CN109735501A - The N2a cell line and its construction method and kit of knockout zDHHC17 gene - Google Patents

Abstract

The invention discloses the N2a cell line for knocking out zDHHC17 gene and its construction method and kit, the method is the construction method using CRISPR-Cas9 system, can take into account quality and efficiency, accurate and efficient.Since zDHHC17 is a kind of important palmityl modification enzyme, the palmitoylation modification modification by regulating and controlling target protein influences protein function；ZDHHC17 is also known as Huntingdon interaction albumen (Hip14), closely related with the pathogenesis of Huntingdon disease.The N2a cell line for knocking out zDHHC17 gene is easy to amplification cultivation, facilitates and provides a large amount of biological sample, is easy to the discovery research of its target proteins；It is easy to the special regulatory function for studying its target protein and relevant signal path.Therefore, the N2a cell line for knocking out zDHHC17 gene can be used for the functional study of its palmitoylation substrate and the study of pathogenesis of Huntingdon disease.

Description

The N2a cell line and its construction method and kit of knockout zDHHC17 gene

Technical field

The invention belongs to field of biotechnology, are related to a kind of N2a cell line and its construction method for knocking out zDHHC17 gene And kit.

Background technique

N2a cell full name mouse neuroblastoma N2a cells, also referred to as Neuro-2a, are mouse sources Neuroma mother cell.The cell is adherent good, most at neuron, has aixs cylinder spline structure；The cell line is mainly used for reality It tests room and cultivates cell model of the cell line as external pathological study；For neurite outgrowth, neurotoxicity, Alzheimer The research of disease and mammal cell line Asymmetric division.

Palmitoylation modification is esterification modification after the reversible protein translation of one kind, influences the structure and stabilization of protein Property, the interaction of regulatory protein, is transported and the film of protein positions.The palmitoylation of people is modified by 23 kinds of palmitoyl transferases (zDHHCs) it mediates.Palmitoylation modification is widely present in nerve cell, adjusts growth and development, the cell point of nerve cell Change, the plasticity of cynapse, and participates in the generation of a variety of the nervous system diseases.

Huntingdon disease (HD) is a kind of autosome dominant disease, derives from chromosome 4p16.3 galianconism Huntingdon The CAG extended in gene (HTT) repeats (36 or more repeat).Huntingdon disease (HD) has extensive shadow to the nervous function of people It rings, causes brain nervous cell progressive degeneration, be usually expressed as action obstacle, cognition and phrenoblabia.

ZDHHC17 is an important member of palmitoylation enzyme DHHC family.DHHC family protein, which is that one kind is important, to be turned over Rear palmitoylation modification enzyme is translated, is positioned in the film of regulatory protein matter, the sorting of protein and the weight such as protein folding and stability It wants to play an important role in physiology course.Correlative study shows that DHHC activity disorder is related to neurological disease.ZDHHC17 is also known as henry The court of a feudal ruler interactions between protein albumen (Hip14) can be combined by N-terminal ankyrin repeat domains (ANK) and Huntington protein (HTT), The palmitoylation of HTT is adjusted, the pathogenic process of Huntingdon disease is participated in.

Genome editor is the important means for studying gene function, has been developed that several genes group editing technique at present, Such as ZFN technology, TALEN technology and CRISPR-Cas9 gene editing technology.TALEN is activating transcription factor sample effector core Sour enzyme (transcription activator-like effector nuclease).ZFN is Zinc finger nuclease (Zinc- finger nuclease).CRISPR refers to short palindrome repetitive sequence (the Clustered regularly in regular cluster interval Interspaced short palindromic repeat), Cas refers to CRISPR GAP-associated protein GAP.CRISPR-Cas genome Editing technique is to identify target practice site by one section of RNA, is carried out by the nucleic acid near Cas endonuclease air exercise target site It cuts to realize the fixed point editor to genome, therefore the technology is also referred to as the endonuclease zymotechnic of RNA guidance.The above technology Respectively there is feature, according to the suitable technology of the genome edit effect to be realized selection and optimisation technique scheme is the key that application, Take into account the problem of quality and efficiency are to be solved.

