CN114457113B - Method for inhibiting haploid embryonic stem cell doubling - Google Patents

Method for inhibiting haploid embryonic stem cell doubling Download PDF

Info

Publication number
CN114457113B
CN114457113B CN202210216902.3A CN202210216902A CN114457113B CN 114457113 B CN114457113 B CN 114457113B CN 202210216902 A CN202210216902 A CN 202210216902A CN 114457113 B CN114457113 B CN 114457113B
Authority
CN
China
Prior art keywords
cells
haploid
has2
stem cells
embryonic stem
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210216902.3A
Other languages
Chinese (zh)
Other versions
CN114457113A (en
Inventor
帅领
孙圣怡
张文豪
赵芹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nankai University
Original Assignee
Nankai University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nankai University filed Critical Nankai University
Priority to CN202210216902.3A priority Critical patent/CN114457113B/en
Publication of CN114457113A publication Critical patent/CN114457113A/en
Application granted granted Critical
Publication of CN114457113B publication Critical patent/CN114457113B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0603—Embryonic cells ; Embryoid bodies
    • C12N5/0606—Pluripotent embryonic cells, e.g. embryonic stem cells [ES]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1048—Glycosyltransferases (2.4)
    • C12N9/1051—Hexosyltransferases (2.4.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/01—Hexosyltransferases (2.4.1)
    • C12Y204/01212—Hyaluronan synthase (2.4.1.212)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Abstract

The invention discloses a method for inhibiting haploid embryonic stem cell doubling, which comprises the following steps ofHas2An expression vector for the gene; step two, willHas2The expression vector of the gene is transfected into haploid embryonic stem cells to obtain cells to be subjected to flow sorting; thirdly, separating the cells to be subjected to flow separation to obtain haploid embryonic stem cells transfected into the expression vector of the HAS2 gene, and culturing the haploid embryonic stem cells. The invention is characterized by transferring exogenous in haploid embryo stem cellsHas2Gene, realization ofHas2The high expression of the gene can reach the aim of obviously improving the haploid maintenance capacity of the haploid embryo stem cells. Thus maintaining haploid proportion for a long time under serum culture condition without sorting, so as to facilitate the application of haploid embryonic stem cells.

