgagatggcacatagccttgctcaaattggaatcaggtttgtgccaataccagtag。

(2) Synthesizing the pDual-sgRNA-lacZ plasmid vector by the gene.

And connecting the functional elements of the pDual-sgRNA-lacZ plasmid vector in sequence through gene synthesis to obtain the pDual-sgRNA-lacZ plasmid vector.

The plasmid has a nucleotide sequence shown in SEQ ID NO.2 and is synthesized by Jinzhi Biotechnology, Inc., Suzhou.

The plasmid is used as an sgRNA sequence of a targeted lacZ gene from 5' end 259-278 bp, a J23119 promoter from 279-313 bp, a replicon from 584-1172 bp and an ampicillin resistance gene from 1343-2203 bp.

SEQ ID NO.2：

tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagcttgtctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcggggctggcttaaaagcttctgcaggtcgactctagagaattcaaaaaaagcaccgactcggtgccactttttcaagttgataacggactagccttattttaacttgctatttctagctctaaaactcgttttacaacgtcgtgacactagtattatacctaggactgagctagctgtcaaggatccagcatatgcggtgtgaaataccgcacagatgcgtaaggagaaaataccgcatcaggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgcgctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacagaatcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgtaaaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacgctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctccctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcgtggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgtgtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaacccggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgtaggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaagaacagtatttggtatctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaaccaccgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaagaagatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtcatgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagtatatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtctatttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctggccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaaccagccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaattgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctacaggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgagttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaagttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaagatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttgctcttgcccggcgtcaatacgggataataccgcgccacatagcagaactttaaaagtgctcatcattggaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaacccactcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaaggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttttcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaataaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattattatcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc。

Example 2 construction of Ku + ligD plasmid library Using pDual-Cas9-Parental as backbone vector

In this embodiment, pDual-Cas 9-paretal is used as a backbone vector to construct a Ku + ligD plasmid library, which includes the following steps:

(1) five CDS coding sequences of microbial Ku protein and ligD protein were obtained from NCBI, GenBank accession numbers are WP _010886496(Bsu-Ku), GAS86454(Mbr-Ku), YP _889815(Msm-Ku), NP _215452(Mtb-Ku), ACV76561(Nmu-Ku), NP _389223(Bsu-ligD), ATD76462(Bve-ligD), ALI25184(Mfo-ligD), WP _011730625(Msm-ligD) and NP 215453(Mtb-ligD), respectively.

(2) Carrying out codon optimization on CDS coding sequences of Ku protein and ligD protein aiming at an escherichia coli host, wherein the optimized CDS coding sequence of the Ku protein does not contain BbsI and Bsas I recognition sequences, a nucleotide sequence shown by SEQ ID No.22 is added at the 5 'end of the sequence, and a nucleotide sequence shown by SEQ ID No.23 is added at the 3' end of the sequence; the CDS coding sequence of the optimized ligaD protein does not contain a BbsI recognition sequence, the nucleotide sequence shown in SEQ ID NO.24 is added to the 5 'end of the sequence, and the nucleotide sequence shown in SEQ ID NO.25 is added to the 3' end of the sequence.

SEQ ID NO.22：CCCAGTCACGACGGTCTCAAAAA (Bsa i recognition site);

SEQ ID NO.23：AAGCCGAGACCTCCTGTGTGAAA (Bsa I recognition site);

SEQ ID NO.24：CCCAGTCACGACGAAGACGCAAAA (Bbs i recognition site);

SEQ ID NO.25：CACAAGGTCTTCTCCTGTGTGAAA (Bbs I recognition site).

The optimized CDS coding sequence of the Ku protein has a nucleotide sequence shown in SEQ ID NO. 3-7 and is synthesized by Suzhou Jinzhi Biotech limited.

SEQ ID NO.3(Bsu-Ku)：

CCCAGTCACGACGGTCTCAAAAAatgaatcgcacaccgtctttacacaccaaagagaaaaaaggcttcatcgacatgcacaccatgtggaaaggcagcatcagctttggtttagtgaacatcccgattaagctgtacgcagccaccgaagataaagatattaaattacgctctttacataaagaagatcatgccccgattaaatatgaaaaagtgtgtaccaactgcgagaaaactttaagccccgatgagatcgtgaaaggctatgagtatgtgaaaggcaagtatgtggtgctgaccgatgaggatctgaagagtctgaagcaagaacatgaggaaaaggccgttgagatcgtggacttcgttcagctgcaagaaatcgacccgatctacttcaaccgcagctactttgtgggccccggtgataacggcaccaaagcctataccttactgcgcgaagctttacgcagcaccggtaaaatcggcattgccaacatgaccattcgcagcaagcaacagctggccattctgcgtgtgtacgagaactgcatcgtgatggagagcatccattatccggacgaagtgcgtagcgcagcacaagttccgggtgttccggaccagagcaacgtgaacgacaaagagctgcagaccgcaattactttaattgatgagctgaccgccaagttcgagccggaaaaatacgaggacacctaccgtcaagctttactgcagcgcgtgaacgataagctggaaaacaaggaaaccgcagtgaccccggataaagcaccgccgcgcgaagatgttatcgatctggtgagtgctttacaagctagcattgatcgtacccgtcgcccgaatcgtgaaacacccgctgcagcaccggcacaagctgcagaaccgaagggtgccggtgacaaaaaacagaaaaccacccgcaaaaaagcaagcggcaccagctaaAAGCCGAGACCTCCTGTGTGAAA；

SEQ ID NO.4(Mbr-Ku)：

CCCAGTCACGACGGTCTCAAAAAatgcgcagcatctggaaaggcagtatcgcattcggtttagttaacgtgccggtgaaagtttacagcgccaccgaggatcacgacatcaagttccaccaagttcatgccaaagacaatggccgcatccgctataaacgcgtgtgcgaagtgtgcggcgaagtggtggaatttcgcgatattaataaagcctatgaaagcgacgacggtcagatggtggtgattaccgacgaggatattgctactttaccggaagaacgtagtcgcgagattgaggtggtggagtttatcccggccgaacaactggatccgctgatgtacgataagagctactttctggagccggatagcaaaagcagcaagagctacgtgctgctggcaaaaactttagccgaaactgaacgcgttgccattgtgcacttcagcttacgcaataaaacccgtttagcagcactgcgcgttaaggatttcagcaagcgcaacgtgatggtgatccatactttactgtggccggatgaaattcgtgacccggattttccggtgctggacaaggaagtggagatcaaaccggccgaactgaagatggccggccaagttgtggaaagcatgaccgacgatttccacccggaccagtttcgcgatgattatcaagctcagctgtatgagctggttcaagccaaactggaaggcggcgaagcattcagtgtggaagaacagccggccgatctggatgaaaccgaggatgtttctgatctgctggccaagctggaagccagcgtgaaagcccgtaaaggcggtggtagcgcaaaaagcgataaggacagcgacgaggatagcgataaggatagcgatgacgaggaagcaaagccggccaaaaaggcaccggctaaaaaagcagcagccaagaaagccccggctaaaaaagccgccgccaaaaaataaAAGCCGAGACCTCCTGTGTGAAA；

SEQ ID NO.5(Msm-Ku)：

CCCAGTCACGACGGTCTCAAAAAatgaatcgtgcagtgcgccataccggtctgatgcgcagcatctggaaaggtagcatcgcatttggtttagtgaatgtgccggtgaaagtgtacagcgccaccgaagatcacgatatcaaatttcatcaagttcatgccaaggataacggccgcatccgttacaaacgtgtgtgcgaggtgtgcggcgaagtggtggaatatcgtgatatcaataaagcctttgaaagtgatgacggccagatggtggtgattaccgatgaggacatcgcaactttacccgaagaacgcagccgtgagattgaagtggtggagttcatcccggcagagcaactggatccgctgatgtacgacaagagctacttcttagagccggacagcaagagcagcaagagttatgtgctgctggccaaaaccttagccgaaaccgaccgcatcgcaatcgtgcacttttctttacgcaataaaagccgtttagcagctttacgcgtgaaagacttcagcaagcgcgacgtgatgatgattcacactttactgtggccggatgagatccgcgacccggattttccgattttagataaagaagttcagatcaaaccggccgagctgaaaatggctggtcaagttgtggagagcatgaccgacgacttcaagcccgatctgtaccacgatgactaccaagaacagttacgtgaactggtgcaagctaaactggaaggtggcgaagcattcagcgtggaagaacagccggccgaactggatgaaggtaccgaggacgtgagcgatctgttagccaagctggaagcaagcgtgaaagcccgtaagggcggcaaaagcgatagcaaggacgatagcgacagcgagagcgacagcaaagagagcaaaagcgacagtaagccggccaaaaaagcccccgctaagaaagccgcagccaagaaaagcaccgctaaaaaagccccggctaaaaaagcagccgccaagaaatcttaaAAGCCGAGACCTCCTGTGTGAAA；

SEQ ID NO.6(Mtb-Ku)：

CCCAGTCACGACGGTCTCAAAAAatgcgtgccatttggaccggcagcattgcatttggtttagtgaatgtgccggtgaaagtttacagcgccaccgcagatcacgatattcgtttccaccaagttcatgccaaggataatggccgcatccgctataaacgcgtttgcgaggcatgtggcgaagtggtggattatcgcgatctggcacgtgcctatgagagcggtgatggccagatggtggccattaccgatgacgacattgcctctttaccggaagagcgtagccgcgaaattgaggtgctggagttcgttccggccgccgatgtggacccgatgatgttcgaccgcagctattttttagaaccggacagcaagagcagcaaaagctacgtgttactggccaaaactttagccgaaaccgatcgtatggccatcgtgcattttactttacgcaataaaacccgtttagccgctttacgcgtgaaagacttcggcaaacgtgaagtgatgatggtgcacaccttactgtggccggatgagattcgcgatccggattttccggtgctggaccagaaggtggaaatcaaaccggccgagctgaaaatggctggtcaagttgtggatagcatggcagacgactttaacccggatcgctatcacgacacctatcaagaacagctgcaagaactgattgatacaaagctggagggtggccaagcttttaccgccgaagatcagccgcgtttactggatgaaccggaggatgtgagtgatctgctggctaaactggaagcaagcgtgaaggcccgcagcaaagcaaacagcaatgtgcctaccccgccgtaaAAGCCGAGACCTCCTGTGTGAAA；

SEQ ID NO.7(Nmu-Ku)：

CCCAGTCACGACGGTCTCAAAAAatgcgcagcatctggaaaggcagcgtggcctttggtttagttaatgtgccggtgaaactgtacagcgcaaccgaagagaaggacatccgctttcatcaagttcatgcccaagatggtggccgcatcaaatataaacgcgtgtgcgatctggacggcgaggaagtgccgtatgccgatattgccaaagcctacgaaagcgacgatggtcgcacaatcatgctgaccgatgaggattttgctcagctgccggccagcagcagccgcgaaatcgatgttgtgagctttgtgcctagtgaccaagttgatcccgttctgtatgataaaacctactatctggagcccgctagcaccagcaccaaagcctatgtgttactgcgccagactttagaacagaccgaccgtattgccatcgtgaacttcgcactgcgccagaaaacccgtttagcagctttacgtgttcgtgatgatgtgctggtgatccagacactgctgtggccggatgaagtgcgcgccgcagaatttgcctctttagaggaaagcgtgagcattaaaccggccgaactgaagatggccagcatgctggtggatagtttcgccgatgacttccacccggaggactataccgatgagtatcgcgaagagctgcagcaactgatcgaagccaaactggaaggcggcgaagcctttgaaactccggaaaaaccggatgaaggtgaggatgctgaagtggttgatctgctggcagctctgcagcgcagcgttgagcgccataaaaaagctggtgcaagcaccggcgatgatagtggcgatggcgccgatgatagtccgaaaaagagcccgcgcaccagcagcgcaaaaacccgcaccaaagccaccgatgaaaccggtgaccaagataaagacgaggcaaaaccgccgacacgccgtcgtagtccggcacgtaaaaccggttaaAAGCCGAGACCTCCTGTGTGAAA。

The CDS coding sequence of the optimized ligaD protein has a nucleotide sequence shown in SEQ ID No. 8-12 and is synthesized by Jinzhi Biotechnology, Inc. of Suzhou.