Summary of the invention

It is an object of the present invention to provide a kind of accurately and efficiently buildings to knock out the N2a cell line of zDHHC17 gene Method.

The method that building provided by the invention knocks out the N2a cell line of zDHHC17 gene, for based on CRISPR-Cas9 system The construction method of system.

Preferably, the method with meet in zDHHC17 gene order shown in SEQ ID NO:1 5 ' -20N-NGG-3 ' or Sequence shown in " 20N " in the sequence of 5 '-CCN-20N-3 ' series arrangement rule is as target sequence；N is A or T or C or G.

Preferably, the target sequence is 264-283 of zDHHC17 gene order or the shown in SEQ ID NO:1 298-317.

Preferably, described method includes following steps (A) and (B):

(A) include the following steps (a1)-(a3):

(a1) two single stranded DNAs of entitled positive single stranded DNA 1 and entitled reversed single stranded DNA 1 are synthesized；The forward direction The sequence of single stranded DNA 1 is as shown in SEQ ID NO:2；The sequence of the reversed single stranded DNA 1 is as shown in SEQ ID NO:3；

(a2) the forward direction DNA1 and the reverse DNA 1 are subjected to annealing reaction, obtain double-stranded DNA 1；

(a3) double-stranded DNA 1 is connected at the cleavage site of restriction enzyme BbsI of pX458 plasmid, is obtained Recombinant plasmid be denoted as pX458-zDHHC17-1；

(B) include the following steps (b1)-(b4):

(b1) two single stranded DNAs of entitled positive single stranded DNA 2 and entitled reversed single stranded DNA 2 are synthesized；The forward direction The sequence of single stranded DNA 2 is as shown in SEQ ID NO:4；The sequence of the reversed single stranded DNA 2 is as shown in SEQ ID NO:5；

(b2) the forward direction DNA2 and direction DNA2 is subjected to annealing reaction, obtains double-stranded DNA 2；

(b3) double-stranded DNA 1 is connected at the cleavage site of restriction enzyme BbsI of pX458 plasmid, is obtained Recombinant plasmid be denoted as pX458-zDHHC17-2；

(b4) the pX458-zDHHC17-2 plasmid and (a3) described pX458-zDHHC17-1 plasmid co-transfection N2a is thin Born of the same parents obtain the N2a cell line that zDHHC17 gene is knocked from the N2a cell after transfection.

Preferably, in step (a2) and step (b2), the condition of the annealing reaction is equal are as follows: 95 DEG C of effect 5min, 95 25 DEG C DEG C are cooled to, rate of temperature fall is 6 DEG C/min；In step (b4), by the pX458-zDHHC17-1 and pX458- When zDHHC17-2 plasmid co-transfection N2a cell, the mass ratio of the pX458-zDHHC17-1 and pX458-zDHHC17-2 plasmid For 1:1.

The second object of the present invention is to provide the N2a cell line for knocking out zDHHC17 gene, and the cell line is using any The mouse Nerve tumor mother cell N2a-KO- that the method that building described in knocks out the N2a cell line of zDHHC17 gene obtains zDHHC17。

The third object of the present invention is to provide complete plasmid, thin by the N2a described above for constructing knockout zDHHC17 gene The pX458-zDHHC17-1 plasmid and pX458-zDHHC17-2 plasmid composition in the method for born of the same parents system.

Wherein two kinds of plasmids in the complete plasmid can be packed individually, can also be 1:1's according to mass ratio Ratio is hybrid packed.

The purposes of the complete plasmid also belongs to protection scope of the present invention, and the purposes is to be struck based on CRISPR-Cas9 Except the zDHHC17 gene in N2a cell.