Description

Method for inhibiting haploid embryonic stem cell doubling
Technical Field
The invention relates to the field of life science, in particular to a method for inhibiting doubling of haploid embryonic stem cells.
Background
Haploid embryonic stem cells have become powerful tools for functional genomics and genetic engineering due to the fact that they contain only one set of chromosomes and have the differentiation potential of stem cells. However, haploid embryonic stem cells have a strong tendency of spontaneous doubling in daily culture and differentiation, and continuous flow sorting and enrichment of haploids are required, which greatly limits further development and application of haploids. Currently, scientists develop various regulation strategies to inhibit haploid doubling aiming at haploid and diploid differences, but various methods have certain limitations. There is therefore a need to develop a simpler and more efficient method to maintain the proportion of haploids, thereby promoting a wider application of haploids.
Disclosure of Invention
In order to solve the technical problems, the invention provides a method for inhibiting doubling of haploid embryonic stem cells. The invention is implemented by using haploid embryo stem cellsTransfection of exogenousHas2Gene, realization ofHas2The high expression of the gene can reach the aim of obviously improving the haploid maintenance capacity of the haploid embryo stem cells. Thus maintaining haploid proportion for a long time under serum culture condition without sorting, so as to facilitate the application of haploid embryonic stem cells.
The aim of the invention is achieved by the following technical scheme:
a method of inhibiting doubling of haploid embryonic stem cells comprising the steps of:
step one, constructingHas2An expression vector for the gene;
step two, willHas2The expression vector of the gene is transfected into haploid embryonic stem cells to obtain cells to be subjected to flow sorting;
step three, sorting from the cells to be subjected to flow sorting to obtainHas2The gene expression vector is transfected into successful haploid embryo stem cells for culturing.
Further improvement, in the first stepHas2The gene is mouseHas2The gene, the haploid embryo stem cell is a mouse haploid embryo stem cell.
Further improvement, the first step comprises the following steps:
expression is takenHas2The total cDNA of the mouse cells is taken as a template to carry out PCR and amplification to obtainHas2Connecting the Has2 CDS with the T2A EGFP fragment by using an overlay PCR mode, purifying and recovering after electrophoresis verifying the size of the band, respectively enzyme-cutting the amplified fragment and PB-CAG MCS-PA carrier for 30 min by using two restriction enzymes of BamHI and MluI at 37 ℃, and respectively purifying and recovering enzyme-cut fragments and enzyme-cut carriers by using enzyme-cut products, wherein the enzyme-cut carriers are obtained by the steps of: enzyme section mass ratio 50 ng:150 ng, then reacting 1 h at 16 ℃ by using T4 ligase to obtain a connection product, converting the connection product into 50 mu l competent cells, and then screening out the competent cells successfully converted.
Further improvements, the competent cells are E.coli competent cells.
Further improved, the sequence of the PB-CAG MCS-PA vector is shown in SEQ ID NO. 1.
Further improvement, the second step comprises the following steps:
and (3) extracting the cell competent cells which are successfully transformed to obtain PBase plasmids, transfecting wild type haploid embryonic stem cells with good growth vigor by adopting a PiggyBac transposon system, and transferring the PBase plasmids into the wild type haploid embryonic stem cells to obtain cells to be subjected to flow sorting.
Further improvement, 2×10 at transfection 6 The individual cells were electrotransferred with 2. Mu.g of the PBase plasmid and 6. Mu.g of the PiggyBac Has2 OE plasmid; the electrotransport was set at 1400 v,3 pulses/10 ms.
In a further improvement, in the third step, the cells to be flow-sorted are digested into single cells by 0.05% trypsin, and then stained by 4 mug/ml Hoechst 33342, and incubated for 15min in a water bath at 37 ℃ in the absence of light; cell sieves were filtered and sorted with BD FACS AriaII; and before the flow-sorting cells are put on the machine, the wild diploid embryonic stem cells are used as a control, a 2n peak and a GFP negative cell population are defined, then haploid cells are put on the machine, and cells at the positions of the GFP positive peak and the GFP negative peak are defined for sorting and continuous culture.
The invention has the beneficial effects that:
the invention is characterized by transferring exogenous in haploid embryo stem cellsHas2Gene, realization ofHas2The high expression of the gene can reach the aim of obviously improving the haploid maintenance capacity of the haploid embryo stem cells. Thus maintaining haploid proportion for a long time under serum culture condition without sorting, so as to facilitate the application of haploid embryonic stem cells.
Drawings
The invention is further illustrated by the accompanying drawings, the content of which does not constitute any limitation of the invention.
FIG. 1 is a schematic diagram of a vector construction;
FIG. 2 is a diagram; white light pattern of wild-type cell growth prior to transfection
FIG. 3 is a diagram; green fluorescence map of wild-type cells before transfection
FIG. 4 is a diagram; white light image of Has2 OE cell growth after transfection
FIG. 5 is a diagram; green fluorescence image of Has2 OE cells after transfection
FIG. 6 is a diagram; the expression level of the Has2 gene of different cells; WT-haESCs wild-type haploid embryonic stem cells; haploid embryonic stem cells transfected with Empty Vector by Empty Vector; the PB-Has2 OE transfects haploid embryonic stem cells of the PB-Has2 OE vector;
FIG. 7 is a diagram; proportion of haploid cells in wild type haploid embryonic stem cells after 7 days of flow sorting
FIG. 8 is a diagram; proportion of haploid cells in Has2 OE haploid embryonic stem cells after 7 days of flow sorting
FIG. 9 is a diagram; proportion of haploid cells in wild type haploid embryonic stem cells after 14 days of flow sorting
Fig. 10 is: proportion of haploid cells in Has2 OE haploid embryonic stem cells after 14 days of flow sorting
Detailed Description
The invention will be further described in detail with reference to the drawings and examples, in order to make the objects, technical solutions and advantages of the invention more apparent.
Example 1
The material method comprises the following steps:
vector construction
And taking total cDNA of the mouse cells expressing HAS2 as a template for PCR, and amplifying to obtain CDS sequences of HAS2 genes. Connecting the Has2 CDS with the T2A EGFP fragment by using an overlay PCR mode, purifying and recovering after electrophoresis verification of the size of the band, and simultaneously digesting the amplified fragment and the PB-CAG MCS-PA carrier for 30 min by using two restriction enzymes, namely BamHI and MluI, at 37 ℃. Purifying and recovering the enzyme cutting product again according to the carrier: fragment mass ratio 50 ng:150 ng was reacted at 16℃with T4 ligase 1 h. The product was transformed into 50. Mu.g competent cells, plated on LBA plates and incubated overnight at 37 ℃. The next day, single bacterial colony with proper size and clear boundary is picked for colony PCR verification, bacterial strain with correct strip size is picked for expansion culture, plasmid is extracted and sequencing verification is carried out. The primer information used in this procedure is as follows:
Has2 CDS-F：
NNNNGGATCCATGCATTGTGAGAGGTTTCTATGTGTCC
Has2 CDS-R：
GTTAGCAGACTTCCTCTGCCCTCTACATCAAGCACCATGTCATACTGTTG
T2A GFP-F：
GAGGGCAGAGGAAGTCTGCTAACATGCGGTGACGTCGAGGAGAATCCTGGCCCAGTGAGCAAGGGCGAGGAG
T2A GFP-R：NNNNACGCGTTCACTTGTACAGCTCGTCCATGCC
Colony PCR-F：CTGTAATTAGCTGAGCAAGAGGTAAGGG
Colony PCR-R：
GTTAGCAGACTTCCTCTGCCCTCTACATCAAGCACCATGTCATACTGTTG
cell transfection
The wild haploid embryonic stem cells with good growth vigor are transfected by using the PiggyBac transposon system. 2X 10 6 Each cell was electroporated with 2. Mu.g of the PBase plasmid and 6. Mu.g of the PiggyBac Has2 OE plasmid. The electrokinetic transducer was used at NEON (Invitrogen), 1400 v,3 pulses, 10 ms.
Flow analysis and flow sorting
Cells to be flow sorted were digested into single cells with 0.05% trypsin and then stained with Hoechst 33342 (4. Mu.g/ml) and incubated in a water bath at 37℃for 15min in the absence of light. Cell sieves were filtered and sorted with BD FACS AriaII. The haploid cells need to be placed on the machine before the embryo stem cells of the wild diploid are used as a control, and a 2n peak and a GFP negative cell population are defined. And then loading the haploid cells, sorting and continuously culturing the cells circling GFP positive and 1n peaks.
Cells to be flow analyzed were digested with 0.05% trypsin into single cells and fixed with 75% ethanol overnight at 4 ℃. The next day was stained with 50. Mu.g/ml propidium iodide, 2. 2 mg/ml RNase was added and incubated in a 37℃water bath in the dark for 15min. After cell screening, the relevant analysis was performed with BD LSRII SORP.
qPCR verification of Has2 expression level