SEQ ID NO.8(Bsu-ligD)：

CCCAGTCACGACGAAGACGCAAAAatggcattcaccatgcagccggtgttaacaagcagcccgcctatcggtgcagagtggcgctatgaggtgaagtacgacggttaccgctgcattctgcgtattcatagcagcggcgtgactttaaccagtcgtaacggtgttgagctgagcagtacattcccggagatcacccagttcgccaaaaccgcatttcagcatctggaaaaggaactgccgctgactttagatggtgaaattgtgtgtctggtgaacccgtgtcgcgcagatttcgagcatctgcaagttcgtggtcgtttaaagcgcccggataaaatccaagaaagtgccaacgcccgcccgtgttgttttctggccttcgatttactggaacgtagcggcgaagatgtgactttactgagctatttagaccgcaagaaatctctgcgtgagctgatcagcgccgcaaaactgccggccagccccgatccgtacgccaaggaaaccatccaaagcatcccgtgctacgaccatttcgatcagctgtgggagatggtgatcaagtacgacggcgaaggcatcgtggcaaagaaaaccaacagcaagtggctggaaaagaaacgcagcagcgattggctgaaatacaaaaactttaaacaagcttacgtttgtattaccggctttaatcctaataatggctttttaaccgtgagcgttctgaaaaacggcatcatgacaccgattgcaagcgtgagtcacggcatgcgcgatgaggagaaaagtgcaattcgcgagattatggaacagcacggtcaccagacaccgagcggcgagttcactttagaaccgagtatttgtgccgcagtgcagtatttaaccattctgcaaggtaccttacgtgaagtgagcttcatcggctttgagttccagatggactggacagagtgcacctatgcccaagttatccgccatagcaaaccggtgcaccctaagctgcagtttaccagtctggataagattatctttgagaaaaataagaaaaccaaagaagatttcattcaatatatgatcgaggtgagtgattatctgctgccgtttctgaagaatcgcgccgtgaccgtgatccgttatccgcacggcagtcgcagcgaaagcttttttcagaagaacaaaccggactacgcccccgattttgtgcagagcttttacgatggcagccacgagcacatcgtttgcgaagatatgagcacactgctgtggctgtgcaatcagctggcactggagttccatgtgccgtttcagacaatcaagagccgccgtccggcagagattgttatcgatttagacccgcctagccgcgacgattttttaatggccgtgcaagctgccaatgagctgaaacgtctgctggatagcttcggtatcaccagttacccgaagctgagcggtaacaagggcatccagctgtatatccctctgagcccggaggcatttacctacgaagaaacccgccagttcacacagctgattgccgagtactgcaccaacgcatttcccgaactgttcacaaccgagcgtttaatcaaaaaccgtcattgcaaactgtatctggattatttacagcacgccgaaggcaaaaccattatctgcccgtacagcacccgtggtaatgagttaggtaccgtggccgcaccgctgtattggcatgaagttcagagtagtctgaccccggctttattcacaattgacaccgttattgatcgtattaaaaaacaaggttgcccgttttttgatttctatcgcaacccgcaagatgaaccgctgagcgccattctgcaccagttaaagaagaaatcttaaCACAAGGTCTTCTCCTGTGTGAAA；

SEQ ID NO.9(Bve-ligD)：

CCCAGTCACGACGAAGACGCAAAAatggttctgacaatgcagccgattttaaccagcgagccccccgaaggtagtgaatggcgttacgaggtgaagtacgacggtttccgctgtttactgcgtatcgacgaaagtggtgttactttaacaagccgcaatggtcagactttaaccaaccagttcccggaaattaccgcattcgccgcccgctgcttccagcatatgaaggatcgttttccgatcactttagacggtgagctggtgtatctgatcaatccgtatcgcgccgactttgaacatttacagattcgcggccgcttaaaacgtacagaaagcatcgaaagcacagccgatcgccgtccgtgtcgttttctggcctttgatttactggtgttagagggcgccggtaccgtttctttaccgtatgtgaaacgcaagcgcgcactgagcaaactgttcaaagaggccaatctgccggcttgtccgcaccatctggcagaagaggccatccagtacattccggaacataccgatttcgacgctttatgggataaagtggtgcgccatgatggtgaaggcgttgtggccaaacgcgccagtagtggttgggcagagaacaagcgtagcccggactggcaaaaatacaaacatatgaaaactgctcatgttctgctgaccggctttaaccctaagaacggctacgtgaccgcaagcgtgctgaaagatggcaccgccattcctattgccagcgtgagccatggtatgcaagctgaggaaaagaatgcagtgcgcaccattatggaaactcacggcaaaaagcagaagagtggtgaatatactttagagccgagcatttgcatgaccgtgcaatatttaaccattttacaagatactttacgcgaggtgagctttgtgagcttccaatttgaaatggattggacagagtgcacctaccagcaactgattctgcgcagcaagactttaccgccgaaactgcagtttacctctttagacaaaattgtttttaaaaaacgcgaaaaaaccaaagcagatttcttaagctacatggtgaaaatgagcgattttttaatgccttttctgaaagaccgcgccgtgaccgttatccgctatccgcatggtgcacccggtgaaagtttcttccagaaaaataagccggactacaccccggactttgttagtagcgtgtttgacggcagccacgaacacatcgtttgtagtagcattccgtctttactgtggctggcaaaccagctggctttagagtttcacgttccgtttcagaccgtgcatagcgaacgcccggccgaaatcgttattgatttagatccgcctagccgcaacgatttcccgatggccgtggaagcagcacacgttctgaagcagctgtttgacagcttcagcatcaccagtttcccgaaactgagcggcaacaagggcattcagctgtacattcctctgagcccggaggcctttacctacgaagaaacccgcgcctttaccatgctgatcgcagactactgtgttcgcacacgccccgatttatttacaaccgagcgcttcatcaaaaaccgcaatggccgtctgtatctggactatctgcagcacgccgagggtaagacaattattgccccgtatagtacccgcggtaacgaactgggcacagttgccgcaccgctgtactggagcgaggtgaacagctctttaacccccgatgactatactatcgacacagtggtgaaccgcgtgcgcaccgaaggcgatccgttctacgacttctatcgcaatccgcaagatggcccgctgagcatcgtgttagagcagattaagcgtaaaagctaaCACAAGGTCTTCTCCTGTGTGAAA；

SEQ ID NO.10(Mfo-ligD)：

CCCAGTCACGACGAAGACGCAAAAatggaacgctatgaacgtgtgcgtttaaccaaccccgataaggttctgtaccccgctagcagcaccaccaaagcagaggtgtttgattattatctgagcatcgccgaagttatgctgccgcatattgccggtcgtccggttacccgtaaacgttggccgaatggtgtggcagaagccagcttcttcgaaaagcaactggccagtagtgcaccggattggctggaacgtggcaccattgtgcataagagcggcaccaccacctaccctatcgttaacacccgcgaaggcttagcatggatcgcccagcaagcttctttagagctgcatgttccgcaatggcgctttagcagcgatggcagccaaggtccggcaacccgtatcgtgttcgatttagatccgggtgaaggcgttacaatgcctcagctgtgcgaggttgcccaagccgtgcgcgaactgatgagcgacatcggcttaatgacctatccgctgaccagtggtagcaaaggtttacatttatacgttccgctggcagaccctatcagcagccgcggtgcaagcgttctggccaagcgcgttgcagtgcagctggagcaagctatgccgaagctggttaccgcaaccatgacccgcagtctgcgcgcccagaaagtgtttttagactggagtcagaataatgcagccaagaccacaatcgcaccgtattctttacgcggtcgtgattacccgaccgttgcagcaccgcgtacatgggatgaaattggcgacccggatttacgccatctgcgtttcgacgaagttctgcagcgcatcagtgacgatggcgatttattagctggtttagatgacgatgccccggttgccgataaactgaccacctatcgcagcatgcgcgatgcaacaaaaaccccggaacccgttccgcgcgatatcccggttcgcggtaacaacgatcgtttcgttattcaagaacatcacgcacgtcgtttacattatgatctgcgtctggaacgtgatggcgtgctggttagctgggcagttccgaaaaatttaccggacaccaccgccgttaatcatttagccgtgcacacagaagatcaccctatcgagtatttaacctttcacggcacaattccgaagggcgagtatggtgctggtaatatggtgatctgggacaccggtacctatgaggccgagaaattccgcgttccggccgatccggatgacagcgatgcaccgaagggtgaagttatcttcactttaaatggtaaccgcatcgatggccgttacgcactgatccagaccgaaggtaagaactggctggcacatcgcatgaaggatcagagcagcgccgcacccgaaccgaaagacttcgccccgatgttagcaaccgaaggcagtgtggccaagctgaaggccacccagtgggccttcgaaggtaaatgggacggctaccgcttactggtggaggccgaacatggtcgcttacaactgcgtagtcgccgcggccgtgatgttaccgccgagtatccgcagtttgaagcactggccgccgatctggccgatcatcatgtggtgctggatggtgaagccgttgccttagacgatcacggcatgccgagcttccgcgagatgcagaaccgcgcacgcagtacacgtgttgagttctgggcctttgatattttatggctggatggtcgctctttactgcgcgcaaaatacacagaccgccgcaaactgctggaagcactggcagctggtggtggtctgattgtgccggaacagctggctggtgatggtccggaggccatggaacacgcacgtgagcacaaattcgagggcgtggtggctaaaaaacgcgatagcacctaccagcccggtcgtcgtagtgccagctggatcaaagacaaaatctggaacacccaagaagttgttatcggcggttggcgccaaggcgaaggtggccgtagcagtggcattggcgctttagttctgggtgtgccgggtcctcatggtttacaatttgctggtcgtgttggcaccggcttcaccgaaaaggaactgaccaaactgaaaggtatgctgaaaccgctgcacaccaaagagagcccgtttgataagccgctgccgaaactggatgccaaaggcgtgaccttcgtgcgccccgaactggttggcgaggtgcgctatagtgaacgtacaaccgaccaccgtttacgccagcctagttggcgtggtctgcgtccggacaaagcaccggacgaagtggtgtgggagtaaCACAAGGTCTTCTCCTGTGTGAAA；