The fourth object of the present invention is to provide a kind of N2a cell for constructing based on CRISPR-Cas9 and knocking out zDHHC17 gene The kit of system, the kit contain above-described complete plasmid and specification；It is recorded in the specification to take up an official post The method that one building knocks out the N2a cell line of zDHHC17 gene.

Functional study and Heng Ting of the N2a cell line of the knockout zDHHC17 gene in zDHHC17 palmitoylation substrate Application in the study of pathogenesis for disease of pausing also belongs to protection scope of the present invention.

The present invention has the advantages that the method for the N2a cell line that building of the invention knocks out zDHHC17 gene can be taken into account Quality and efficiency, the acquisition for capableing of precise and high efficiency knock out the N2a cell line of zDHHC17 gene.The specificity in target practice site carries out Calculating verifying repeatedly improves the efficiency for obtaining and knocking out cell using fluorescence flow unicellular sorting technology, and common Drug screening is compared and substantially reduces cell strain screening time.The N2a cell line of zDHHC17 gene is knocked out, or lacks zDHHC17 A part of gene, or cause frameshift mutation due to knocking out or being inserted into certain segments, therefore cannot correctly express zDHHC17 egg It is white, in order to avoid shearing the influence of variant, site design is knocked out in the public domain of each variant.Since zDHHC17 is a kind of Palmitoylation modification enzyme, the missing of zDHHC17 albumen cause its substrate protein not modify palmitoylation normally, can not normal row Make protein function, while zDHHC17 is related to the pathogenesis of Huntingdon disease；Therefore knock out the N2a cell line of zDHHC17 gene It can be used in the study of pathogenesis of its functional study for modifying substrate and Huntingdon disease.The N2a for knocking out zDHHC17 gene is thin Born of the same parents are the supplement and extension for knocking out zDHHC17 DNA murine, compared with the mouse for knocking out zDHHC17 gene, knock out zDHHC17 base The N2a cell of cause is easier to obtain a large amount of biological sample, carries out palmityl protein group credit analysis by mass spectrum, obtains The potential target protein information of zDHHC17；Target protein is overexpressed in the N2a cell for knocking out zDHHC17 gene, it is easier to right Its target protein carries out the research of regulatory mechanism and the research of associated signal paths.

Detailed description of the invention

Fig. 1 is PCR qualification result.

Fig. 2 is Western Blot qualification result.

Specific embodiment

Experimental method used in following embodiments is conventional method unless otherwise specified.

The materials, reagents and the like used in the following examples is commercially available unless otherwise specified.

PX458 plasmid: gRNA is manually inserted into the recombinant plasmid that forms after the plasmid has guiding role, can with wanted Corresponding position is combined in the genome of editor, plays the role of guiding.The plasmid can express Cas9 simultaneously, Cas9 with Realize its cutting function to genome in gRNA reaches the genome to be edited position after combining.It is recorded in " F Ann Ran,Patrick D Hsu,Jason Wright,Vineeta Agarwala,David A Scott&Feng Zhang.2013.Genome engineering using the CRISPR-Cas9system.Nat Protoc；8(11): A 2281-2308. " text, the public can buy (Cat.#:48138) from addgene.

PX458 plasmid can express EGFP fluorescin, and EGFP fluorescin can be used for fluorescence flow cytometry sorting Dan Ke Grand cell can get the cell line of gene knockout.

Bacillus coli DH 5 alpha: Biomed company, article No. BC102-01 are purchased from.

N2a cell line: ATCC company buys (Cat.#:CCL-131)

Embodiment one: the building of the N2a cell line of zDHHC17 gene is knocked out

1. the determination of gene to be knocked out target sequence

The shearing splicing and structure of zDHHC17 gene are checked by http://asia.ensembl.org/index.html Domain information, choosing zDHHC17 Gene Partial sequence (shown in SEQ ID NO:1, containing intron sequences) is gene to be knocked out sequence. Sequence shown in SEQ ID NO:1 is analyzed using http://crispor.tefor.net/, on this basis artificial screening Suitable target sequence.For sequence shown in SEQ ID NO:1, two target sequences of the present inventor's final design, respectively For 264-283 (TTTATCCATGGTTGTACAAC is denoted as target sequence 1) of sequence shown in SEQ ID NO:1 and 298- 317 (GCAGACCCCTCCTTAATTGA is denoted as target sequence 2).