And (3) taking proper wild type haploid embryo stem cells (WT-haESCs), haploid embryo stem cells transferred into an Empty Vector (Empty Vector) and haploid embryo stem cells of Has2 OE, dissolving the haploid embryo stem cells into single cells, and centrifuging to remove the supernatant. The cell pellet was lysed by 1 mL TRIzol resuspended and allowed to stand at room temperature for 5min, the nucleic acid was extracted by adding 0.2. 0.2 mL chloroform, vigorously shaken for 15 s, allowed to stand at room temperature for 3 min, and centrifuged at 12000 rpm for 15min at 4℃to separate the visible liquid into 3 layers. Carefully sucking the upper water phase 0.5. 0.5 mL, adding isopropanol in equal volume, mixing well, and standing at room temperature for 10 min. Centrifuge the tube at 4℃and 12000 rpm for 10 min, discard the supernatant and visualize the white RNA precipitate at the bottom of the tube. Washing the precipitate with 75% ethanol for 1 time, discarding ethanol, air drying, and determining volume with 20 μl DEPC water, and detecting RNA content and quality with NanoDrop. Reverse transcription and qPCR were performed on 1. Mu.g total RNA to verify the amount of expressed Has 2. The primers used are as follows:
GAPDH qPCR-F：AGGTCGGTGTGAACGGATTTG
GAPDH qPCR-R：TGTAGACCATGTAGTTGAGGTCA
Has2 qPCR-F：GTTCACAACATGTCACCCAATTGG
Has2 qPCR-R：CCTTCACCATCTCCACAGATGAGG
comparison of haploid maintenance ratio
Separating 10000 wild haploid embryo stem cells at 1n peak and haploid embryo stem cells of Has2 OE in 24-well plate by flow cytometry, adding appropriate amount of culture based on 5% CO at 37deg.C 2 Culturing in incubator, changing culture medium every day, and passaging for 2-3 days according to cell density. Appropriate cells were taken at day 7, 14 post-sorting for 75% ethanol fixation and haploid cell proportions were analyzed, as previously described. It was found that the cells of the Has2 OE can maintain the haploid proportion more effectively during long-term culture in vitro.
The PB-CAG MCS-PA carrier sequence information is shown in SEQ ID NO. 1.
Cell culture: adopts a serum culture method, and the system is as follows: DMEM/F12 (Gibco) basal broth, 10% KOSR (Gibco), 7% fetal bovine serum (BI), 1 mM sodium pyruvate (Sigma), 0.1 mM beta-mercaptoethanol (Sigma), 100U/mL of diabody (Gibco), 1000U/mL of LIF (Gibco), 3. Mu.M of CHIR99021 (MCE) and 1. Mu.M of PD0325901 (MCE) were added.
The construction principle of the vector is shown in figure 1: the piggyBac transposon system is used for delivering exogenous genes, and is designed into a continuous expression cassette of CAP-Has 2 CDS-T2A-EGFP-PA. The CAG promoter was used to drive expression of the HAS2 gene and the enhanced green fluorescent protein EGFP, which was linked using a T2A self-cleaving peptide.
Cell line construction: the extracted endotoxin-free PB carrier and PB enzyme plasmid are subjected to electrotransfection on wild type haploid embryonic stem cells with good growth state according to the ratio of 3:1, 8 mug plasmid is used for each 106 cells, after 48 hours of culture, GFP positive haploid embryonic stem cells are enriched through flow sorting, and subsequent culture and experiments are carried out.
Cell identification: the cells obtained above were used to extract total RNA by TRizol method, after genome removal and reverse transcription, qPCR was used to verify the expression level of HAS2, which was much higher than that of wild type haploid embryonic stem cells and empty control, as shown in FIG. 6.
Has2Comparison of the haploid maintenance ratios of OE cells. Will beHas2And (3) respectively selecting ten thousands of haploid cells from the cell line with successful overexpression and the wild cell line through flow and culturing under the same condition. Part of the cells were taken at 7 and 14 days after sorting for detection of haploid proportion.Has2The overexpressed cell lines have better ability to maintain haploid ratios than wild-type cells, with a significantly higher "1n" peak ratio than wild-type cells and a significantly lower "4n" peak ratio than wild-type cells. As shown in fig. 7-10.
Finally, it should be noted that the above embodiments are only for illustrating the technical solution of the present invention and not for limiting the scope of the present invention, and although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made to the technical solution of the present invention without departing from the spirit and scope of the technical solution of the present invention.
Sequence listing
<110> applicant name
NANKAI University
<120> a method of inhibiting haploid embryonic stem cell doubling
<130> 2022-02-17
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 8083
<212> DNA
<213> an artificial sequence
<400> 1
actcttcctt tttcaatatt attgaagcat ttatcagggt tattgtctca tgagcggata 60