SEQ ID NO.11(Msm-ligD)：

CCCAGTCACGACGAAGACGCAAAAatggaacgctacgaacgtgtgcgtttaaccaaccccgataaggtgctgtaccccgctaccggcaccaccaaagccgaagtgtttgattattatttaagcattgcacaagttatggtgccgcacatcgccggtcgtccggttacacgtaaacgctggccgaatggcgtggccgaagaagcattctttgagaagcagctggccagcagtgccccgagttggttagaacgcggcagcattacccataaaagcggcaccaccacctaccctatcattaacacccgcgaaggtctggcatgggttgcccagcaagcttctttagaagtgcatgtgccgcagtggcgctttgaagatggtgaccaaggtccggcaacccgtatcgttttcgatttagacccgggtgagggcgtgaccatgacccagctgtgcgaaatcgcccacgaagtgcgcgctttaatgaccgatctggatttagagacatacccgctgacaagcggcagcaaaggtttacatctgtacgttccgctggcagaaccgattagcagccgtggtgcaagcgttctggcacgccgtgtggcacagcagctggaacaagctatgccgaaactggttaccgccaccatgaccaaatctttacgtgctggtaaggtgtttctggattggagccagaacaacgcagcaaaaaccaccatcgccccgtatagtttacgcggtcgtgaccatcctacagtggccgcccctcgcacttgggacgaaattgccgatccggaactgcgccatttacgctttgatgaggtgctggaccgtctggacgaatacggtgatctgctggcacctctggacgcagacgccccgattgccgataagctgacaacctaccgtagtatgcgcgacgcaagtaaaaccccggaaccggtgccgaaagaaattccgaaaactggtaataatgacaaattcgtgatccaagaacatcatgcccgtcgtttacactacgacttacgtttagagcgcgacggcgtgctggttagtttcgccgtgcctaaaaatttaccggaaaccaccgcagaaaaccgtttagccgttcacaccgaagatcacccgattgaatatttagccttccacggtagcatccctaaaggcgagtatggtgccggcgatatggtgatttgggacagcggcagttatgaaaccgagaaattccgcgtgccggaagaactggataacccggacgacagccacggtgaaatcatcgtgactttacacggcgaaaaggttgacggccgttacgctttaattcaaaccaagggcaaaaactggctggcccaccgtatgaaagaccagaaaaacgcccgtccggaggattttgcccctatgctggccaccgaaggcagtgtggccaaatacaaggccaaacaatgggccttcgagggtaaatgggatggctaccgtgtgattatcgacgccgatcatggtcagctgcagatccgtagccgtaccggccgtgaagttaccggcgagtatccgcagtttaaagctttagccgcagatctggcagagcatcacgttgttctggacggcgaggccgttgccttagatgagagcggcgtgccgagttttggccagatgcagaatcgcgcccgtagcacccgtgtggagttttgggccttcgatattttatggttagacggtcgttctttactgcgtgcaaagtatagcgatcgccgtaaaattttagaagctttagcagacggtggtggtctgattgtgcccgatcaactgccgggtgacggccccgaagccatggaacacgtgcgtaaaaagcgcttcgagggtgtggttgccaaaaagtgggatagcacctaccagcccggtcgtcgcagcagcagctggatcaaagataaaatttggaatacccaagaagttgttattggcggttggcgtcaaggtgagggtggtcgcagcagtggtattggcgctttagttctgggcattccgggtcccgaaggtttacagttcgtgggtcgtgttggcaccggttttaccgaaaaagaactgagtaagctgaaagatatgctgaagccgctgcataccgatgaaagcccgttcaacgcaccgctgccgaaagtggatgcccgtggcgtgacctttgtgcgccccgaactggtgggcgaagtgcgttatagcgagcgcaccagcgatggtcgtttacgtcaacctagttggcgtggtttacgcccggataagacaccggatgaggtggtttgggaataaCACAAGGTCTTCTCCTGTGTGAAA；

SEQ ID NO.12(Mtb-ligD)：

CCCAGTCACGACGAAGACGCAAAAatgggcagcgcaagcgaacagcgcgttaccttaaccaacgccgacaaagtgctgtatccggcaaccggtaccaccaaaagcgacattttcgactactatgctggtgtggcagaggtgatgctgggtcatattgccggtcgcccggcaacccgtaaacgctggccgaatggcgttgatcagccggcatttttcgagaagcagctggctttaagtgcacccccttggctgagccgtgccaccgttgcacaccgtagtggtaccaccacctaccctatcattgatagcgccaccggtctggcttggattgcacagcaagccgcactggaagtgcacgtgccgcagtggcgtttcgtggccgaaccgggtagtggcgaattaaatcccggtccggctacccgtttagtgttcgatctggatccgggcgagggtgtgatgatggcacagctggccgaagttgcacgcgcagtgcgtgacttactggcagacattggcttagtgacctttccggtgacaagcggcagtaaaggtctgcatttatacaccccgctggatgaaccggtgagtagtcgcggcgccacagtgctggcaaaacgtgttgcacagcgtttagagcaagcaatgcccgctctggtgaccagcacaatgaccaaaagtctgcgcgccggcaaggtgtttgtggattggagtcagaacagcggcagcaagaccacaattgcaccttatagtctgcgcggtcgtacccatccgaccgttgcagccccgcgtacatgggcagaactggacgatcccgctctgcgccagctgagctatgacgaagttctgacacgcattgcccgcgatggcgatctgctggaacgtttagatgcagatgcaccggttgcagatcgtttaacccgctaccgtcgtatgcgtgatgcaagcaaaacccccgaaccgatcccgaccgccaagcccgttaccggtgacggtaacacattcgtgattcaagaacatcatgcccgtcgcccgcactatgattttcgtttagaacgtgatggcgtgctggtgagttgggccgttccgaaaaatctgccggataacaccagcgttaaccatttagccattcacaccgaggatcacccgctggagtatgccacctttgagggcgcaattcctagcggtgaatatggtgccggcaaagtgatcatctgggacagtggcacctatgataccgagaaatttcatgatgacccgcacaccggtgaggtgatcgttaatttacatggtggccgtatcagcggtcgctacgcactgattcgcaccaatggcgaccgctggctggcccatcgtttaaagaatcagaaagatcagaaagtgttcgagtttgataatctggcccctatgctggcaacccacggtacagtggccggtctgaaggccagccagtgggcatttgaaggcaaatgggatggctaccgcttactggttgaagcagatcacggtgcagtgcgtctgcgcagtcgtagcggccgtgatgtgaccgccgaatatccgcagctgcgcgctttagcagaagatttagcagatcatcacgttgtgctggatggtgaggccgtggttctggacagcagcggcgtgccgagtttcagccagatgcaaaaccgcggtcgtgacacacgcgtggaattctgggcctttgacttactgtatctggatggccgtgcactgctgggcacccgttatcaagatcgccgtaaactgttagaaactttagcaaacgcaacctctttaaccgttccggaactgttaccgggcgacggtgcccaagcttttgcttgtagtcgtaaacacggttgggaaggtgtgattgccaaacgtcgtgacagccgttatcagcccggtcgccgttgtgccagctgggttaaagataaacattggaatacccaagaagtggtgatcggtggctggcgtgctggtgaaggcggtcgtagcagcggtgtgggtagtttactgatgggcatcccgggtccgggtggtctgcagtttgctggtcgtgtgggtaccggcttaagcgaacgtgaactggccaatctgaaggagatgctggcaccgctgcacaccgatgagagtcctttcgacgtgccgttacccgctcgtgatgccaaaggcatcacctacgttaagccggcactggtggccgaagttcgctatagcgaatggacaccggaaggccgtttacgccagagtagctggcgtggtttacgtccggacaaaaaaccgagcgaggtggttcgcgagtaaCACAAGGTCTTCTCCTGTGTGAAA。

(3) The pDual-Cas 9-Parantal plasmid was digested.

The enzyme digestion reaction system is as follows:

reacting at 37 ℃ for 1h, and purifying the enzyme digestion product by using magnetic beads after the reaction is finished.

(4) The CDS coding sequence of 5 Ku proteins was cleaved by enzyme.

The enzyme digestion reaction system is as follows:

(5) And (4) connecting.

And (3) mixing the CDS coding sequence of the Ku protein purified in the step (4) according to equal molecular number, mixing with the enzyme digestion vector fragment purified in the step (3), and connecting.

The ligation reaction system is as follows:

and reacting at 22 ℃ for 1h, after the reaction is finished, transforming the ligation product into Top10 competent cells, coating a kanamycin-resistant LB plate, culturing at 30 ℃ overnight, scraping all clones on the plate for extracting plasmids, carrying out NGS sequencing on the plasmids, and analyzing the cloning condition of the CDS coding sequence of the Ku protein, wherein the sequencing result shows that the plasmid library contains 5 CDS coding sequences of the Ku protein.

(6) And (6) enzyme digestion.

The plasmid extracted by the scraper in the step (5) was digested with Bbs I.

The enzyme digestion reaction system is as follows:

reacting at 37 ℃ for 1h, and purifying the enzyme digestion product by using a phenol/chloroform/isopropanol precipitation method after the reaction is finished.

(7) The CDS coding sequence of 5 ligaD proteins was cleaved by enzyme.

The enzyme digestion reaction system is as follows:

(8) And (4) connecting.

And (3) mixing the CDS coding sequences of the purified ligaD protein in the step (7) according to equal molecular number, mixing with the vector fragments purified in the step (6), and connecting.

The ligation reaction system is as follows:

reacting for 1h at 22 ℃, after the reaction is finished, transforming the ligation product into Top10 competent cells, coating a kanamycin-resistant LB plate, culturing overnight at 30 ℃, extracting plasmids from all cloning scrapes of the plate the next day to obtain a Ku + liga plasmid library, carrying out NGS sequencing on the plasmids to analyze the cloning condition of CDS coding sequences of liga proteins and the coverage condition of a library Ku + liga combination, and displaying that the plasmid library contains 25 Ku + liga plasmids, namely the Ku + liga plasmid library is successfully constructed.

Example 3 screening of the Ku + ligD plasmid library for an effective NHEJ System in E.coli

This example screens for an effective NHEJ system in e.coli, comprising the following steps:

(1) the Ku + ligD plasmid library constructed in example 2 was transfected into MG1655 E.coli competent cells, plated with a kanamycin-resistant LB plate, and cultured overnight at 30 ℃.

(2) Scraping all clones on the plate and inoculating the bacterial liquid to LB culture medium, culturing at 30 deg.C and 220rpm, and obtaining OD of bacterial liquid₆₀₀When the value reached 0.6, competent cells were prepared according to the standard electroporation competent cell preparation method.

(3) Electrotransfering pDual-sgRNA-lacZ plasmid to the electrotransfer competent cells prepared in the step (2), coating LB plate containing IPTG, X-gal, kanamycin and ampicillin, and culturing overnight at 30 ℃.

(4) All plates were white clones, indicating successful lacZ gene editing. 96 white monoclonals are picked and transferred to an LB culture plate for 8 hours, and the Ku, ligD and lacZ gene sequences of each monoclone are amplified by using a colony PCR method.

The PCR amplification system is as follows:

wherein, the PCR amplification primer of lacZ gene is shown as SEQ ID NO.13 and SEQ ID NO. 14.

SEQ ID NO.13：AGCATCTGGTCGCATTGGGTCACCAGC；

SEQ ID NO.14：CTTCCAGATAACTGCCGTCACTCCAGCGC。

The PCR amplification primers of the Ku gene are shown as SEQ ID NO.15 and SEQ ID NO. 16.

SEQ ID NO.15：CTTCAGCCATACTTTTCATACTC；

SEQ ID NO.16：AGCTGGACACCGTTTAAACTCAATG。

PCR amplification primers of the ligaD gene are shown as SEQ ID NO.17 and SEQ ID NO. 18.

SEQ ID NO.17：TCTGTTGTTTGTCGGTGAACTG；

SEQ ID NO.18：CTGGTATTGGCACAAACCTGAT。

The reaction procedure was as follows:

pre-denaturation: 96 ℃ for 6 min;

and (3) circulating amplification: 96 ℃ for 30 s; at 58 ℃ for 30 s; 50/120s at 72 ℃; circulating for 35 times;

circulating external extension: 72 ℃ for 5 min.

The amplification product was stored at 4 ℃.

Wherein lacZ and Ku genes are amplified, and the PCR extension time is 50 s; the ligD gene was amplified and the PCR extension time was 120 s.

The lacZ gene amplification results are shown in FIG. 1, the Ku gene amplification results are shown in FIG. 2, and the ligD gene amplification results are shown in FIG. 3, and it can be seen from the above pictures that all of the lacZ, Ku and ligD genes of 64 clones in 96 strains were successfully amplified, the PCR products were purified and analyzed by Sanger sequencing, the PCR products of the lacZ gene were sequenced using SEQ ID No.13 and SEQ ID No.14, the PCR products of the Ku gene were sequenced using SEQ ID No.16, and the PCR products of the ligD gene were sequenced using SEQ ID No. 18.

Sequencing results showed that the lacZ genes of 64 clones all underwent gene editing, and had sequence deletions or insertions of different lengths, and the results of Ku + ligD combinations corresponding to 64 clones are shown in Table 1.

TABLE 1

As can be seen from Table 1, there are 11 Ku + ligD combinations as NHEJ system of E.coli, wherein Msm-Ku + Msm-ligD frequency is 12, Bsu-Ku + Bsu-ligD and Mtb-Ku + Mtb-ligD frequency are both 0, which indicates that Msm-Ku + Msm-ligD has better gene editing effect in E.coli than Bsu-Ku + Bsu-ligD and Mtb-Ku + Mtb-ligD, and the result is consistent with the experiment results of Xuan Zheng, etc. In addition, the frequency of Mbr-Ku + Mfo-ligD is the highest and reaches 25, which is higher than the frequency of Msm-Ku + Msm-ligD, and the result shows that Mbr-Ku + Mfo-ligD is used as an Escherichia coli NHEJ system, and the gene editing efficiency is superior to Msm-Ku + Msm-ligD.