When progress target sequence determines, the present inventor is carried out according to following principle:

(1) according to http://crispor.tefor.net/ to sequence 1 analyze as a result, choose it is specific compared with High target sequence (specificity score > 80).

(2) being typically chosen the sequence that meeting on exon requires in (1) is target sequence, the cell of the general same knockout It is while sets up two pairs of satisfactory target sequences.

(3) it is desirable to be spaced a distance (40-150bp) both when two pairs of satisfactory target sequences of selection.

(4) selected target sequence is preferably located at the more important functional domain of translated protein, in this way can be more Good guarantee knocks out effect.

2.DNA oligo design of primers

According to the target sequence that step 1 determines, two pairs of DNA oligo primers are designed, particular sequence is as follows:

It has synthesized two pairs of Oligonucleolide primers and has been used to prepare gRNA, sequence is as follows:

For the DNA oligo primer of target sequence 1:

ZDHHC17-gRNA-up1:5 '-CACCGTTGTACAACCATGGATAAA-3 ' (as shown in SEQ ID NO:2)

ZDHHC17-gRNA-down1:5 '-AAACTTTATCCATGGTTGTACAAC-3 ' (as shown in SEQ ID NO:3)

For the DNA oligo primer of target sequence 2:

ZDHHC17-gRNA-up2:5 '-CACCGCAGACCCCTCCTTAATTGA -3 ' (as shown in SEQ ID NO:4)

ZDHHC17-gRNA-down2:5 '-AAACTCAATTAAGGAGGGGTCTGC-3 ' (as shown in SEQ ID NO:5)

3. expressing the building of the recombinant plasmid of gRNA

(1) the single-stranded annealing of oligonucleotides obtains double chain oligonucleotide

By two DNA oligo for target sequence 1 of synthesis it is single-stranded (positive single stranded DNA 1 and reversed single stranded DNA 1, point Not as shown in SEQ ID NO:2 and 3) annealing, obtain double-strand double chain oligonucleotide 1 (double-stranded DNA 1)；

By two DNA oligo for target sequence 2 of synthesis it is single-stranded (positive single stranded DNA 2 and reversed single stranded DNA 2, point Not as shown in SEQ ID NO:4 and 5) annealing, obtain double-strand double chain oligonucleotide 2 (double-stranded DNA 2)；

Annealing reaction system and annealing reaction condition are as follows:

Annealing reaction system: zDHHC17-gRNA-up1 or zDHHC17-gRNA-up2 (100 μM of concentration) 1 μ l； ZDHHC17-gRNA-down1 or zDHHC17-gRNA-down2 (100 μM of concentration) 1 μ l；NEB T4ligase buffer10X 1 μl；NEB T4PNK 0.5μl；ddH₂O 6.5μl；10 μ l of total system.

Annealing reaction condition: above-mentioned system is put into PCR instrument after mixing, 37 DEG C of effect 30min；95 DEG C of effects 5min；95 DEG C are cooled to 25 DEG C, and rate of temperature fall is 6 DEG C/min；65 DEG C of effect 10min.4 DEG C of preservations, are directly used in connection.

(2) digestion and connection reaction

PX458 plasmid is extracted with Axygen small amount plasmid extraction kit, then uses NEB restriction endonuclease BbsI Digestion is carried out, digestion condition is 37 DEG C and cuts 12h.Plasmid after digestion is carried out to 1% agarose gel electrophoresis detection digestion effect Fruit simultaneously carries out glue recycling, and it is Axygen Products that glue, which recycles used kit,.

Because annealed product directly contains the viscous end complementary with pX458 carrier restriction enzyme site, therefore it is used directly for connecting Experiment.

Glue digested plasmid after the recovery is attached with glue recycling annealed product and is reacted, specific system and condition are as follows:

Linked system: 1 μ l of annealed product (double chain oligonucleotide 1 or double chain oligonucleotide 2)；Glue digestion after the recovery PX458 carrier (concentration 50ng/ μ l) 1 μ l；1 μ l of NEB T4 ligase；NEB T4ligase buffer 10X 1μl；ddH₂O 6 μl；10 μ l of total system.

Condition of contact: 21 DEG C of connection 4h in PCR instrument.

(3) it converts

10 μ, 1 connection product is added in the bacillus coli DH 5 alpha competent cell of 50 μ 1 in superclean bench, ice bath 30min, then heat shock 90s in 42 DEG C of water-baths, then ice bath 5min, after 800 μ, 1 nonreactive LB liquid medium is then added, 37 DEG C, after 160rpm shake culture 45min, it is coated with the LB solid plate of ammonia benzyl resistance, overnight incubation in 37 DEG C of incubators.It is to appear After single colonie, 3 bacterium colonies being of moderate size of picking, 3ml Liquid Culture 8h prepares glycerol tube, and thallus transfers to Wuhan Jin Kairui public Department is sequenced.

It will show to be inserted into " 5 '-GTTGTACAACCATGGATAAA- at the restriction enzyme site BbsI of pX458 plasmid through sequencing 3 ' " the recombinant plasmid name of the DNA fragmentation as shown in SEQ ID NO:6 are as follows: pX458-zDHHC17-1；It will show through sequencing " 5 '-GCAGACCCCTCCTTAATTGA-3 ' " DNA as shown in SEQ ID NO:7 is inserted at the restriction enzyme site BbsI of pX458 plasmid The recombinant plasmid of segment is named are as follows: pX458-zDHHC17-2.

(4) extraction of recombinant plasmid

Will sequencing correctly clone carries out 15ml Liquid Culture, with it is endotoxin-free it is a small amount of in mention plasmid extraction kit (Tiangeng company) extracts recombinant plasmid and measures plasmid concentration, extracts the concrete operation step of recombinant plasmid in strict accordance with specification It carries out.

4. transfection and the screening of monoclonal

By recombinant plasmid pX458-zDHHC17-1 and pX458-zDHHC17-2 the corotation N2a cell of building, concrete operations Steps are as follows:

(1) by N2a cell point to overnight incubation after 6 porocyte culture plates, used medium is containing 10% (volume fraction) The MEM culture medium of FBS carries out next-step operation when morning next day, cell confluency degree reached 70% or so.

(2) cell that cell confluency degree reaches 70% is changed into liquid into opti-MEM, is transfected after 2h.Then by two kinds Plasmid (each 1ug) and P3000 (4 μ 1) are diluted in the opti-MEM of 125 μ 1, and mixing is stored at room temperature 5min； LipofectamineTM3000 (5 μ 1) is diluted in the opti-MEM of 125 μ 1, and mixing is stored at room temperature 5min；After dilution LipofectamineTM3000 is added in the plasmid to dilution and P3000 mixed system, mixes gently；After standing 30min, It is gently added dropwise in the cell for shifting to opti-MEM culture medium in advance, is placed in 37 DEG C of cell incubators and is cultivated, it will after 4-6h Cell changes liquid to be continued to cultivate into the MEM culture medium for containing 10% (volume fraction) FBS.

(3) wait add plasmid for 24 hours after -48h, the expression of fluorescence microscopy microscopic observation EGFP.Most cells occur When green fluorescence, it is ready for the unicellular separation of streaming.

(4) prepare the fresh MEM (containing FBS) of every 200 μ of hole addition 1 of 2 96 orifice plates, be used for unicellular culture.

(5) the cell 1-3min in pancreatin (0.25%trypsin) the processing 6 orifice plates of 37 DEG C of 1.5ml preheatings, until cell It is completely dispersed；1.5ml MEM (containing FBS) is added to terminate pancreatin digestion.The cell of suspension is transferred to sterile 15ml centrifuge tube, 500g is centrifuged 5min, discards supernatant；Cell is resuspended with the fresh MEM of 2ml (containing FBS) culture medium, is transferred to streaming pipe, carries out streaming Sorting.

(6) sorting of EGFP fluorescence flow obtains unicellular, and unicellular be placed in 96 orifice plates for sorting acquisition is cultivated；2-3 days The fresh MEM (containing FBS) of 120 μ 1 is added, the growing state of monoclonal, the every 7 days culture mediums replaced in an orifice plate in peep hole； Monoclonal cell grows up to cell mass and probably needs 14 day time, and 24 orifice plate cultures are transferred to after cell is dispelled, and cultivates 2-3 days Corresponding 2 holes for being transferred to 6 orifice plates in every hole afterwards, 1 hole are used for cell cryopreservation, and 1 hole is tested for PCR identification and Western Blot Card.

(7) PCR identifies positive colony

The monoclonal cell for being extended to 6 orifice plates is collected, a part of cell cracking is taken and is handled with Proteinase K；Cell cracking PCR identification is directly used in after liquid dilution.It freezes after remaining cell RIPA cracking, is verified for Western Blot.PCR reagent is The Plus Mix Cat.#:P2032 of Dongsheng biology.

The primer sequence of N2a cell line for PCR identification zDHHC17 gene knockout is as follows:

PCR-KOzDHHC17-up:5 '-the CTCCTCAAGTCTGCGCTTTC-3 ' (181- of sequence SEQ ID NO:1 200)

PCR-KOzDHHC17-down:5 '-ACGCACACTATTGAGAGTTCC-3 ' (the of sequence SEQ ID NO:1 404-424 reverse complementary sequences)

PCR-KOzDHHC17-up and PCR-KOzDHHC17-down primer pair amplifies are used to cannot get size as 244bp mesh Band (sequence SEQ ID NO:1 181-424) clone be the positive.

Experiment simultaneously using the N2a cell line genome of wild type as template as a control group.

The results show that using the N2a cell line genome of wild type as template as a control group.Using PCR-KOzDHHC17- It is 244bp purpose band (sequence SEQ ID NO:1 181- that up and PCR-KOzDHHC17-down primer pair amplifies, which obtain size, 424).And the N2a cell of part cotransfection recombinant plasmid pX458-zDHHC17-1 and pX458-zDHHC17-2, using PCR- It is 244bp purpose band (sequence SEQ that KOzDHHC17-up and PCR-KOzDHHC17-down primer pair amplifies, which cannot get size, ID NO:1 181-424), only amplification obtains band less than normal, is accredited as positive colony.As a result as shown in Figure 1, swimming lane 1 is DNA Marker；Swimming lane 2 is using wild type N2a cell line genome as the control group of template；Swimming lane 5 is potential homozygous knockout Cell line；Swimming lane 3,4,6,7 is the amplification for having knocked out the positive colony of the N2a cell line after the zDHHC17 gene of part.

(8) Western Blot verifies the expression of zDHHC17

Prepare the RIPA lysate of the positive cell line to be verified and wild type N2a cell line, and with the method for BCA to sample The total protein concentration of product carries out quantitative (BCA kit is produced by Tiangeng company).Take equivalent sample and electrophoresis loading buffer Mixing, 95 DEG C of processing 5min, the sample handled well are used for subsequent detection.

Ready sample is subjected to Western Blot analysis.Concrete operation step are as follows:

A. SDS-PAGE is carried out according to method described in " molecular cloning ", uses the protein Marker of pre-dyed as instruction Gel after electrophoresis, is put into electricity and turns to carry out transferring film after balancing 2min in buffer by agent.

B. the standard wet type membrane-transferring device for using Bio-Rad, sets transferring film electric current as 300-400mA, and the transferring film time is 90min。

C. after transferring film, protein film is placed into preprepared Western cleaning solution immediately, rinses 1- 2min, to wash away the transferring film liquid on film.Cleaning solution is exhausted, Western confining liquid is added, is slowly shaken on shaking table, room temperature envelope Close 60min.

D. confining liquid is exhausted, the primary antibody diluted is added immediately, 4 DEG C slowly shake overnight incubation on the side shaker.

E. cleaning solution washs 5-10min, washs 3 times altogether.Cleaning solution is exhausted, the secondary antibody diluted is added immediately, room temperature exists It is slowly shaken on side-sway shaking table and is incubated for 2h.

F. cleaning solution washs 5-10min, washs 3 times altogether.Transfer film is gently contacted to filter paper and blots liquid, there is protein It is placed on preservative film upward on one side.Luminescent solution (Tiangeng Products) A liquid, B liquid is taken to be uniformly mixed in equal volume.By ECL mixed liquor It is added drop-wise on transfer film, reacts 3min.It is put into CLI NX chemical gel imager and is imaged.

As a result as shown in Fig. 2, swimming lane 1 is albumen Maker；Swimming lane 2 is the expression knot of wild type N2a cell line zDHHC17 Fruit (obtains the purpose band of size about 72KD), and swimming lane 3,4,5,6 is the N2a cell line knocked out after part zDHHC17 gene The expression of results (no purpose band) of zDHHC17.β-actin is sample internal reference.From the results, it was seen that knocking out part N2a cell line after zDHHC17 gene can't detect the expression of zDHHC17 albumen, show that the cell line knocks out successfully.

SEQUENCE LISTING

<110>Xinxiang College of Medical Science

<120>the N2a cell line of knockout zDHHC17 gene and its construction method and kit

<130> zDHHC17

<160> 7

<170> PatentIn version 3.3

<210> 1

<211> 583

<212> DNA

<213> Mus musculus

<400> 1

tacttaaata ggttttttgg gggttttaag atcatattgg aatgaactca cttaataatt 60

actatgcttt cattaagtta tcaaagctgt tgctccaatt aagactttga agaactgtga 120

actcctgtgt cttgttttaa agcaacttga taaaatgtgt gctttgattc catccttacg 180

ctcctcaagt ctgcgctttc ctagaagact ttggaatcac ttaatgtcta aatgctcgtc 240

ttcctgtttt ttagacaagg ccatttatcc atggttgtac aactaatgaa atatggtgca 300

gacccctcct taattgatgg ggaaggatgc agctgtatcc acttggctgc tcagttcgga 360

catacctcaa ttgttgctta tcttatagca aaaggacagg taaggaactc tcaatagtgt 420

gcgtcttaac catgtattat ttatggctta aatgcctgat attcgaagca ttacactttt 480

aatacctgaa aatacttaag tagtagtttc tgatggagga ggagagtaaa agaaagtgta 540

gttatttttg tactaagttt taatgtactt aaagtaagag caa 583

<210> 2

<211> 24

<212> DNA

<213>artificial synthesized

<400> 2

caccgttgta caaccatgga taaa 24

<210> 3

<211> 24

<212> DNA

<213>artificial synthesized

<400> 3

aaactttatc catggttgta caac 24

<210> 4

<211> 24

<212> DNA

<213>artificial synthesized

<400> 4

caccgcagac ccctccttaa ttga 24

<210> 5

<211> 24

<212> DNA

<213>artificial synthesized

<400> 5

aaactcaatt aaggaggggt ctgc 24

<210> 6

<211> 20

<212> DNA

<213>artificial synthesized

<400> 6

gttgtacaac catggataaa 20

<210> 7

<211> 20

<212> DNA

<213>artificial synthesized

<400> 7

gcagacccct ccttaattga 20

Claims (10)

1. the method that building knocks out the N2a cell line of zDHHC17 gene, which is characterized in that the method is based on CRISPR- The construction method of Cas9 system.

2. according to the method described in claim 1, it is characterized by: the method is with zDHHC17 gene shown in SEQ ID NO:1 Meet sequence conduct shown in " 20N " in the sequence of 5 ' -20N-NGG-3 ' or 5 '-CCN-20N-3 ' series arrangement rule in sequence Target sequence；N is A or T or C or G.

3. according to the method described in claim 2, it is characterized by: the target sequence is zDHHC17 base shown in SEQ ID NO:1 Because of 264-283 of sequence or 298-317.

4. according to the method described in claim 3, it is characterized by: described method includes following steps (A) and (B):

(A) include the following steps (a1)-(a3):

(a1) two single stranded DNAs of entitled positive single stranded DNA 1 and entitled reversed single stranded DNA 1 are synthesized；The forward direction is single-stranded The sequence of DNA1 is as shown in SEQ ID NO:2；The sequence of the reversed single stranded DNA 1 is as shown in SEQ ID NO:3；

(a2) the positive single stranded DNA 1 and the reversed single stranded DNA 1 are subjected to annealing reaction, obtain double-stranded DNA 1；

(a3) double-stranded DNA 1 is connected at the cleavage site of restriction enzyme BbsI of pX458 plasmid, obtained weight Group plasmid is denoted as pX458-zDHHC17-1；

(B) include the following steps (b1)-(b4):

(b1) two single stranded DNAs of entitled positive single stranded DNA 2 and entitled reversed single stranded DNA 2 are synthesized；The forward direction is single-stranded The sequence of DNA2 is as shown in SEQ ID NO:4；The sequence of the reversed single stranded DNA 2 is as shown in SEQ ID NO:5；

(b2) the positive single stranded DNA 2 and the reverse DNA 2 are subjected to annealing reaction, obtain double-stranded DNA 2；

(b3) double-stranded DNA 1 is connected at the cleavage site of restriction enzyme BbsI of pX458 plasmid, obtained weight Group plasmid is denoted as pX458-zDHHC17-2；

(b4) by the pX458-zDHHC17-2 plasmid and (a3) described pX458-zDHHC17-1 plasmid co-transfection N2a cell, The N2a cell line that zDHHC17 gene is knocked is obtained from the N2a cell after transfection.

5. according to the method described in claim 4, it is characterized by: in step (a2) and step (b2), the annealing reaction Condition it is equal are as follows: 95 DEG C of effect 5min, 95 DEG C are cooled to 25 DEG C, and rate of temperature fall is 6 DEG C/min；It, will be described in step (b4) When pX458-zDHHC17-1 and pX458-zDHHC17-2 plasmid co-transfection N2a cell, the pX458-zDHHC17-1 and The mass ratio of pX458-zDHHC17-2 plasmid is 1:1.

6. knocking out the N2a cell line of zDHHC17 gene, it is characterised in that: the cell line is using any in claim 2-5 The mouse Nerve tumor mother cell N2a-KO- that the method that building described in knocks out the N2a cell line of zDHHC17 gene obtains zDHHC17。

7. complete plasmid, it is characterised in that: the pX458-zDHHC17-1 plasmid as described in claim 4 and the pX458- ZDHHC17-2 plasmid composition.

8. the purposes of complete plasmid described in claim 7, it is characterised in that: the purposes is to be knocked out based on CRISPR-Cas9 ZDHHC17 gene in N2a cell.

9. constructing the kit for knocking out the N2a cell line of zDHHC17 gene based on CRISPR-Cas9, it is characterised in that: the examination Agent box contains complete plasmid and specification as claimed in claim 7；Any one of claim 2-5 is recorded in the specification The method.

10. the N2a cell line as claimed in claim 6 for knocking out zDHHC17 gene is ground in the function of zDHHC17 palmitoylation substrate Study carefully and the application in the study of pathogenesis of Huntingdon disease.