catatttgaa tgtatttaga aaaataaaca aataggggtt ccgcgcacat ttccccgaaa 120
agtgccacct aaattgtaag cgttaatatt ttgttaaaat tcgcgttaaa tttttgttaa 180
atcagctcat tttttaacca ataggccgaa atcggcaaaa tcccttataa atcaaaagaa 240
tagaccgaga tagggttgag tgttgttcca gtttggaaca agagtccact attaaagaac 300
gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg gcgatggccc actacgtgaa 360
ccatcaccct aatcaagttt tttggggtcg aggtgccgta aagcactaaa tcggaaccct 420
aaagggagcc cccgatttag agcttgacgg ggaaagccgg cgaacgtggc gagaaaggaa 480
gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa gtgtagcggt cacgctgcgc 540
gtaaccacca cacccgccgc gcttaatgcg ccgctacagg gcgcgtccca ttcgccattc 600
aggctgcgca actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg 660
gcgaaagggg gatgtgctgc aaggcgatta agttgggtaa cgccagggtt ttcccagtca 720
cgacgttgta aaacgacggc cagtgagcgc gcctcgttca ttcacgtttt tgaacccgtg 780
gaggacgggc agactcgcgg tgcaaatgtg ttttacagcg tgatggagca gatgaagatg 840
ctcgacacgc tgcagaacac gcagctagat taaccctaga aagataatca tattgtgacg 900
tacgttaaag ataatcatgt gtaaaattga cgcatgtgtt ttatcggtct gtatatcgag 960
gtttatttat taatttgaat agatattaag ttttattata tttacactta catactaata 1020
ataaattcaa caaacaattt atttatgttt atttatttat taaaaaaaaa caaaaactca 1080
aaatttcttc tataaagtaa caaaactttt atgagggaca gccccccccc aaagccccca 1140
gggatgtaat tacgtccctc ccccgctagg gggcagcagc gagccgcccg gggctccgct 1200
ccggtccggc gctccccccg catccccgag ccggcagcgt gcggggacag cccgggcacg 1260
gggaaggtgg cacgggatcg ctttcctctg aacgcttctc gctgctcttt gagcctgcag 1320
acacctgggg ggatacgggg aaaaggcctc cacggccact agttctagag gtacccgtta 1380
cataacttac ggtaaatggc ccgcctggct gaccgcccaa cgacccccgc ccattgacgt 1440
caatagtaac gccaataggg actttccatt gacgtcaatg ggtggagtat ttacggtaaa 1500
ctgcccactt ggcagtacat caagtgtatc atatgccaag tacgccccct attgacgtca 1560
atgacggtaa atggcccgcc tggcattgtg cccagtacat gaccttatgg gactttccta 1620
cttggcagta catctacgta ttagtcatcg ctattaccat ggtcgaggtg agccccacgt 1680
tctgcttcac tctccccatc tcccccccct ccccaccccc aattttgtat ttatttattt 1740
tttaattatt ttgtgcagcg atgggggcgg gggggggggg ggggcgcgcg ccaggcgggg 1800
cggggcgggg cgaggggcgg ggcggggcga ggcggagagg tgcggcggca gccaatcaga 1860
gcggcgcgct ccgaaagttt ccttttatgg cgaggcggcg gcggcggcgg ccctataaaa 1920
agcgaagcgc gcggcgggcg ggagtcgctg cgacgctgcc ttcgccccgt gccccgctcc 1980
gccgccgcct cgcgccgccc gccccggctc tgactgaccg cgttactccc acaggtgagc 2040
gggcgggacg gcccttctcc tccgggctgt aattagctga gcaagaggta agggtttaag 2100
ggatggttgg ttggtggggt attaatgttt aattacctgg agcacctgcc tgaaatcact 2160
ttttttcagg ttggaccggt ggatccatgc attgtgagag gtttctatgt gtcctgagaa 2220
taattggaac tacacttttt ggagtgtctc tcctcctcgg aatcacagct gcttatattg 2280
ttggctacca gtttatccaa acagataatt actacttctc atttggactg tacggtgcct 2340
ttttagcctc gcatctcatc atccaaagcc tctttgcctt tttggaacac cggaaaatga 2400
agaagtccct tgaaaccccg attaaattga acaaaacggt agcactctgc atcgctgcgt 2460
accaagagga ccctgactac ttacggaaat gtttgcaatc tgtgaaaagg ctgacctacc 2520
ctgggattaa agtcgtgatg gtcatcgatg ggaactcaga cgacgacctt tacatgatgg 2580
acatattcag cgaagttatg ggcagggaca aatcggccac gtacatctgg aagaacaact 2640
ttcatgaaaa gggacctggt gagacagaag agtcccataa agaaagttca caacatgtca 2700
cccaattggt cttgtctaac aaaagtattt gcatcatgca aaaatggggt ggaaagagag 2760
aagtcatgta cacagccttc agagcactgg ggcgaagcgt ggattatgta caggtgtgtg 2820
actcagatac tatgcttgac cctgcctcat ctgtggagat ggtgaaggtc ttagaggaag 2880
accctatggt tggaggtgtt ggaggagatg tccagatttt aaacaagtat gattcctgga 2940
tctccttcct cagcagcgtg agatactgga tggcttttaa tatagaaagg gcctgccagt 3000
cttattttgg ctgtgtccag tgcataagcg gtcctctggg aatgtacaga aactccttgc 3060
tgcatgaatt tgtggaagac tggtacaatc aggaattcat gggtaaccaa tgcagttttg 3120
gtgacgacag gcaccttacc aacagggtgt tgagtctggg ctatgcaact aaatacacgg 3180
ctcggtccaa gtgccttact gaaactccca tagaatatct gagatggctg aaccagcaga 3240
cccgttggag caagtcctac ttccgagagt ggctgtacaa tgccatgtgg tttcacaagc 3300
atcacttgtg gatgacctat gaagctgtta tcactggatt ctttcctttc tttctcattg 3360
ccacagtcat ccagctcttc tacaggggta aaatctggaa catcctcctc ttcctgttaa 3420
ctgtccagct agtgggtctc atcaagtcat cttttgccag ctgccttaga ggaaatatcg 3480
tcatggtatt catgtctctg tattcagtgt tatacatgtc aagtctactt cctgccaaga 3540
tgtttgcaat tgcaaccata aacaaagctg ggtggggcac atctggaagg aagaccattg 3600
ttgttaattt cataggactt attccagtgt ccgtgtggtt tacaatcctt ctaggtggtg 3660
taattttcac catttataag gaatctaaaa agccattttc cgaatccaaa cagactgttc 3720
tcatcgtggg aactttgatc tatgcatgct actgggtcat gcttttgact ctctatgtgg 3780
ttctcatcaa taagtgtggc aggcggaaga agggacaaca gtatgacatg gtgcttgatg 3840
tagagggcag aggaagtctg ctaacatgcg gtgacgtcga ggagaatcct ggcccagtga 3900
gcaagggcga ggagctgttc accggggtgg tgcccatcct ggtcgagctg gacggcgacg 3960
taaacggcca caagttcagc gtgtccggcg agggcgaggg cgatgccacc tacggcaagc 4020
tgaccctgaa gttcatctgc accaccggca agctgcccgt gccctggccc accctcgtga 4080