Example 4 Gene editing of E.coli Using the NHEJ System selected

In this example, Msm-Ku + Msm-ligD, Msm-Ku + Mtb-ligD, Msm-Ku + Mfo-ligD and Mbr-Ku + Mfo-ligD were used as NHEJ system of E.coli to edit the FhuA gene of E.coli, including the following steps:

(1) referring to "example 2", the CDS coding sequences of the pDual-Cas9-Parental plasmid and Msm-Ku, Mbr-Ku proteins were cleaved with Bsa I, the CDS coding sequences of the Msm-Ku, Mbr-Ku proteins were ligated to the pDual-Cas9-Parental plasmid using T4 DNA ligase to obtain the pDual-Cas 92-Msm-Ku and pDual-Cas9-Mbr-Ku plasmids, respectively, and then the CDS coding sequences of the pDual-Cas9-Msm-Ku, pDual-Cas9-Mbr-Ku plasmids and Msm-ligD, Mtb-ligD and Mfo-ligD proteins were cleaved with Bbs I to obtain the pDual-Cas9-Msm-Ku, pDual-Cas 6384-Mbr-Ku plasmids, and the CDS coding sequences of the Msm-ligD, Mtb-ligD and Mfo-ligD proteins, and the Cas-Msm-Ku-9-Ku 9-599-Ku, respectively, and Mtb 639-Ku-9, Mfo-ligD and pDual-Cas9-Mbr-Ku are connected to finally obtain pDual-Cas9-Msm-Ku + Msm-ligD, pDual-Cas9-Msm-Ku + Mtb-ligD, pDual-Cas9-Msm-Ku + Mfo-ligD and pDual-Cas9-Mbr-Ku + Mfo-ligD plasmids.

(2) The plasmid pDaual-sgRNA-lacZ was digested with Spe I restriction enzyme.

The enzyme digestion reaction system is as follows:

the Fhua-sgRNA-for-Gibson sequence is synthesized by the gene, and the sequence is shown in SEQ ID NO. 19.

SEQ ID NO.19(FhuA)：

tttaacttgctatttctagctctaaaacGCGGATAAAGGCCATTATCTactagtattatacctaggactgagctagctgtca。

Using Gibson

The Master Mix kit carries out ligation reaction on a SpeI enzyme-digested pDual-sgRNA-lacZ plasmid and an FhuA-sgRNA-for-Gibson sequence, wherein the ligation reaction system is as follows:

the reaction conditions were 50 ℃ for ligation reaction for 1 h.

The ligation products were transformed into Top10 competent cells, plated on ampicillin-resistant LB plates, cultured overnight at 37 ℃, 8 single clones were selected the next day for sequencing, and the correctly sequenced plasmid was named pDual-sgRNA-Fhua.

(3) Plasmid pDual-Cas9-Msm-Ku + Msm-ligD, pDual-Cas9-Msm-Ku + Mtb-ligD, pDual-Cas9-Msm-Ku + Mfo-ligD and pDual-Cas9-Mbr-Ku + Mfo-ligD were separately transfected into MG1655 E.coli competent cells, coated on kanamycin-resistant LB plates, and cultured overnight at 30 ℃.

(4) Respectively selecting the monoclonals to LB culture medium for culturing at 30 deg.C and 220rpm, and culturing as bacterial liquid OD₆₀₀When the value reached 0.6, competent cells were prepared according to the standard electroporation competent cell preparation method.

(5) The four prepared electroporation competent cells were electroporated with the plasmid pDual-sgRNA-Fhua, respectively, coated with LB plates of kanamycin and ampicillin, and cultured overnight at 30 ℃.

(6) A single clone was picked up on an LB plate culture, and the FhuA gene was amplified by colony PCR, and the PCR amplification system and reaction procedure were as described in step (4) of example 3, with an extension time of 50 s.

PCR amplification primers of the FhuA gene are shown as SEQ ID NO.20 and SEQ ID NO. 21.

SEQ ID NO.20：GCTGGAACGCGCTGAAATTATGCGTG；

SEQ ID NO.21：CGCTTCGATTTCTACGCCACGTGCGC。

The PCR amplification results are shown in FIG. 4, and the PCR products successfully amplified were purified and analyzed by Sanger sequencing.

The PCR product of the Fhua gene was sequenced using SEQ ID NO.20 and SEQ ID NO.21, and the sequencing results showed that: all cloned Fhua genes have sequence deletions or insertions with different lengths, and the comparison results of partial sequencing results are as follows:

wherein, Fhua-1 and Fhua-2: the edited sequence of the FhuA gene of the pDual-Cas9-Msm-Ku + Msm-ligD plasmid is transformed;

fhua-3 and Fhua-4: the edited sequence of the FhuA gene of the pDual-Cas9-Msm-Ku + Mtb-ligD plasmid is transformed;

fhua-5 and Fhua-6: the edited sequence of the FhuA gene of the pDual-Cas9-Msm-Ku + Mfo-ligD plasmid is transformed;

fhua-7 and Fhua-8: the edited sequence of the FhuA gene of the pDual-Cas9-Mbr-Ku + Mfo-ligD plasmid is transformed;

Fhua-Ref: the original sequence of the FhuA gene of MG1655 Escherichia coli.

The above experimental results prove that Msm-Ku + Msm-ligD, Msm-Ku + Mtb-ligD, Msm-Ku + Mfo-ligD and Mbr-Ku + Mfo-ligD screened by the invention can be used as NHEJ system of Escherichia coli and used for gene editing of Escherichia coli.

In conclusion, the invention successfully screens out the Ku + ligD combination which is effective in the escherichia coli by jointly using the pDual-Cas9-Parental plasmid vector and the pDual-sgRNA-lacZ plasmid vector, introduces the NHEJ system into the escherichia coli, can efficiently edit genes in the escherichia coli, provides a new tool for related research, and has wide application value.

The applicant states that the present invention is illustrated in detail by the above examples, but the present invention is not limited to the above detailed methods, i.e. it is not meant that the present invention must rely on the above detailed methods for its implementation. It should be understood by those skilled in the art that any modification of the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific modes, etc., are within the scope and disclosure of the present invention.

Sequence listing

<110> Suzhou Jinzhi Biotechnology Ltd

<120> high throughput screening tool for enabling escherichia coli to obtain effective NHEJ system and application thereof