ccaccctgac ctacggcgtg cagtgcttca gccgctaccc cgaccacatg aagcagcacg 4140
acttcttcaa gtccgccatg cccgaaggct acgtccagga gcgcaccatc ttcttcaagg 4200
acgacggcaa ctacaagacc cgcgccgagg tgaagttcga gggcgacacc ctggtgaacc 4260
gcatcgagct gaagggcatc gacttcaagg aggacggcaa catcctgggg cacaagctgg 4320
agtacaacta caacagccac aacgtctata tcatggccga caagcagaag aacggcatca 4380
aggtgaactt caagatccgc cacaacatcg aggacggcag cgtgcagctc gccgaccact 4440
accagcagaa cacccccatc ggcgacggcc ccgtgctgct gcccgacaac cactacctga 4500
gcacccagtc cgccctgagc aaagacccca acgagaagcg cgatcacatg gtcctgctgg 4560
agttcgtgac cgccgccggg atcactctcg gcatggacga gctgtacaag tgaacgcgtc 4620
cgcgggtcga cctcgaggcg gccgcgttaa ctagacttgt ttattgcagc ttataatggt 4680
tacaaataaa gcaatagcat cacaaatttc acaaataaag catttttttc actgcattct 4740
agttgtggtt tgtccaaact catcaatgta tcttatcatg tctggaattg actcaaatga 4800
tgtcaattag tctatcagaa gctatctggt ctcccttccg ggggacaaga catccctgtt 4860
taatatttaa acagcagtgt tcccaaactg ggttcttata tcccttgctc tggtcaacca 4920
ggttgcaggg tttcctgtcc tcacaggaac gaagtcccta aagaaacagt ggcagccagg 4980
tttagccccg gaattgactg gattcctttt ttagggccca ttggtatggc tttttccccg 5040
tatcccccca ggtgtctgca ggctcaaaga gcagcgagaa gcgttcagag gaaagcgatc 5100
ccgtgccacc ttccccgtgc ccgggctgtc cccgcacgct gccggctcgg ggatgcgggg 5160
ggagcgccgg accggagcgg agccccgggc ggctcgctgc tgccccctag cgggggaggg 5220
acgtaattac atccctgggg gctttggggg ggggctgtcc ctgatatcta taacaagaaa 5280
atatatatat aataagttat cacgtaagta gaacatgaaa taacaatata attatcgtat 5340
gagttaaatc ttaaaagtca cgtaaaagat aatcatgcgt cattttgact cacgcggtcg 5400
ttatagttca aaatcagtga cacttaccgc attgacaagc acgcctcacg ggagctccaa 5460
gcggcgactg agatgtccta aatgcacagc gacggattcg cgctatttag aaagagagag 5520
caatatttca agaatgcatg cgtcaatttt acgcagacta tctttctagg gttaatctag 5580
ctgcatcagg atcatatcgt cgggtctttt ttccggctca gtcatcgccc aagctggcgc 5640
tatctgggca tcggggagga agaagcccgt gccttttccc gcgaggttga agcggcatgg 5700
aaagagtttg ccgaggatga ctgctgctgc attgacgttg agcgaaaacg cacgtttacc 5760
atgatgattc gggaaggtgt ggccatgcac gcctttaacg gtgaactgtt cgttcaggcc 5820
acctgggata ccagttcgtc gcggcttttc cggacacagt tccggatggt cagcccgaag 5880
cgcatcagca acccgaacaa taccggcgac agccggaact gccgtgccgg tgtgcagatt 5940
aatgacagcg gtgcggcgct gggatattac gtcagcgagg acgggtatcc tggctggatg 6000
ccgcagaaat ggacatggat accccgtgag ttacccggcg ggcgcgcttg gcgtaatcat 6060
ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac aacatacgag 6120
ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gagctaactc acattaattg 6180
cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa 6240
tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgct tcctcgctca 6300
ctgactcgct gcgctcggtc gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg 6360
taatacggtt atccacagaa tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc 6420
agcaaaaggc caggaaccgt aaaaaggccg cgttgctggc gtttttccat aggctccgcc 6480
cccctgacga gcatcacaaa aatcgacgct caagtcagag gtggcgaaac ccgacaggac 6540
tataaagata ccaggcgttt ccccctggaa gctccctcgt gcgctctcct gttccgaccc 6600
tgccgcttac cggatacctg tccgcctttc tcccttcggg aagcgtggcg ctttctcata 6660
gctcacgctg taggtatctc agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc 6720
acgaaccccc cgttcagccc gaccgctgcg ccttatccgg taactatcgt cttgagtcca 6780
acccggtaag acacgactta tcgccactgg cagcagccac tggtaacagg attagcagag 6840
cgaggtatgt aggcggtgct acagagttct tgaagtggtg gcctaactac ggctacacta 6900
gaaggacagt atttggtatc tgcgctctgc tgaagccagt taccttcgga aaaagagttg 6960
gtagctcttg atccggcaaa caaaccaccg ctggtagcgg tggttttttt gtttgcaagc 7020
agcagattac gcgcagaaaa aaaggatctc aagaagatcc tttgatcttt tctacggggt 7080
ctgacgctca gtggaacgaa aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa 7140
ggatcttcac ctagatcctt ttaaattaaa aatgaagttt taaatcaatc taaagtatat 7200
atgagtaaac ttggtctgac agttaccaat gcttaatcag tgaggcacct atctcagcga 7260
tctgtctatt tcgttcatcc atagttgcct gactccccgt cgtgtagata actacgatac 7320
gggagggctt accatctggc cccagtgctg caatgatacc gcgagaccca cgctcaccgg 7380
ctccagattt atcagcaata aaccagccag ccggaagggc cgagcgcaga agtggtcctg 7440
caactttatc cgcctccatc cagtctatta attgttgccg ggaagctaga gtaagtagtt 7500
cgccagttaa tagtttgcgc aacgttgttg ccattgctac aggcatcgtg gtgtcacgct 7560
cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga gttacatgat 7620
cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt gtcagaagta 7680
agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct cttactgtca 7740
tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca ttctgagaat 7800
agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaat acgggataat accgcgccac 7860
atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga aaactctcaa 7920
ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc aactgatctt 7980
cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg 8040
caaaaaaggg aataagggcg acacggaaat gttgaatact cat 8083

Claims (4)

1. A method of inhibiting doubling of haploid embryonic stem cells comprising the steps of:
step one, constructBuilding constructionHas2An expression vector for the gene;Has2the gene is mouseHas2The gene is characterized in that the haploid embryonic stem cells are mouse haploid embryonic stem cells;
step two, willHas2The expression vector of the gene is transfected into haploid embryonic stem cells to obtain cells to be subjected to flow sorting;
step three, sorting to obtainHas2The gene expression vector is transfected into successful haploid embryo stem cells for culturing.
2. The method of inhibiting doubling of haploid embryonic stem cells of claim 1, wherein step one comprises the steps of:
expression is takenHas2The total cDNA of the mouse cells is taken as a template to carry out PCR and amplification to obtainHas2CDS sequence of gene, and using overlay PCR methodHas2CDS is connected with T2A EGFP fragment, after electrophoresis verification of the size of the band, the band is purified and recovered, two restriction enzymes BamHI and MluI are used for respectively enzyme digestion and amplification of the fragment and PB-CAG MCS-PA carrier for 30 min at 37 ℃, enzyme digestion products are respectively purified and recovered to obtain enzyme digestion fragments and enzyme digestion carriers, and the enzyme digestion carriers are used for enzyme digestion: enzyme section mass ratio 50 ng:150 ng and mixing, then reacting 1 h at 16 ℃ by using T4 ligase to obtain a connection product, converting the connection product into 50 mu l competent cells, and then screening out competent cells successfully converted; the sequence of the connection product is shown as SEQ ID NO. 1.
3. The method of inhibiting doubling of haploid embryonic stem cells of claim 2, wherein the competent cells are e.
4. The method of claim 2, wherein in step three, the cells to be flow sorted are digested to single cells with 0.05% trypsin and then stained with 4 μg/ml Hoechst 33342 and incubated in a water bath at 37 ℃ for 15min in the absence of light; cell sieves were filtered and sorted with BD FACS AriaII; and before the flow-sorting cells are put on the machine, the wild diploid embryonic stem cells are used as a control, a 2n peak and a GFP negative cell population are defined, then haploid cells are put on the machine, and cells at the positions of the GFP positive peak and the GFP negative peak are defined for sorting and continuous culture.
CN202210216902.3A 2022-03-07 2022-03-07 Method for inhibiting haploid embryonic stem cell doubling Active CN114457113B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210216902.3A CN114457113B (en) 2022-03-07 2022-03-07 Method for inhibiting haploid embryonic stem cell doubling