<130> 2021

<160> 25

<170> PatentIn version 3.3

<210> 1

<211> 9687

<212> DNA

<213> Artificial sequence

<400> 1

aaacagacga agaatccatg ggtatggaca tgccgctcgc cttccatggg tatggacagt 60

tttccctttg atatgtaacg gtgaacagtt gttctacttt tgtttgttag tcttgatgct 120

tcactgatag atacaagagc cataagaacc tcagatcctt ccgtatttag ccagtatgtt 180

ctctagtgtg gttcgttgtt tttgcgtgag ccatgagaac gaaccattga gatcatactt 240

actttgcatg tcactcaaaa attttgcctc aaaactggtg agctgaattt ttgcagttaa 300

agcatcgtgt agtgtttttc ttagtccgtt atgtaggtag gaatctgatg taatggttgt 360

tggtattttg tcaccattca tttttatctg gttgttctca agttcggtta cgagatccat 420

ttgtctatct agttcaactt ggaaaatcaa cgtatcagtc gggcggcctc gcttatcaac 480

caccaatttc atattgctgt aagtgtttaa atctttactt attggtttca aaacccattg 540

gttaagcctt ttaaactcat ggtagttatt ttcaagcatt aacatgaact taaattcatc 600

aaggctaatc tctatatttg ccttgtgagt tttcttttgt gttagttctt ttaataacca 660

ctcataaatc ctcatagagt atttgttttc aaaagactta acatgttcca gattatattt 720

tatgaatttt tttaactgga aaagataagg caatatctct tcactaaaaa ctaattctaa 780

tttttcgctt gagaacttgg catagtttgt ccactggaaa atctcaaagc ctttaaccaa 840

aggattcctg atttccacag ttctcgtcat cagctctctg gttgctttag ctaatacacc 900

ataagcattt tccctactga tgttcatcat ctgaacgtat tggttataag tgaacgatac 960

cgtccgttct ttccttgtag ggttttcaat cgtggggttg agtagtgcca cacagcataa 1020

aattagcttg gtttcatgct ccgttaagtc atagcgacta atcgctagtt catttgcttt 1080

gaaaacaact aattcagaca tacatctcaa ttggtctagg tgattttaat cactatacca 1140

attgagatgg gctagtcaat gataattact agtccttttc ctttgagttg tgggtatctg 1200

taaattctgc tagacctttg ctggaaaact tgtaaattct gctagaccct ctgtaaattc 1260

cgctagacct ttgtgtgttt tttttgttta tattcaagtg gttataattt atagaataaa 1320

gaaagaataa aaaaagataa aaagaataga tcccagccct gtgtataact cactacttta 1380

gtcagttccg cagtattaca aaaggatgtc gcaaacgctg tttgctcctc tacaaaacag 1440

accttaaaac cctaaaggct taagtagcac cctcgcaagc tcggttgcgg ccgcaatcgg 1500

gcaaatcgct gaatattcct tttgtctccg accatcaggc acctgagtcg ctgtcttttt 1560

cgtgacattc agttcgctgc gctcacggct ctggcagtga atgggggtaa atggcactac 1620

aggcgccttt tatggattca tgcaaggaaa ctacccataa tacaagaaaa gcccgtcacg 1680

ggcttctcag ggcgttttat ggcgggtctg ctatgtggtg ctatctgact ttttgctgtt 1740

cagcagttcc tgccctctga ttttccagtc tgaccacttc ggattatccc gtgacaggtc 1800

attcagactg gctaatgcac ccagtaaggc agcggtatca tcaacggggt ctgacgctca 1860

gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac 1920

ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac 1980

ttggtctgac agttacgttt ccaaccaatt aaccaattct gattagaaaa actcatcgag 2040

catcaaatga aactgcaatt tattcatatc aggattatca ataccatatt tttgaaaaag 2100

ccgtttctgt aatgaaggag aaaactcacc gaggcagttc cataggatgg caagatcctg 2160

gtatcggtct gcgattccga ctcgtccaac atcaatacaa cctattaatt tcccctcgtc 2220

aaaaataagg ttatcaagtg agaaatcacc atgagtgacg actgaatccg gtgagaatgg 2280

caaaagctta tgcatttctt tccagacttg ttcaacaggc cagccattac gctcgtcatc 2340

aaaatcactc gcatcaacca aaccgttatt cattcgtgat tgcgcctgag cgagacgaaa 2400

tacgcgatcg ctgttaaaag gacaattaca aacaggaatc gaatgcaacc ggcgcaggaa 2460

cactgccagc gcatcaacaa tattttcacc tgaatcagga tattcttcta atacctggaa 2520

tgctgttttc ccggggatcg cagtggtgag taaccatgca tcatcaggag tacggataaa 2580

atgcttgatg gtcggaagag gcataaattc cgtcagccag tttagtctga ccatctcatc 2640

tgtaacatca ttggcaacgc tacctttgcc atgtttcaga aacaactctg gcgcatcggg 2700

cttcccatac aatcgataga ttgtcgcacc tgattgcccg acattatcgc gagcccattt 2760

atacccatat aaatcagcat ccatgttgga atttaatcgc ggcctcgagc aagacgtttc 2820

ccgttgaata tggctcataa caccccttgt attactgttt atgtaagcag acagttttat 2880

tgttcatgat gatatatttt tatcttgtgc aatgtaacat cagagatttt gagacacaac 2940

gtggctttcc ctgcagggtt tgcagtcaga gtagaataga agtatcaaaa aaagcaccga 3000

ctcggtgcca ctttttcaag ttgataacgg actagcctta ttttaacttg ctatgctgtt 3060

ttgaatggtt ccaacaagat tattttataa cttttataac aaataatcaa ggagaaattc 3120

aaagaaattt atcagccata aaacaatact taatactata gaatgataac aaaataaact 3180

actttttaaa agaattttgt gttataatct atttattatt aagtattggg taatattttt 3240

tgaagagata ttttgaaaaa gaaaaattaa agcatattaa actaatttcg gaggtcatta 3300

aaactattat tgaaatcatc aaactcatta tggatttaat ttaaactttt tattttagga 3360

ggcaaaaatg gataaaaaat acagtatcgg cttagatatt ggcactaata gcgtgggttg 3420

ggccgttatt accgatgaat ataaagttcc gagcaagaaa ttcaaagttc tgggtaatac 3480

cgatcgccac agtattaaga agaatctgat cggtgcactg ctgtttgata gcggcgagac 3540

agccgaagcc acacgtctga aacgtaccgc acgtcgccgt tatacccgtc gtaaaaatcg 3600

tatttgttac ctgcaagaga tttttagcaa tgaaatggcc aaagttgatg acagtttttt 3660

ccaccgtctg gaagaaagtt ttttagtgga agaagataag aaacacgaac gccatccgat 3720

cttcggcaac atcgttgacg aagttgccta ccacgaaaag taccctacaa tttatcacct 3780

gcgcaaaaaa ctggttgata gcaccgacaa agccgacctg cgcttaatct atctggccct 3840

ggcccacatg atcaaatttc gcggccactt tctgattgaa ggtgacttaa accctgataa 3900

cagtgacgtt gacaaattat tcattcagtt agttcaaacc tataaccagc tgtttgaaga 3960

aaacccgatc aacgccagtg gtgttgacgc aaaagccatc ctgagtgccc gcctgagtaa 4020

aagccgccgt ttagaaaact taatcgcaca attaccgggt gagaagaaaa atggcttatt 4080

cggcaacctg attgccctga gtctgggctt aacccctaat ttcaaaagta acttcgacct 4140

ggccgaggac gccaagttac aactgagtaa agacacttat gatgacgatc tggataattt 4200

actggcccaa atcggtgacc agtacgccga tctgttttta gccgccaaga atttaagcga 4260

tgccatcctg ctgagtgata ttctgcgtgt gaatacagaa attacaaaag ccccgctgag 4320

cgcaagcatg attaagcgct atgacgagca ccatcaggac ttaaccctgc tgaaggcctt 4380

agttcgccaa cagctgccgg agaagtataa agaaatcttt tttgatcaga gcaagaacgg 4440

ttacgccggt tatattgacg gcggtgccag ccaggaagag ttttacaagt tcatcaaacc 4500

gatcctggag aaaatggatg gcacagagga actgttagtg aagctgaacc gtgaagattt 4560

actgcgcaag cagcgcacct tcgacaatgg cagcattccg catcaaattc atctgggtga 4620

attacatgcc attttacgtc gtcaggaaga tttttatccg ttcctgaaag acaaccgtga 4680

gaagatcgag aagattctga ccttccgcat cccgtactat gtgggcccgt tagcacgcgg 4740

taacagccgt ttcgcatgga tgacacgtaa aagtgaagag acaattaccc cttggaattt 4800

cgaagaggtg gtggacaaag gtgccagcgc ccagtctttt atcgagcgca tgacaaactt 4860

cgataagaat ttacctaatg agaaagtttt acctaaacat agcctgctgt atgaatactt 4920

cacagtttac aatgagttaa ccaaagtgaa atatgtgacc gaaggtatgc gtaaaccggc 4980

cttcttaagc ggcgagcaaa agaaggcaat cgtggatctg ttattcaaaa ccaatcgcaa 5040

agttacagtg aaacaactga aagaggacta tttcaagaaa attgaatgct tcgatagcgt 5100

ggagattagt ggcgtggagg accgttttaa tgccagctta ggtacatacc atgatctgtt 5160

aaaaattatt aaagataaag attttctgga taacgaagaa aatgaagata ttctggaaga 5220

tatcgtgctg accctgaccc tgtttgaaga tcgcgaaatg atcgaagagc gtctgaaaac 5280

ctatgcccat ctgttcgacg acaaagtgat gaaacagctg aagcgtcgcc gctacaccgg 5340

ttggggtcgc ttaagtcgca agctgatcaa cggtattcgt gacaaacaga gcggtaaaac 5400

catcctggat tttctgaaaa gcgatggttt cgccaaccgt aactttatgc agttaatcca 5460

tgacgatagc ctgacattta aagaagatat tcaaaaggcc caggttagcg gccaaggtga 5520

tagcttacac gaacacattg ccaatctggc aggcagtccg gccattaaaa aaggtatttt 5580

acaaaccgtt aaggtggttg atgaattagt gaaagtgatg ggccgccaca agcctgaaaa 5640

tatcgtgatt gaaatggccc gtgagaacca gaccacccaa aaaggccaga aaaacagtcg 5700

tgaacgcatg aagcgtatcg aagaaggtat taaagaactg ggcagccaaa tcctgaaaga 5760

gcatccggtt gagaacacac agttacaaaa cgaaaaactg tatttatact atctgcaaaa 5820

tggccgcgat atgtatgtgg accaggagct ggatattaac cgcctgagtg attatgatgt 5880

tgatcacatt gttccgcagt cttttttaaa ggatgatagc atcgacaata aggtgctgac 5940

ccgtagcgac aagaatcgcg gcaagagcga taacgttccg agcgaagaag ttgtgaagaa 6000

aatgaaaaat tactggcgcc agttactgaa cgccaagctg atcacccaac gcaagttcga 6060

caatctgacc aaagcagagc gtggtggttt aagcgaactg gacaaggccg gcttcatcaa 6120

gcgtcagtta gtggaaaccc gtcagatcac aaaacacgtg gcccagattc tggatagccg 6180

tatgaatacc aaatacgacg agaatgataa actgattcgt gaagttaaag ttatcaccct 6240

gaagagtaag ctggtgagcg acttccgtaa agactttcag ttctacaaag ttcgcgaaat 6300

taataattat catcatgcac atgatgcata cctgaacgcc gttgttggca cagccctgat 6360

caagaagtat cctaaactgg aaagcgagtt tgtttatggc gattacaagg tgtatgatgt 6420

gcgcaaaatg atcgccaaga gtgagcagga aatcggtaaa gccaccgcca aatacttttt 6480

ctacagtaac attatgaatt ttttcaagac cgaaatcacc ttagcaaacg gcgagatccg 6540

caaacgcccg ctgatcgaaa ccaatggtga aaccggcgag attgtttggg ataagggtcg 6600

cgactttgca accgttcgca aggtgctgtc tatgcctcag gtgaatattg ttaagaaaac 6660

cgaagtgcaa accggcggct ttagtaaaga aagcatcctg ccgaaacgca atagcgacaa 6720

actgattgcc cgtaaaaaag actgggaccc taagaagtac ggcggttttg atagccctac 6780

cgtggcatac agcgttctgg ttgtggccaa agtggaaaag ggcaagagta agaagctgaa 6840

gagtgttaaa gagctgctgg gcatcaccat catggaacgt agcagcttcg agaaaaatcc 6900

gatcgatttc ctggaggcaa aaggttacaa agaagttaaa aaagatttaa tcatcaaatt 6960

acctaaatac agcctgttcg agctggagaa tggtcgcaaa cgtatgctgg caagcgccgg 7020

cgaattacaa aaaggtaatg aactggcact gccgagcaag tacgttaact tcttatattt 7080

agcaagccat tacgagaaat taaaaggtag tccggaggat aacgagcaga agcagttatt 7140

tgttgagcag cataaacatt acctggatga gattattgag cagattagtg agttcagcaa 7200

gcgcgtgatt ctggcagatg ccaacctgga taaggttctg agcgcctata acaaacaccg 7260

cgacaagccg attcgcgaac aagcagagaa cattattcat ctgttcacac tgaccaacct 7320

gggcgccccg gcagccttca agtattttga taccaccatc gaccgcaaac gctatacaag 7380

caccaaagag gttctggacg ccaccctgat tcaccaaagc attaccggct tatatgaaac 7440

ccgcatcgac ctgagtcagt taggcggtga ctaaagtata ttttagatga agattatttc 7500

ttaatctaga catgagcgga tacatatttg aatgtattta gaaaaataaa caaatagggg 7560

ttccgcgcac atttccccga aaagtgccac ctgcatcgat ttattatgac aacttgacgg 7620

ctacatcatt cactttttct tcacaaccgg cacggaactc gctcgggctg gccccggtgc 7680

attttttaaa tacccgcgag aagtagagtt gatcgtcaaa accaacattg cgaccgacgg 7740

tggcgatagg catccgggtg gtgctcaaaa gcagcttcgc ctggctgata cgttggtcct 7800

cgcgccagct taagacgcta atccctaact gctggcggaa aagatgtgac agacgcgacg 7860

gcgacaagca aacatgctgt gcgacgctgg cgatatcaaa attgctgtct gccaggtgat 7920

cgctgatgta ctgacaagcc tcgcgtaccc gattatccat cggtggatgg agcgactcgt 7980

taatcgcttc catgtgccgc agtaacaatt gctcaagcag atttatcgcc agcagctccg 8040

aatagcgccc ttccccttgc ccggcgttaa tgatttgccc aaacaggtcg ctgaaatgcg 8100

gctggtgcgc ttcatccggg cgaaagaacc ccgtattggc aaatattgac ggccagttaa 8160

gccattcatg ccagtaggcg cgcggacgaa agtaaaccca ctggtgatac cattcgcgag 8220

cctccggatg acgaccgtag tgatgaatct ctcctggcgg gaacagcaaa atatcacccg 8280

gtcggcaaac aaattctcgt ccctgatttt tcaccacccc ctgaccgcga atggtgagat 8340

tgagaatata acctttcatt cccagcggtc ggtcgataaa aaaatcgaga taaccgttgg 8400

cctcaatcgg cgttaaaccc gccaccagat gggcattaaa cgagtatccc ggcagcaggg 8460

gatcattttg cgcttcagcc atacttttca tactcccgcc attcagagaa gaaaccaatt 8520

gtccatattg catcagacat tgccgtcact gcgtctttta ctggctcttc tcgctaacca 8580

aaccggtaac cccgcttatt aaaagcattc tgtaacaaag cgggaccaaa gccatgacaa 8640

aaacgcgtaa caaaagtgtc tataatcacg gcagaaaagt ccacattgat tatttgcacg 8700

gcgtcacact ttgctatgcc atagcatttt tatccataag attagcggat cctacctgac 8760

gctttttatc gcaactctct actgtttctc catacccgtt tttttgggaa ttcgagctct 8820

aaggaggtta taaaaaagag accattccat tccggtctca aagcttgggc ccgaacaaaa 8880

actcatctca gaagaggatc tgaatagcgc cgtcgaccat catcatcatc atcattgagt 8940

ttaaacggtg tccagcttgg ctgttttggc ggatgagaga agattttcag cctgatacag 9000

attaaatcag aacgcagaag cggtctgata aaacagaatt tgcctggcgg cagtagcgcg 9060

gtggtcccac ctgaccccat gccgaactca gaagtgaaac gccgtagcgc cgatggtagt 9120

gtggggtgtc cccatgcgag agtagggaac tgccaggcat caaataaaac gaaaggctca 9180

gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg gtgaactgga tccttactcg 9240

agaagaaacc aattgtccat attgcatcag acattgccgt cactgcgtct tttactggct 9300

cttctcgcta accaaaccgg taaccccgct tattaaaagc attctgtaac aaagcgggac 9360

caaagccatg acaaaaacgc gtaacaaaag tgtctataat cacggcagaa aagtccacat 9420

tgattatttg cacggcgtca cactttgcta tgccatagca tttttatcca taagattagc 9480

ggatcctacc tgacgctttt tatcgcaact ctctactgtt tctccatacc cgtttttttg 9540

ggaattcgag ctctaaggag gttataaaaa aagtcttcat tccattccga agacaacaca 9600

aagcatcttc tgttgagtta agaacgagta tcgagatggc acatagcctt gctcaaattg 9660

gaatcaggtt tgtgccaata ccagtag 9687

<210> 2

<211> 2403

<212> DNA

<213> Artificial sequence

<400> 2

tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60

cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120

ttggcgggtg tcggggctgg cttaaaagct tctgcaggtc gactctagag aattcaaaaa 180

aagcaccgac tcggtgccac tttttcaagt tgataacgga ctagccttat tttaacttgc 240

tatttctagc tctaaaactc gttttacaac gtcgtgacac tagtattata cctaggactg 300

agctagctgt caaggatcca gcatatgcgg tgtgaaatac cgcacagatg cgtaaggaga 360

aaataccgca tcaggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca 420

ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg 480

taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 540

agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 600

cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 660

tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 720

tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata 780

gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 840

acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 900

acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 960

cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 1020

gaagaacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 1080

gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 1140

agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 1200

ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 1260

ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 1320

atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 1380

tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 1440

gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 1500

ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 1560

caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 1620

cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct 1680

cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 1740

cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 1800

agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 1860

tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 1920

agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac 1980

atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 2040

ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 2100

cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 2160

caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc ctttttcaat 2220

attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt gaatgtattt 2280

agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca cctgacgtct 2340

aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg aggccctttc 2400

gtc 2403

<210> 3

<211> 982

<212> DNA

<213> Artificial sequence

<400> 3

cccagtcacg acggtctcaa aaaatgaatc gcacaccgtc tttacacacc aaagagaaaa 60

aaggcttcat cgacatgcac accatgtgga aaggcagcat cagctttggt ttagtgaaca 120

tcccgattaa gctgtacgca gccaccgaag ataaagatat taaattacgc tctttacata 180

aagaagatca tgccccgatt aaatatgaaa aagtgtgtac caactgcgag aaaactttaa 240

gccccgatga gatcgtgaaa ggctatgagt atgtgaaagg caagtatgtg gtgctgaccg 300

atgaggatct gaagagtctg aagcaagaac atgaggaaaa ggccgttgag atcgtggact 360

tcgttcagct gcaagaaatc gacccgatct acttcaaccg cagctacttt gtgggccccg 420

gtgataacgg caccaaagcc tataccttac tgcgcgaagc tttacgcagc accggtaaaa 480

tcggcattgc caacatgacc attcgcagca agcaacagct ggccattctg cgtgtgtacg 540

agaactgcat cgtgatggag agcatccatt atccggacga agtgcgtagc gcagcacaag 600

ttccgggtgt tccggaccag agcaacgtga acgacaaaga gctgcagacc gcaattactt 660

taattgatga gctgaccgcc aagttcgagc cggaaaaata cgaggacacc taccgtcaag 720

ctttactgca gcgcgtgaac gataagctgg aaaacaagga aaccgcagtg accccggata 780

aagcaccgcc gcgcgaagat gttatcgatc tggtgagtgc tttacaagct agcattgatc 840

gtacccgtcg cccgaatcgt gaaacacccg ctgcagcacc ggcacaagct gcagaaccga 900

agggtgccgg tgacaaaaaa cagaaaacca cccgcaaaaa agcaagcggc accagctaaa 960

agccgagacc tcctgtgtga aa 982

<210> 4

<211> 985

<212> DNA

<213> Artificial sequence

<400> 4

cccagtcacg acggtctcaa aaaatgcgca gcatctggaa aggcagtatc gcattcggtt 60

tagttaacgt gccggtgaaa gtttacagcg ccaccgagga tcacgacatc aagttccacc 120

aagttcatgc caaagacaat ggccgcatcc gctataaacg cgtgtgcgaa gtgtgcggcg 180

aagtggtgga atttcgcgat attaataaag cctatgaaag cgacgacggt cagatggtgg 240

tgattaccga cgaggatatt gctactttac cggaagaacg tagtcgcgag attgaggtgg 300

tggagtttat cccggccgaa caactggatc cgctgatgta cgataagagc tactttctgg 360

agccggatag caaaagcagc aagagctacg tgctgctggc aaaaacttta gccgaaactg 420

aacgcgttgc cattgtgcac ttcagcttac gcaataaaac ccgtttagca gcactgcgcg 480

ttaaggattt cagcaagcgc aacgtgatgg tgatccatac tttactgtgg ccggatgaaa 540

ttcgtgaccc ggattttccg gtgctggaca aggaagtgga gatcaaaccg gccgaactga 600

agatggccgg ccaagttgtg gaaagcatga ccgacgattt ccacccggac cagtttcgcg 660

atgattatca agctcagctg tatgagctgg ttcaagccaa actggaaggc ggcgaagcat 720

tcagtgtgga agaacagccg gccgatctgg atgaaaccga ggatgtttct gatctgctgg 780

ccaagctgga agccagcgtg aaagcccgta aaggcggtgg tagcgcaaaa agcgataagg 840

acagcgacga ggatagcgat aaggatagcg atgacgagga agcaaagccg gccaaaaagg 900

caccggctaa aaaagcagca gccaagaaag ccccggctaa aaaagccgcc gccaaaaaat 960

aaaagccgag acctcctgtg tgaaa 985

<210> 5

<211> 1033

<212> DNA

<213> Artificial sequence

<400> 5

cccagtcacg acggtctcaa aaaatgaatc gtgcagtgcg ccataccggt ctgatgcgca 60

gcatctggaa aggtagcatc gcatttggtt tagtgaatgt gccggtgaaa gtgtacagcg 120

ccaccgaaga tcacgatatc aaatttcatc aagttcatgc caaggataac ggccgcatcc 180

gttacaaacg tgtgtgcgag gtgtgcggcg aagtggtgga atatcgtgat atcaataaag 240

cctttgaaag tgatgacggc cagatggtgg tgattaccga tgaggacatc gcaactttac 300

ccgaagaacg cagccgtgag attgaagtgg tggagttcat cccggcagag caactggatc 360

cgctgatgta cgacaagagc tacttcttag agccggacag caagagcagc aagagttatg 420

tgctgctggc caaaacctta gccgaaaccg accgcatcgc aatcgtgcac ttttctttac 480

gcaataaaag ccgtttagca gctttacgcg tgaaagactt cagcaagcgc gacgtgatga 540

tgattcacac tttactgtgg ccggatgaga tccgcgaccc ggattttccg attttagata 600

aagaagttca gatcaaaccg gccgagctga aaatggctgg tcaagttgtg gagagcatga 660

ccgacgactt caagcccgat ctgtaccacg atgactacca agaacagtta cgtgaactgg 720

tgcaagctaa actggaaggt ggcgaagcat tcagcgtgga agaacagccg gccgaactgg 780

atgaaggtac cgaggacgtg agcgatctgt tagccaagct ggaagcaagc gtgaaagccc 840

gtaagggcgg caaaagcgat agcaaggacg atagcgacag cgagagcgac agcaaagaga 900

gcaaaagcga cagtaagccg gccaaaaaag cccccgctaa gaaagccgca gccaagaaaa 960

gcaccgctaa aaaagccccg gctaaaaaag cagccgccaa gaaatcttaa aagccgagac 1020

ctcctgtgtg aaa 1033

<210> 6

<211> 868

<212> DNA

<213> Artificial sequence

<400> 6

cccagtcacg acggtctcaa aaaatgcgtg ccatttggac cggcagcatt gcatttggtt 60

tagtgaatgt gccggtgaaa gtttacagcg ccaccgcaga tcacgatatt cgtttccacc 120

aagttcatgc caaggataat ggccgcatcc gctataaacg cgtttgcgag gcatgtggcg 180

aagtggtgga ttatcgcgat ctggcacgtg cctatgagag cggtgatggc cagatggtgg 240

ccattaccga tgacgacatt gcctctttac cggaagagcg tagccgcgaa attgaggtgc 300

tggagttcgt tccggccgcc gatgtggacc cgatgatgtt cgaccgcagc tattttttag 360

aaccggacag caagagcagc aaaagctacg tgttactggc caaaacttta gccgaaaccg 420

atcgtatggc catcgtgcat tttactttac gcaataaaac ccgtttagcc gctttacgcg 480

tgaaagactt cggcaaacgt gaagtgatga tggtgcacac cttactgtgg ccggatgaga 540

ttcgcgatcc ggattttccg gtgctggacc agaaggtgga aatcaaaccg gccgagctga 600

aaatggctgg tcaagttgtg gatagcatgg cagacgactt taacccggat cgctatcacg 660

acacctatca agaacagctg caagaactga ttgatacaaa gctggagggt ggccaagctt 720

ttaccgccga agatcagccg cgtttactgg atgaaccgga ggatgtgagt gatctgctgg 780

ctaaactgga agcaagcgtg aaggcccgca gcaaagcaaa cagcaatgtg cctaccccgc 840

cgtaaaagcc gagacctcct gtgtgaaa 868

<210> 7

<211> 1000

<212> DNA

<213> Artificial sequence

<400> 7

cccagtcacg acggtctcaa aaaatgcgca gcatctggaa aggcagcgtg gcctttggtt 60

tagttaatgt gccggtgaaa ctgtacagcg caaccgaaga gaaggacatc cgctttcatc 120

aagttcatgc ccaagatggt ggccgcatca aatataaacg cgtgtgcgat ctggacggcg 180

aggaagtgcc gtatgccgat attgccaaag cctacgaaag cgacgatggt cgcacaatca 240

tgctgaccga tgaggatttt gctcagctgc cggccagcag cagccgcgaa atcgatgttg 300

tgagctttgt gcctagtgac caagttgatc ccgttctgta tgataaaacc tactatctgg 360

agcccgctag caccagcacc aaagcctatg tgttactgcg ccagacttta gaacagaccg 420

accgtattgc catcgtgaac ttcgcactgc gccagaaaac ccgtttagca gctttacgtg 480

ttcgtgatga tgtgctggtg atccagacac tgctgtggcc ggatgaagtg cgcgccgcag 540

aatttgcctc tttagaggaa agcgtgagca ttaaaccggc cgaactgaag atggccagca 600

tgctggtgga tagtttcgcc gatgacttcc acccggagga ctataccgat gagtatcgcg 660

aagagctgca gcaactgatc gaagccaaac tggaaggcgg cgaagccttt gaaactccgg 720

aaaaaccgga tgaaggtgag gatgctgaag tggttgatct gctggcagct ctgcagcgca 780

gcgttgagcg ccataaaaaa gctggtgcaa gcaccggcga tgatagtggc gatggcgccg 840

atgatagtcc gaaaaagagc ccgcgcacca gcagcgcaaa aacccgcacc aaagccaccg 900

atgaaaccgg tgaccaagat aaagacgagg caaaaccgcc gacacgccgt cgtagtccgg 960

cacgtaaaac cggttaaaag ccgagacctc ctgtgtgaaa 1000

<210> 8

<211> 1884

<212> DNA

<213> Artificial sequence

<400> 8

cccagtcacg acgaagacgc aaaaatggca ttcaccatgc agccggtgtt aacaagcagc 60

ccgcctatcg gtgcagagtg gcgctatgag gtgaagtacg acggttaccg ctgcattctg 120

cgtattcata gcagcggcgt gactttaacc agtcgtaacg gtgttgagct gagcagtaca 180

ttcccggaga tcacccagtt cgccaaaacc gcatttcagc atctggaaaa ggaactgccg 240

ctgactttag atggtgaaat tgtgtgtctg gtgaacccgt gtcgcgcaga tttcgagcat 300

ctgcaagttc gtggtcgttt aaagcgcccg gataaaatcc aagaaagtgc caacgcccgc 360

ccgtgttgtt ttctggcctt cgatttactg gaacgtagcg gcgaagatgt gactttactg 420

agctatttag accgcaagaa atctctgcgt gagctgatca gcgccgcaaa actgccggcc 480

agccccgatc cgtacgccaa ggaaaccatc caaagcatcc cgtgctacga ccatttcgat 540

cagctgtggg agatggtgat caagtacgac ggcgaaggca tcgtggcaaa gaaaaccaac 600

agcaagtggc tggaaaagaa acgcagcagc gattggctga aatacaaaaa ctttaaacaa 660

gcttacgttt gtattaccgg ctttaatcct aataatggct ttttaaccgt gagcgttctg 720

aaaaacggca tcatgacacc gattgcaagc gtgagtcacg gcatgcgcga tgaggagaaa 780

agtgcaattc gcgagattat ggaacagcac ggtcaccaga caccgagcgg cgagttcact 840

ttagaaccga gtatttgtgc cgcagtgcag tatttaacca ttctgcaagg taccttacgt 900

gaagtgagct tcatcggctt tgagttccag atggactgga cagagtgcac ctatgcccaa 960

gttatccgcc atagcaaacc ggtgcaccct aagctgcagt ttaccagtct ggataagatt 1020

atctttgaga aaaataagaa aaccaaagaa gatttcattc aatatatgat cgaggtgagt 1080

gattatctgc tgccgtttct gaagaatcgc gccgtgaccg tgatccgtta tccgcacggc 1140

agtcgcagcg aaagcttttt tcagaagaac aaaccggact acgcccccga ttttgtgcag 1200

agcttttacg atggcagcca cgagcacatc gtttgcgaag atatgagcac actgctgtgg 1260

ctgtgcaatc agctggcact ggagttccat gtgccgtttc agacaatcaa gagccgccgt 1320

ccggcagaga ttgttatcga tttagacccg cctagccgcg acgatttttt aatggccgtg 1380

caagctgcca atgagctgaa acgtctgctg gatagcttcg gtatcaccag ttacccgaag 1440

ctgagcggta acaagggcat ccagctgtat atccctctga gcccggaggc atttacctac 1500

gaagaaaccc gccagttcac acagctgatt gccgagtact gcaccaacgc atttcccgaa 1560

ctgttcacaa ccgagcgttt aatcaaaaac cgtcattgca aactgtatct ggattattta 1620

cagcacgccg aaggcaaaac cattatctgc ccgtacagca cccgtggtaa tgagttaggt 1680

accgtggccg caccgctgta ttggcatgaa gttcagagta gtctgacccc ggctttattc 1740

acaattgaca ccgttattga tcgtattaaa aaacaaggtt gcccgttttt tgatttctat 1800

cgcaacccgc aagatgaacc gctgagcgcc attctgcacc agttaaagaa gaaatcttaa 1860

cacaaggtct tctcctgtgt gaaa 1884

<210> 9

<211> 1884

<212> DNA

<213> Artificial sequence

<400> 9

cccagtcacg acgaagacgc aaaaatggtt ctgacaatgc agccgatttt aaccagcgag 60

ccccccgaag gtagtgaatg gcgttacgag gtgaagtacg acggtttccg ctgtttactg 120

cgtatcgacg aaagtggtgt tactttaaca agccgcaatg gtcagacttt aaccaaccag 180

ttcccggaaa ttaccgcatt cgccgcccgc tgcttccagc atatgaagga tcgttttccg 240

atcactttag acggtgagct ggtgtatctg atcaatccgt atcgcgccga ctttgaacat 300

ttacagattc gcggccgctt aaaacgtaca gaaagcatcg aaagcacagc cgatcgccgt 360

ccgtgtcgtt ttctggcctt tgatttactg gtgttagagg gcgccggtac cgtttcttta 420

ccgtatgtga aacgcaagcg cgcactgagc aaactgttca aagaggccaa tctgccggct 480

tgtccgcacc atctggcaga agaggccatc cagtacattc cggaacatac cgatttcgac 540

gctttatggg ataaagtggt gcgccatgat ggtgaaggcg ttgtggccaa acgcgccagt 600

agtggttggg cagagaacaa gcgtagcccg gactggcaaa aatacaaaca tatgaaaact 660

gctcatgttc tgctgaccgg ctttaaccct aagaacggct acgtgaccgc aagcgtgctg 720

aaagatggca ccgccattcc tattgccagc gtgagccatg gtatgcaagc tgaggaaaag 780

aatgcagtgc gcaccattat ggaaactcac ggcaaaaagc agaagagtgg tgaatatact 840

ttagagccga gcatttgcat gaccgtgcaa tatttaacca ttttacaaga tactttacgc 900

gaggtgagct ttgtgagctt ccaatttgaa atggattgga cagagtgcac ctaccagcaa 960

ctgattctgc gcagcaagac tttaccgccg aaactgcagt ttacctcttt agacaaaatt 1020

gtttttaaaa aacgcgaaaa aaccaaagca gatttcttaa gctacatggt gaaaatgagc 1080

gattttttaa tgccttttct gaaagaccgc gccgtgaccg ttatccgcta tccgcatggt 1140

gcacccggtg aaagtttctt ccagaaaaat aagccggact acaccccgga ctttgttagt 1200

agcgtgtttg acggcagcca cgaacacatc gtttgtagta gcattccgtc tttactgtgg 1260

ctggcaaacc agctggcttt agagtttcac gttccgtttc agaccgtgca tagcgaacgc 1320

ccggccgaaa tcgttattga tttagatccg cctagccgca acgatttccc gatggccgtg 1380

gaagcagcac acgttctgaa gcagctgttt gacagcttca gcatcaccag tttcccgaaa 1440

ctgagcggca acaagggcat tcagctgtac attcctctga gcccggaggc ctttacctac 1500

gaagaaaccc gcgcctttac catgctgatc gcagactact gtgttcgcac acgccccgat 1560

ttatttacaa ccgagcgctt catcaaaaac cgcaatggcc gtctgtatct ggactatctg 1620

cagcacgccg agggtaagac aattattgcc ccgtatagta cccgcggtaa cgaactgggc 1680

acagttgccg caccgctgta ctggagcgag gtgaacagct ctttaacccc cgatgactat 1740

actatcgaca cagtggtgaa ccgcgtgcgc accgaaggcg atccgttcta cgacttctat 1800

cgcaatccgc aagatggccc gctgagcatc gtgttagagc agattaagcg taaaagctaa 1860

cacaaggtct tctcctgtgt gaaa 1884

<210> 10

<211> 2325

<212> DNA

<213> Artificial sequence

<400> 10

cccagtcacg acgaagacgc aaaaatggaa cgctatgaac gtgtgcgttt aaccaacccc 60

gataaggttc tgtaccccgc tagcagcacc accaaagcag aggtgtttga ttattatctg 120

agcatcgccg aagttatgct gccgcatatt gccggtcgtc cggttacccg taaacgttgg 180

ccgaatggtg tggcagaagc cagcttcttc gaaaagcaac tggccagtag tgcaccggat 240

tggctggaac gtggcaccat tgtgcataag agcggcacca ccacctaccc tatcgttaac 300

acccgcgaag gcttagcatg gatcgcccag caagcttctt tagagctgca tgttccgcaa 360

tggcgcttta gcagcgatgg cagccaaggt ccggcaaccc gtatcgtgtt cgatttagat 420

ccgggtgaag gcgttacaat gcctcagctg tgcgaggttg cccaagccgt gcgcgaactg 480

atgagcgaca tcggcttaat gacctatccg ctgaccagtg gtagcaaagg tttacattta 540

tacgttccgc tggcagaccc tatcagcagc cgcggtgcaa gcgttctggc caagcgcgtt 600

gcagtgcagc tggagcaagc tatgccgaag ctggttaccg caaccatgac ccgcagtctg 660

cgcgcccaga aagtgttttt agactggagt cagaataatg cagccaagac cacaatcgca 720

ccgtattctt tacgcggtcg tgattacccg accgttgcag caccgcgtac atgggatgaa 780

attggcgacc cggatttacg ccatctgcgt ttcgacgaag ttctgcagcg catcagtgac 840

gatggcgatt tattagctgg tttagatgac gatgccccgg ttgccgataa actgaccacc 900

tatcgcagca tgcgcgatgc aacaaaaacc ccggaacccg ttccgcgcga tatcccggtt 960

cgcggtaaca acgatcgttt cgttattcaa gaacatcacg cacgtcgttt acattatgat 1020

ctgcgtctgg aacgtgatgg cgtgctggtt agctgggcag ttccgaaaaa tttaccggac 1080

accaccgccg ttaatcattt agccgtgcac acagaagatc accctatcga gtatttaacc 1140

tttcacggca caattccgaa gggcgagtat ggtgctggta atatggtgat ctgggacacc 1200

ggtacctatg aggccgagaa attccgcgtt ccggccgatc cggatgacag cgatgcaccg 1260

aagggtgaag ttatcttcac tttaaatggt aaccgcatcg atggccgtta cgcactgatc 1320

cagaccgaag gtaagaactg gctggcacat cgcatgaagg atcagagcag cgccgcaccc 1380

gaaccgaaag acttcgcccc gatgttagca accgaaggca gtgtggccaa gctgaaggcc 1440

acccagtggg ccttcgaagg taaatgggac ggctaccgct tactggtgga ggccgaacat 1500

ggtcgcttac aactgcgtag tcgccgcggc cgtgatgtta ccgccgagta tccgcagttt 1560

gaagcactgg ccgccgatct ggccgatcat catgtggtgc tggatggtga agccgttgcc 1620

ttagacgatc acggcatgcc gagcttccgc gagatgcaga accgcgcacg cagtacacgt 1680

gttgagttct gggcctttga tattttatgg ctggatggtc gctctttact gcgcgcaaaa 1740

tacacagacc gccgcaaact gctggaagca ctggcagctg gtggtggtct gattgtgccg 1800

gaacagctgg ctggtgatgg tccggaggcc atggaacacg cacgtgagca caaattcgag 1860

ggcgtggtgg ctaaaaaacg cgatagcacc taccagcccg gtcgtcgtag tgccagctgg 1920

atcaaagaca aaatctggaa cacccaagaa gttgttatcg gcggttggcg ccaaggcgaa 1980

ggtggccgta gcagtggcat tggcgcttta gttctgggtg tgccgggtcc tcatggttta 2040

caatttgctg gtcgtgttgg caccggcttc accgaaaagg aactgaccaa actgaaaggt 2100

atgctgaaac cgctgcacac caaagagagc ccgtttgata agccgctgcc gaaactggat 2160

gccaaaggcg tgaccttcgt gcgccccgaa ctggttggcg aggtgcgcta tagtgaacgt 2220

acaaccgacc accgtttacg ccagcctagt tggcgtggtc tgcgtccgga caaagcaccg 2280

gacgaagtgg tgtgggagta acacaaggtc ttctcctgtg tgaaa 2325

<210> 11

<211> 2316

<212> DNA

<213> Artificial sequence

<400> 11

cccagtcacg acgaagacgc aaaaatggaa cgctacgaac gtgtgcgttt aaccaacccc 60

gataaggtgc tgtaccccgc taccggcacc accaaagccg aagtgtttga ttattattta 120

agcattgcac aagttatggt gccgcacatc gccggtcgtc cggttacacg taaacgctgg 180

ccgaatggcg tggccgaaga agcattcttt gagaagcagc tggccagcag tgccccgagt 240

tggttagaac gcggcagcat tacccataaa agcggcacca ccacctaccc tatcattaac 300

acccgcgaag gtctggcatg ggttgcccag caagcttctt tagaagtgca tgtgccgcag 360

tggcgctttg aagatggtga ccaaggtccg gcaacccgta tcgttttcga tttagacccg 420

ggtgagggcg tgaccatgac ccagctgtgc gaaatcgccc acgaagtgcg cgctttaatg 480

accgatctgg atttagagac atacccgctg acaagcggca gcaaaggttt acatctgtac 540

gttccgctgg cagaaccgat tagcagccgt ggtgcaagcg ttctggcacg ccgtgtggca 600

cagcagctgg aacaagctat gccgaaactg gttaccgcca ccatgaccaa atctttacgt 660

gctggtaagg tgtttctgga ttggagccag aacaacgcag caaaaaccac catcgccccg 720

tatagtttac gcggtcgtga ccatcctaca gtggccgccc ctcgcacttg ggacgaaatt 780

gccgatccgg aactgcgcca tttacgcttt gatgaggtgc tggaccgtct ggacgaatac 840

ggtgatctgc tggcacctct ggacgcagac gccccgattg ccgataagct gacaacctac 900

cgtagtatgc gcgacgcaag taaaaccccg gaaccggtgc cgaaagaaat tccgaaaact 960

ggtaataatg acaaattcgt gatccaagaa catcatgccc gtcgtttaca ctacgactta 1020

cgtttagagc gcgacggcgt gctggttagt ttcgccgtgc ctaaaaattt accggaaacc 1080

accgcagaaa accgtttagc cgttcacacc gaagatcacc cgattgaata tttagccttc 1140

cacggtagca tccctaaagg cgagtatggt gccggcgata tggtgatttg ggacagcggc 1200

agttatgaaa ccgagaaatt ccgcgtgccg gaagaactgg ataacccgga cgacagccac 1260

ggtgaaatca tcgtgacttt acacggcgaa aaggttgacg gccgttacgc tttaattcaa 1320

accaagggca aaaactggct ggcccaccgt atgaaagacc agaaaaacgc ccgtccggag 1380

gattttgccc ctatgctggc caccgaaggc agtgtggcca aatacaaggc caaacaatgg 1440

gccttcgagg gtaaatggga tggctaccgt gtgattatcg acgccgatca tggtcagctg 1500

cagatccgta gccgtaccgg ccgtgaagtt accggcgagt atccgcagtt taaagcttta 1560

gccgcagatc tggcagagca tcacgttgtt ctggacggcg aggccgttgc cttagatgag 1620

agcggcgtgc cgagttttgg ccagatgcag aatcgcgccc gtagcacccg tgtggagttt 1680

tgggccttcg atattttatg gttagacggt cgttctttac tgcgtgcaaa gtatagcgat 1740

cgccgtaaaa ttttagaagc tttagcagac ggtggtggtc tgattgtgcc cgatcaactg 1800

ccgggtgacg gccccgaagc catggaacac gtgcgtaaaa agcgcttcga gggtgtggtt 1860

gccaaaaagt gggatagcac ctaccagccc ggtcgtcgca gcagcagctg gatcaaagat 1920

aaaatttgga atacccaaga agttgttatt ggcggttggc gtcaaggtga gggtggtcgc 1980

agcagtggta ttggcgcttt agttctgggc attccgggtc ccgaaggttt acagttcgtg 2040

ggtcgtgttg gcaccggttt taccgaaaaa gaactgagta agctgaaaga tatgctgaag 2100

ccgctgcata ccgatgaaag cccgttcaac gcaccgctgc cgaaagtgga tgcccgtggc 2160

gtgacctttg tgcgccccga actggtgggc gaagtgcgtt atagcgagcg caccagcgat 2220

ggtcgtttac gtcaacctag ttggcgtggt ttacgcccgg ataagacacc ggatgaggtg 2280

gtttgggaat aacacaaggt cttctcctgt gtgaaa 2316

<210> 12

<211> 2328

<212> DNA

<213> Artificial sequence

<400> 12

cccagtcacg acgaagacgc aaaaatgggc agcgcaagcg aacagcgcgt taccttaacc 60

aacgccgaca aagtgctgta tccggcaacc ggtaccacca aaagcgacat tttcgactac 120

tatgctggtg tggcagaggt gatgctgggt catattgccg gtcgcccggc aacccgtaaa 180

cgctggccga atggcgttga tcagccggca tttttcgaga agcagctggc tttaagtgca 240

cccccttggc tgagccgtgc caccgttgca caccgtagtg gtaccaccac ctaccctatc 300

attgatagcg ccaccggtct ggcttggatt gcacagcaag ccgcactgga agtgcacgtg 360

ccgcagtggc gtttcgtggc cgaaccgggt agtggcgaat taaatcccgg tccggctacc 420

cgtttagtgt tcgatctgga tccgggcgag ggtgtgatga tggcacagct ggccgaagtt 480

gcacgcgcag tgcgtgactt actggcagac attggcttag tgacctttcc ggtgacaagc 540

ggcagtaaag gtctgcattt atacaccccg ctggatgaac cggtgagtag tcgcggcgcc 600

acagtgctgg caaaacgtgt tgcacagcgt ttagagcaag caatgcccgc tctggtgacc 660

agcacaatga ccaaaagtct gcgcgccggc aaggtgtttg tggattggag tcagaacagc 720

ggcagcaaga ccacaattgc accttatagt ctgcgcggtc gtacccatcc gaccgttgca 780

gccccgcgta catgggcaga actggacgat cccgctctgc gccagctgag ctatgacgaa 840

gttctgacac gcattgcccg cgatggcgat ctgctggaac gtttagatgc agatgcaccg 900

gttgcagatc gtttaacccg ctaccgtcgt atgcgtgatg caagcaaaac ccccgaaccg 960

atcccgaccg ccaagcccgt taccggtgac ggtaacacat tcgtgattca agaacatcat 1020

gcccgtcgcc cgcactatga ttttcgttta gaacgtgatg gcgtgctggt gagttgggcc 1080

gttccgaaaa atctgccgga taacaccagc gttaaccatt tagccattca caccgaggat 1140

cacccgctgg agtatgccac ctttgagggc gcaattccta gcggtgaata tggtgccggc 1200

aaagtgatca tctgggacag tggcacctat gataccgaga aatttcatga tgacccgcac 1260

accggtgagg tgatcgttaa tttacatggt ggccgtatca gcggtcgcta cgcactgatt 1320

cgcaccaatg gcgaccgctg gctggcccat cgtttaaaga atcagaaaga tcagaaagtg 1380

ttcgagtttg ataatctggc ccctatgctg gcaacccacg gtacagtggc cggtctgaag 1440

gccagccagt gggcatttga aggcaaatgg gatggctacc gcttactggt tgaagcagat 1500

cacggtgcag tgcgtctgcg cagtcgtagc ggccgtgatg tgaccgccga atatccgcag 1560

ctgcgcgctt tagcagaaga tttagcagat catcacgttg tgctggatgg tgaggccgtg 1620

gttctggaca gcagcggcgt gccgagtttc agccagatgc aaaaccgcgg tcgtgacaca 1680

cgcgtggaat tctgggcctt tgacttactg tatctggatg gccgtgcact gctgggcacc 1740

cgttatcaag atcgccgtaa actgttagaa actttagcaa acgcaacctc tttaaccgtt 1800

ccggaactgt taccgggcga cggtgcccaa gcttttgctt gtagtcgtaa acacggttgg 1860

gaaggtgtga ttgccaaacg tcgtgacagc cgttatcagc ccggtcgccg ttgtgccagc 1920

tgggttaaag ataaacattg gaatacccaa gaagtggtga tcggtggctg gcgtgctggt 1980

gaaggcggtc gtagcagcgg tgtgggtagt ttactgatgg gcatcccggg tccgggtggt 2040

ctgcagtttg ctggtcgtgt gggtaccggc ttaagcgaac gtgaactggc caatctgaag 2100

gagatgctgg caccgctgca caccgatgag agtcctttcg acgtgccgtt acccgctcgt 2160

gatgccaaag gcatcaccta cgttaagccg gcactggtgg ccgaagttcg ctatagcgaa 2220

tggacaccgg aaggccgttt acgccagagt agctggcgtg gtttacgtcc ggacaaaaaa 2280

ccgagcgagg tggttcgcga gtaacacaag gtcttctcct gtgtgaaa 2328

<210> 13

<211> 27

<212> DNA

<213> Artificial sequence

<400> 13

agcatctggt cgcattgggt caccagc 27

<210> 14

<211> 29

<212> DNA

<213> Artificial sequence

<400> 14

cttccagata actgccgtca ctccagcgc 29

<210> 15

<211> 23

<212> DNA

<213> Artificial sequence

<400> 15

cttcagccat acttttcata ctc 23

<210> 16

<211> 25

<212> DNA

<213> Artificial sequence

<400> 16

agctggacac cgtttaaact caatg 25

<210> 17

<211> 22

<212> DNA

<213> Artificial sequence

<400> 17

tctgttgttt gtcggtgaac tg 22

<210> 18

<211> 22

<212> DNA

<213> Artificial sequence

<400> 18

ctggtattgg cacaaacctg at 22

<210> 19

<211> 82

<212> DNA

<213> Artificial sequence

<400> 19

tttaacttgc tatttctagc tctaaaacgc ggataaaggc cattatctac tagtattata 60

cctaggactg agctagctgt ca 82

<210> 20

<211> 26

<212> DNA

<213> Artificial sequence

<400> 20

gctggaacgc gctgaaatta tgcgtg 26

<210> 21

<211> 26

<212> DNA

<213> Artificial sequence

<400> 21

cgcttcgatt tctacgccac gtgcgc 26

<210> 22

<211> 23

<212> DNA

<213> Artificial sequence

<400> 22

cccagtcacg acggtctcaa aaa 23

<210> 23

<211> 23

<212> DNA

<213> Artificial sequence

<400> 23

aagccgagac ctcctgtgtg aaa 23

<210> 24

<211> 24

<212> DNA

<213> Artificial sequence

<400> 24

cccagtcacg acgaagacgc aaaa 24

<210> 25

<211> 24

<212> DNA

<213> Artificial sequence

<400> 25

cacaaggtct tctcctgtgt gaaa 24

Claims

1. A high throughput screening tool for obtaining an efficient NHEJ system in e.coli, said high throughput screening tool comprising:

2. The high throughput screening tool for conferring an efficient NHEJ system on escherichia coli as claimed in claim 1, wherein the DNA helicase gene comprises Rep101 gene;

preferably, the replicon comprises a pSC101 replicon;

preferably, the nuclease gene comprises a Cas9 gene;

preferably, the number of arabinose promoters is 2;

preferably, the type IIs restriction enzyme recognition sites are at least 2;

3. High throughput screening tool to achieve an efficient NHEJ system in e.coli according to claim 1 or 2 wherein said constitutively expressed strong promoter comprises the J23119 promoter.

4. A method of constructing a high throughput screening tool for escherichia coli to achieve an effective NHEJ system as described in any one of claims 1 to 3, comprising:

synthesizing and connecting functional elements of the pDual-Cas 9-Parantal plasmid vector to obtain the pDual-Cas 9-Parantal plasmid vector;

synthesizing a functional original of the pDual-sgRNA-lacZ plasmid vector and connecting to obtain the pDual-sgRNA-lacZ plasmid vector.

5. A high throughput screening method for obtaining an efficient NHEJ system in e.coli, comprising:

preparing CDS coding sequences of Ku protein and ligD protein, connecting the CDS coding sequences with a pDual-Cas 9-Parantal plasmid vector as described in any one of claims 1-3 to construct a Ku + ligD plasmid library, and preparing positive colonies into competent cells after transformation;

transferring the pDual-sgRNA-lacZ plasmid vector of any one of claims 1 to 3 into the prepared competent cells, selecting positive clones, analyzing, and judging the gene editing efficiency of different Ku + ligD combinations.

6. The high throughput screening method for obtaining an effective NHEJ system of E.coli according to claim 5, further comprising the step of codon optimization of CDS coding sequence of Ku protein and ligD protein;

preferably, the codon optimised CDS coding sequence of the Ku protein does not contain a Bbs i and/or Bsa i recognition sequence;

7. The high-throughput screening method for obtaining an effective NHEJ system of E.coli according to claim 5 or 6, further comprising the step of adding a sequence containing a restriction enzyme recognition site to both sides of the CDS coding sequence of the Ku protein and the ligD protein;

preferably, the nucleotide sequence shown in SEQ ID NO.22 is added to the 5 'end of the CDS coding sequence of the Ku protein, and the nucleotide sequence shown in SEQ ID NO.23 is added to the 3' end;

8. The high throughput screening method for obtaining an effective NHEJ system of E.coli according to any one of claims 5 to 7 wherein the Ku + ligD plasmid library is constructed by the method comprising:

9. The high throughput screening method for obtaining an effective NHEJ system of E.coli according to any one of claims 5 to 8 wherein said step of analysing comprises:

amplifying the positive clone, and sequencing and analyzing the amplified product;

preferably, the step of determining comprises:

10. An NHEJ system effective in Escherichia coli, wherein the NHEJ system effective in Escherichia coli is obtained by screening the Escherichia coli by the high-throughput screening tool for obtaining an effective NHEJ system according to any one of claims 1 to 3 and/or the high-throughput screening method for obtaining an effective NHEJ system according to any one of claims 5 to 9;