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210216902.3A CN114457113B (en) 2022-03-07 2022-03-07 Method for inhibiting haploid embryonic stem cell doubling

Publications (2)

Publication Number Publication Date
CN114457113A CN114457113A (en) 2022-05-10
CN114457113B true CN114457113B (en) 2023-11-17

Family

ID=81418022

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210216902.3A Active CN114457113B (en) 2022-03-07 2022-03-07 Method for inhibiting haploid embryonic stem cell doubling

Country Status (1)

Country Link
CN (1) CN114457113B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007267686A (en) * 2006-03-31 2007-10-18 Japan Science & Technology Agency Inductive transgenic animal comprising hyaluronic acid synthase gene transferred thereinto
WO2017080452A1 (en) * 2015-11-11 2017-05-18 中国科学院上海生命科学研究院 Parthenogenetic haploid embryonic stem cells, preparation method therefor, and application thereof
CN108048400A (en) * 2017-12-26 2018-05-18 南开大学 A kind of preparation method of monkey monoploid neural stem cell
CN108998410A (en) * 2017-06-07 2018-12-14 中国科学院动物研究所 Kinases inhibitor is inhibiting the purposes in haploid cell diplodization
CN110157661A (en) * 2018-02-12 2019-08-23 中国科学院上海生命科学研究院 A kind of method for separating of monoploid embryo stem cell

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007267686A (en) * 2006-03-31 2007-10-18 Japan Science & Technology Agency Inductive transgenic animal comprising hyaluronic acid synthase gene transferred thereinto
WO2017080452A1 (en) * 2015-11-11 2017-05-18 中国科学院上海生命科学研究院 Parthenogenetic haploid embryonic stem cells, preparation method therefor, and application thereof
CN108998410A (en) * 2017-06-07 2018-12-14 中国科学院动物研究所 Kinases inhibitor is inhibiting the purposes in haploid cell diplodization
CN108048400A (en) * 2017-12-26 2018-05-18 南开大学 A kind of preparation method of monkey monoploid neural stem cell
CN110157661A (en) * 2018-02-12 2019-08-23 中国科学院上海生命科学研究院 A kind of method for separating of monoploid embryo stem cell

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
哺乳动物单倍体胚胎干细胞的建立与应用;丁一夫;李劲松;周琪;;中国科学:生命科学(第12期);全文 *

Also Published As

Publication number Publication date
CN114457113A (en) 2022-05-10

Similar Documents

Publication Publication Date Title
CN109777761B (en) Construction and application of engineering bacteria for secretory expression of chitobiose deacetylase
CN100400670C (en) Method and kits for identifying elite event GAT-ZM1 in biological samples
Alting-Mees et al. [42] pBluescriptII: Multifunctional cloning and mapping vectors
CN111088405A (en) Primer probe composition, kit and method for detecting coronavirus 2019-nCoV
CN107604004A (en) Tracer target practice plasmid for vaccinia virus Tiantan strain TK genes and preparation method thereof
CN112225822B (en) CAR-iNKT with high amplification, survival ability and tumor killing effect and application thereof
CN102002509B (en) Escherichia coli-bacillus subtilis shuttle expression vector and application thereof
CN108531510B (en) Application of transgenic zebra fish in preparation of animal model of chronic myelocytic leukemia
CN111239386B (en) Screening method and application of small molecular compound for targeted inhibition of vitamin K-dependent gamma-glutamyl carboxylase
KR20200086902A (en) A vector for monitoring differentiation of neural cells and method for monitoring the differentiation into neural cells using the same
KR101756338B1 (en) Variant Microorganism for Producing L-Cystein and Method for Preparing L-Cystein Using thereof
WO1992017581A1 (en) Mammalian expression vector
CN113862235A (en) Chimeric enzyme and application and method thereof in synthesis of Cap0mRNA by in vitro one-step reaction
CN114457113B (en) Method for inhibiting haploid embryonic stem cell doubling
CN101463362B (en) Expression vector for fusion expression of green fluorescent protein, construction method and use thereof
CN111239385B (en) Screening method and application of small molecule compound for targeted inhibition of vitamin K epoxide reductase
CN101538611B (en) Real-time quantitative fluorescence PCR test method based on double external references of RNA and DNA and application thereof
CN111560392B (en) MiRNA expression vector and application thereof
CN108385170B (en) Regulatory sequence library of Bacillus subtilis F4 promoter
CN111718953A (en) CRISPR/Cas9 vector for sugarcane and construction method and application thereof
CN107034233B (en) Method for driving exogenous gene expression by endogenous promoter
CN110115770B (en) Novel target for preventing and treating viral hepatitis C, CRISPR-Cas9 targeting system and application thereof
CN106519005B (en) Phosphorylated NFAT3 mutant and application thereof
CN101220374A (en) Fowl pox virus double-gene expression carrier (PG7.5N)
CN100429309C (en) 100bp gradient ribonucleic acid molecular weight marker and its preparation

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant