CN103820481B - The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof - Google Patents
The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof Download PDFInfo
- Publication number
- CN103820481B CN103820481B CN201410037328.0A CN201410037328A CN103820481B CN 103820481 B CN103820481 B CN 103820481B CN 201410037328 A CN201410037328 A CN 201410037328A CN 103820481 B CN103820481 B CN 103820481B
- Authority
- CN
- China
- Prior art keywords
- real
- plasmid
- chicken
- goal gene
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to molecular pathology and immunological technique field, relate to the structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof.By gathering the lymphocytic total serum IgE of chick, total serum IgE reverse transcription is become cDNA; Adopt regular-PCR amplification PD-L2 goal gene fragment, detect through agarose gel electrophoresis, and reclaim purifying; By PD-L2 goal gene fragment and pMD? 18-T carrier connects, and is converted in competent cell DH5 α, extracts recombinant plasmid; After colony screening, carry out sequencing analysis, to choose with the positive plasmid of goal gene fragment identical sequence as standard substance plasmid, be depicted as typical curve by copy concentrations; The gene abundance of PD-L2 is measured according to fluorescent signal change and typical curve; PD-L2 gene abundance real-time detection method of the present invention have detect that flux is high, susceptibility is high, high specificity, easy and simple to handle, cost is low and the advantage such as quantitatively accurate.<b />
Description
Technical field
The invention belongs to molecular pathology and immunological technique field, be specifically related to the structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof.
Background technology
Infectious bursal disease (infectiousbursaldisease, IBD) is caused by infectious bursal disease virus (infectiousbursaldiseasevirus, IBDV) that the one of chick is acute, high degree in contact sexually transmitted disease.Research shows, IBDV can cause immunosuppressive condition and the persistent infection of body after infecting.The target organ of virus infection is the fabricius bursa, and virus copies and causes the damage of fabricius bursa lymph follicle, destruction in B cell, and bone-marrow-derived lymphocyte dissolves.Meanwhile, virus copies a large amount of secretions causing inflammatory mediator, viral diffusion and damage aggravation in fabricius bursa monocytes/macrophages system, forms septic shock syndrome, causes serious B cell immune response suppression, and exacerbates the death of disease chicken.In addition, after IBDV infects, the suppression of pre-B lymphocyte propagation and the generation of apoptosis, be also the major reason causing humoral immunization to suppress.
Programmed death ligand (PD-L2) and programmed death acceptor-1 (PD-1) thereof are CD28/B7 superfamily members, and its expression is relatively limited to, and mainly expresses on antigen presenting cell, as the scavenger cell, DC etc. of activation.There are some researches prove, the PD-L2mRNA of people and mouse is high expression level in placenta, liver cancer cell, breast cancer cell and neuroblast.But at spleen, lymphoglandula, thymus gland with become in low expression in fibrous tissue, this makes itself and PD-Ll and other B7 family members have very large difference on express spectra.In immunomodulatory, PD-L2 and its acceptor PD-1 mediates the activation of PD-1:PD-L signal path jointly, premunition tolerance and immunosuppression signal in central immune and periphery immune response, there is restraining effect to the function of antigen specific T, B cell, the propagation of T cell, the secretion of cytokine and kill capability, most of function of T cell after blocking this path, can be recovered.Confirm through correlative study, the infection of some viruses can induce the expression of PD-L2 and acceptor PD-1 thereof, thus affects PD-1:PD-Ls path, makes the immune supervision of viral escape and kills and wounds, and causes body to produce immunosuppression and persistent infection.Therefore, PD-L2 and acceptor PD-1 thereof becomes the focus that people pay close attention in the immunosuppressive disease researchs such as chronic sustained infections, immunotolerance disease, tumour in recent years gradually, and in animal immune inhibition disease or viral persistence infection, the research of T cell immunosuppression path PD-1:PD-Ls is just at the early-stage, and the research particularly in poultry is rare report also.
In recent years, real-time fluorescence quantitative PCR (Real-TimePCR) technology is that gene abundance detection provides brand-new method, compare with traditional method, have that susceptibility is high, high specificity, easy and simple to handle, cost is low and the advantage such as quantitatively accurate is widely used, it can reach the object of monitoring in real time by the fluorescence signal intensity detecting target sequence pcr amplification.But the Real-TimePCR detection system of the abundance of PD-L2 gene in chicken peripheral blood lymphocytes is set up and the research of application there is not been reported.
Summary of the invention
The technical problem to be solved in the present invention is: the construction process that the invention provides a kind of chicken peripheral blood mononuclear lymphocyte PD-L2 real-time fluorescence quantitative PCR positive criteria recombinant plasmid;
The present invention establishes a kind of real-time fluorescence quantitative PCR detection method of PD-L2 gene abundance on this basis, and the method has the advantages such as susceptibility is high, high specificity;
The present invention is by the Changing Pattern of PD-L2 in research peripheral blood lymphocytes, for the quantitative analysis of chicken PD-L2 Molecular Detection provides technology platform, and can be used for analyzing chicken infection immunity inhibition disease as in the Changing Pattern of the transcriptional level of PD-L2 gene after IBD.
technical scheme of the present invention:
The construction process of chicken peripheral blood mononuclear lymphocyte PD-L2 real-time fluorescence quantitative PCR positive criteria recombinant plasmid, comprises the following steps:
Gather the peripheral blood of chick, isolate lymphocyte, extract lymphocytic total serum IgE, total serum IgE reverse transcription is become cDNA, cDNA is stored in-20 DEG C, adopt regular-PCR method amplification PD-L2 goal gene fragment;
Adopt regular-PCR method amplification PD-L2 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaims purifying; Then PD-L2 goal gene purified fragments is connected with pMD18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Reaction system wherein during regular-PCR amplification is 25 μ L, and reaction system is as follows: 2 μ L sample cDNA templates, 2.5 μ L10 × PCRBuffer, 2 μ LdNTP, concentration is forward primer and each 0.5 μ L of reverse primer of 20 μm of ol/L, the Taq DNA polymerase of 0.5 μ L, and all the other are aseptic tri-distilled water;
Forward primer F:5 '-CCGCAATGGGAAAGCAC-3 ',
Reverse primer R:5 '-TGACGCTGGTAATGTGAAGGA-3 '.
Described goal gene fragment is the SEQIDNo.1 sequence of sequence table.
Wherein common PCR reaction program: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 10min.
A Real-time detection method of abundance for chicken peripheral blood mononuclear lymphocyte PD-L2 gene, comprises the following steps:
(1) the PD-L2 goal gene fragment reclaiming purifying is connected with pMD18-T carrier, is then converted in competent cell DH5 α, extract recombinant plasmid; Sequencing analysis is carried out after colony screening, choose with the positive plasmid of PD-L2 goal gene fragment identical sequence as standard substance plasmid, the DNA concentration of bioassay standard product plasmid, and be converted into the copy concentrations of plasmid, by 1:10 concentration gradient dilution positive plasmid doubly;
(2) with the positive plasmid diluted for template, carry out real-time fluorescence quantitative PCR amplified reaction, detect fluorescent signal with real-time fluorescence quantitative PCR instrument, after reaction terminates, draw out typical curve, then measure the gene abundance of PD-L2 in sample DNA according to the change of fluorescent signal and typical curve;
Wherein the reaction system of real-time fluorescence quantitative PCR amplification is 20 μ L, and comprise 2 μ L plasmid templates, concentration is forward primer F and each 0.2 μ L, SYBRGreenIPreMix10 μ L, the tri-distilled water 7.6 μ L of reverse primer R of 20 μm of ol/L;
Wherein, forward primer F:5 '-CCGCAATGGGAAAGCAC-3 ',
Reverse primer R:5 '-TGACGCTGGTAATGTGAAGGA-3 '.
Described goal gene fragment is the SEQIDNo.1 sequence of sequence table.
Wherein quantitative fluorescent PCR response procedures is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; 60 DEG C of annealing and extension 34s, collect fluorescent signal when 60 DEG C, then 40 circulations.
Described real-time fluorescence quantitative PCR instrument is ABI7500Fast type quantitative real time PCR Instrument.
The positive plasmid concentration range of described dilution is for being 4.95 × 10
10-4.95 × 10
1copies/ μ L; The coefficient R of described typical curve
2=0.995, slope is-3.808.
Application in the transcriptional level Changing Pattern of described detection method PD-L2 gene after analyzing chicken infection immunity inhibition disease.
positive beneficial effect of the present invention:
The present invention establishes the method for the real-time fluorescence quantitative PCR of PD-L2 gene abundance in chicken peripheral blood lymphocytes, for better, accurate quantitative analysis is carried out to the transcriptional level of PD-L2 under chicken immune holddown, and then the Changing Pattern of PD-L2 in research peripheral blood lymphocytes, for the quantitative analysis of chicken PD-L2 Molecular Detection provides technology platform, and the biological function played in immunosuppressive diseases in chickens for PD-L2 and application system thereof lay the foundation.
Technical scheme disclosed in this invention is compared with conventional art, and susceptibility is higher, utilizes the method set up to 10
9~ 10
1the standard positive plasmid of 9 groups of different concns of copies/ μ L detects, and result shows: in the present invention, the Monitoring lower-cut of PD-L2 is 10copies/ μ L, its concentration and C
tgood linear relationship is had, coefficient R between value
2=0.995; Utilize the method set up to carry out replica test, organize replica test result between interior and group and show, the variation coefficient is all within 3%, and the present invention has good repeatability; From solubility curve figure, there is single narrow peak (Fig. 4) in PD-L2 molecular melting curve, and agarose gel electrophoresis analysis shows, Real-timeRT-PCR amplification is single specificity object fragment (Fig. 5), illustrates that the present invention has good specificity; The present invention also has and detects that flux is high, easy and simple to handle, cost is low and the feature such as quantitatively accurate in addition.
The present invention confirms by experiment, and after chicken infectivity bursa of Fabricius virus IBDV infects, the expression amount copying PD-L2 along with virus in body raises gradually, illustrates that the variation relation of the infection of IBDV and virus load and chicken PD-L2 gene abundance is very close; And after confirming chicken IFN-γ V infection there is certain relation between changing in the expression of PD-L2 expression change and IFN-γ, IL-2 cytokine, chicken PD-L2 have activated PD-1:PD-Ls signal path after expressing and raising, cause the decline of chicken T cell immunologic function and proliferation activity, cause the sustainable existence of rehabilitation chicken or subclinical infection chicken immune inhibited reaction.
Chicken PD-L2 gene real-time fluorescence quantitative PCR detection method of the present invention, for detecting chicken infection immunity inhibition disease (as infectious bursal disease IBD, chicken Marek's disease MD, chicken infectious anemia CIA, the sick RE of avian leukosis ALD and chicken reticuloendotheliosis etc.) the expression Changing Pattern of PD-L2 provides a kind of technology platform in the immunosuppressive condition that causes, thus enriched immunosuppressive diseases in chickens further and cause immunosuppressant mechanism.
Accompanying drawing explanation
Fig. 1 is that sepharose detects chicken PD-L2 gene amplification result;
Fig. 2 is chicken PD-L2 Real time PCR amplification curve;
Fig. 3 is chicken PD-L2 Real time PCR typical curve;
Fig. 4 is chicken PD-L2 Real time PCR standard substance solubility curves;
Fig. 5 is chicken PD-L2 real time fluorescent quantitative product specificities analytical results;
Fig. 6 is the copy number that chicken infects PD-L2 gene in IBDV different times T cell;
Fig. 7 is that chicken infects IBDV virus load semiquantitive PCR detected result in IBDV different times body;
Fig. 8 is the copy number that chicken infects IBDV different times IFN-γ gene;
Fig. 9 is the copy number that chicken infects IBDV different times IL-2 gene;
Figure 10 is that after experimental group chicken infects IBDV rehabilitation, the biopsy of thymus T cells propagation is surveyed;
Figure 11 is that after control group chicken infects IBDV rehabilitation, the biopsy of thymus T cells propagation is surveyed.
Embodiment
In the present invention, the concept of gene copy number, gene abundance TYP; Real-timePCR, real-time fluorescence quantitative PCR represent same concept; ddH
2o represents distilled water; IBDV represents chicken infectivity bursa of Fabricius virus; CFSE is a kind of fluorescence dye that can mark active somatic cell.
Laboratory animal in embodiment and bacterial classification: 1 age in days healthy chick, raise to 4 week age in SPF shield retaining; IBDV, LD
5010
6/ 0.1mL, is separated for this laboratory and preserves; Competent escherichia coli cell DH5 α, for this laboratory is preserved.
Main agents and instrument: lymphocyte separation medium, purchased from Tianjin Hao sun biological products Science and Technology Ltd.; IBDV Rapid detection test strip, purchased from Henan Bao'ao Biology Engineering Co., Ltd; PCR primer purifying reclaims test kit, purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; Taq DNA polymerase, Reverse Transcription box, pMD18-T carrier, all purchased from the precious biotechnology company limited in Dalian; SYBRGreenI, purchased from Invitrogen company.
embodiment 1: the structure of chicken PD-L2 real-time fluorescence quantitative PCR positive criteria recombinant plasmid
Gather the peripheral blood of chick in 4 week age, the specification sheets with reference to lymphocyte separation medium is separated the lymphocyte of peripheral blood, carries out the extraction of total serum IgE with reference to Invitrogen company's T RIzol test kit specification sheets and pertinent literature.The total serum IgE extracted becomes cDNA with reference to the reverse transcription of Reverse Transcription box specification sheets, be stored in-20 DEG C for subsequent use, for the template of the PD-L2 goal gene fragment that increases.
Adopt regular-PCR method amplification PD-L2 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaims purifying; Then PD-L2 goal gene purified fragments is connected with pMD18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Described goal gene fragment is the SEQIDNo.1 sequence in sequence table:
CCGCAATGGGAAAGCACTCACTTCATCCCAACATCATGATTACATGGGAAGAGCAGCACTGTTACGCAACGAATTGAAATTGGGACGTGCAATCCTTCACATTACCAGCGTCA。
In order to build the common PCR reaction system of PD-L2 real-time fluorescence quantitative PCR positive criteria recombinant plasmid:
Common PCR reaction system is 25 μ L, reaction system is as follows: 2 μ L sample DNA templates, negative control with aseptic tri-distilled water for template, 2.5 μ L10 × PCRBuffer, 2 μ LdNTP, the each 0.5 μ L(20 μm ol/L of forward and reverse primer), 0.5 μ LTaqDNA polysaccharase (Dalian Bao Bio-Engineering Company), all the other volumes are supplied with aseptic tri-distilled water; Reaction system softly mixes, and carries out amplified reaction in regular-PCR instrument.
Regular-PCR program is: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C extend 30s, 30 circulations.Last 72 DEG C extend 10min.
Chicken PD-L2 real-time fluorescence quantitative PCR primer is synthesized by certain biotech firm, and primer sequence is as follows:
Forward primer F:5 '-CCGCAATGGGAAAGCAC-3 ',
Reverse primer R:5 '-TGACGCTGGTAATGTGAAGGA-3 '.
Regular-PCR product is carried out 2% agarose electrophoretic analysis, voltage 100V, observe product after 35min under ultraviolet lamp, result display amplifies single band, and clip size is at about 100bp.
Amplification is shown in that in accompanying drawing 1, figure, M is DL2000 molecular weight standard, and 1 is the amplified production of PD-L2 gene, and amplified band religion is clear, affects without primer dimer.Extension increasing sequence is after clone, order-checking, the comparison of nucleic acid homology is carried out in GenBank, result shows, in sequence SEQIDNo.1 and the GenBank obtained, the sequence homology of chicken PD-L2 gene (XM424812) is 100%, illustrate that primer and amplified production are all correct, can be used for next step experimental study.
After specific fragment is carried out sepharose recovery, carry out Cloning Transformation, transfer to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to carry out sequencing analysis the positive colony of acquisition.
embodiment 2:the foundation of chicken PD-L2 real-time fluorescence quantitative PCR system
(1) preparation of plasmid DNA template
PD-L2 goal gene fragment after utilizing embodiment 1 sepharose to reclaim and pMD18-T carrier (TaKaRa, Dalian) connect, and are then converted in competent cell DH5 α, extract recombinant plasmid; Carry out sequencing analysis after colony screening, sequencing result shows sequence 100% homology with PD-L2 gene in GenBank, and illustrate that obtained sequence is correct, positive plasmid can be used for the making of plasmid standard.Use this standard substance plasmid DNA concentration of trace dna albumen spectrophotometric determination to be 152.1 μ g/mL, primary standard product plasmid solution is carried out 1:10 doubling dilution doubly.
(2) calculating of standard plasmid concentration and the making of PD-L2 typical curve
Extract the plasmid through the positive colony of sequence verification, the plasmid DNA concentration of acquisition is converted into copy number.
The method of calculation of plasmid copy number are: copy number (copies/ μ L)=concentration (μ g/ μ L) × 6.02 × 10
23(copies/ μ L)/MW(g/mol).
Wherein MW=(cloning vector length+object fragment length) (bp) × 660g/mol/bp.
Known: cDNA=104.6 μ g/mL.Plasmid PMD18-T sequence length is 2692bp, PD-L2 gene insert length is 113bp, and the average molar mass of single base is 660g/mol, and calculation formula is:
Molecular weight (MW)=(2692+113) × 660=1.85 × 10
6g/mol.
Plasmid copy concentration: 6.02 × 10
23× (152.1 × 10
-9) ÷ (1.85 × 10
6)=4.95 × 10
10copies/ μ L.
Using the plasmid solution of above-mentioned known copy concentration as standard plasmid, when carrying out Real-timePCR Specification Curve of Increasing, by 1:10 times of gradient dilution, (concentration range is 4.95 × 10
10-4.95 × 10
1copies/ μ L).
The plasmid of known copy number is carried out 10 times of gradient dilutions, obtain plasmid standard.
With the plasmid diluted for template, carry out real-time fluorescence quantitative PCR amplified reaction, reaction adopts Real-timePCR test kit SYBRPremixExTaqTM(Invitrogen company), reaction system is 20 μ L:2 μ L standard plasmid templates, F, R primer (20 μm of ol/L) each 0.2 μ L, SYBRGreenIPreMix(Real-timePCR test kit SYBRPremixExTaqTM, Invitrogen company) 10 μ L, tri-distilled water 7.6 μ L.(template is 2 μ LddH all to arrange negative control in each Real-timePCR reaction
2o), Real-timePCR program is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; 60 DEG C of annealing and extension 34s, collect fluorescent signal when 60 DEG C, 40 circulations.F, R primer is wherein identical with embodiment 1.
Typical curve and all testing samples all arrange 3 parallel reactors.Reaction is carried out in ABI7500 quantitative PCR apparatus (U.S. LifeTechnologies), utilizes ABI7500 software detection and collects fluorescent signal, and carrying out data analysis.
The amplification curve (see accompanying drawing 2) of reaction drawn out voluntarily by ABI7500 software Real time PCR software.Amplification curve shows, and 6 curves represent standard substance 10 successively from left to right
7, 10
6, 10
5, 10
4, 10
3, 10
2the amplification curve of gradient dilution liquid, 6 plasmid standard amplification curves are more smooth, present typical S type, and each cycle threshold (Ct value) interval is even.
The cycle threshold (Ct value) of each concentration gradient of standard substance provided according to amplification curve and reaction, the typical curve (see accompanying drawing 3) of reaction drawn out voluntarily by ABI7500 software.The coefficient R of this typical curve
2=0.995, slope is-3.808, and typical curve is Y=-3.808X+45.293, and wherein Y is the Ct value of fluorescence real-time quantitative PCR reaction, and X is the gene constructed standard plasmid copy number logarithmic value of PD-L2.Calculate its amplification efficiency Eff%=83.074%, meet the requirement of ABI7500 quantitative fluorescence analysis to typical curve.
The solvent temperature of the standard substance measuring each concentration dilution gradient in quantitative fluorescent PCR process also draws solubility curve (see accompanying drawing 4).The solubility curve type peak of standard substance and sample is single, and standard substance solvent temperature identical (80.0 ± 0.5 DEG C), shows that amplified reaction product solvent temperature is homogeneous, and specificity is good and without primer dimer.
The gene abundance of PD-L2 in sample DNA can be measured according to the change of fluorescent signal and typical curve.
embodiment 3:chicken PD-L2 real-time fluorescence quantitative PCR system susceptibility, specificity and repeatability are analyzed
The chicken PD-L2 recombinant plasmid adopting embodiment 1 to build to be recombinated standard plasmid as the positive, adopt the chicken PD-L2 real-time fluorescence quantitative PCR detection system that embodiment 2 is set up, the ABI7500 quantitative real time PCR Instrument that real-time fluorescence quantitative PCR instrument adopts LifeTechnologies company (U.S.) to produce carries out.
With 10 of 10 times of serial dilutions
1~ 10
9copies/ μ L chicken PD-L2 positive restructuring standard plasmid does sensitivity test, and result shows that the Monitoring lower-cut of PD-L2 is 10copies/ μ L.
Specificity analyses is done to chicken PD-L2 molecule Real-time-PCR solubility curve (see accompanying drawing 4) and product agarose gel electrophoresis, result shows, there is single narrow peak in solubility curve, can be increased the specific fragment onesize with expection object fragment, do not generate nonspecific products and primer dimer (see accompanying drawing 5).
In carrying out respectively batch by the method set up and batch between repeatability detect, result shows, in batch and batch between the variation coefficient be less than 3%, repeatability good (seeing attached list 1).
Table 1 chicken PD-L2 real time fluorescence quantifying PCR method criticize interior and batch between reproducibility result
embodiment 4:utilize the real time fluorescence quantifying PCR method that the present invention sets up, analyze chicken infects PD-L2 gene abundance in the monokaryon blood lymphocyte of rear periphery Changing Pattern at immunosuppressive disease.
Adopt the chicken PD-L2 real-time fluorescence quantitative PCR system that embodiment 2 is set up: the ABI7500 quantitative real time PCR Instrument that real-time fluorescence quantitative PCR instrument adopts LifeTechnologies company (U.S.) to produce carries out.
10 1 age in days healthy chicks were raised to 4 week age, expands experiment to IBDV maternal antibody level detection through fine jade, after determining that IBDV maternal antibody disappears, be divided into control group and experimental group at random, often organize 5.Wherein experimental group only infects IBDV diluent 0.1mL/ by eye droppings, collunarium; Control group sterilizing PBS makes same treatment.
The 3rd after chick in 4 week age is infected respectively at IBDV, 5, 7, within 10 days, adopt peripheric venous blood, and with the same Japanese instar chickling not infecting IBDV for contrast, be separated the T lymphocyte of infected group and control group peripheral blood simultaneously, and extract total serum IgE, utilize Reverse Transcription box (Dalian is precious biological) reverse transcription synthesis cDNA, utilize the Auele Specific Primer that embodiment 1 provides, the real-time fluorescence quantitative PCR system adopting embodiment 2 to set up detects, calculate according to typical curve and can obtain PD-L2 gene copy number (i.e. gene abundance) in infected group and control group peripheral blood mononuclear lymphocyte, see accompanying drawing 6.
Result shows, with do not infect compared with IBDV healthy chick, at the metainfective different times of IBDV, because the immunological status of body is different, the abundance of each phase PD-L2 gene is different, after IBDV infects, PD-L2 gene abundance does not infect the lasting rising of IBDV control group, and significant difference (P < 0.05).As can be seen here, the abundance of chicken PD-L2 gene has larger associating with the immunological status of body.
embodiment 5:after chicken IFN-γ V infects, PD-L2 expresses the relation between change and body inner virus carrying capacity
Chicken IFN-γ V semiquantitive PCR primer is synthesized by certain biotech firm, and primer sequence is as follows:
Forward primer F:5 '-ACCAGCGAGATAACCCAGCCAAT-3 ',
Reverse primer R:5 '-GCCAAATGCTCCTGCAATCTTCA-3 ';
Chicken β-actin semiquantitive PCR primer is synthesized by certain biotech firm, and primer sequence is as follows:
Forward primer F:5 '-TCCACCGCAAATGCTTCTAAAC-3 ',
Reverse primer R:5 '-CTGCTGACACCTTCACCATTCC-3 '.
Within 3rd, 5,7,10 day, take fabricius bursa tissue, the total serum IgE in Ti Qufashi lens capsule tissue after infecting 4 weeks age chick respectively at IBDV, utilize Reverse Transcription box (the precious biology in Dalian) reverse transcription to synthesize cDNA.PCR reaction system is: template cDNA1 μ L, each 1 μ L, the dNTP2 μ L of F, R primer (20 μm of ol/L), 10 × PCRBuffer2.5 μ L, Ex
tapenzyme 0.5 μ L, tri-distilled water 16 μ L, sets up 25 μ L common PCR reaction systems.Common PCR reaction condition: 95 DEG C of 5min, then carries out 30 circulations: 94 DEG C of 45s, 55 DEG C of 30s, 72 DEG C of 30s; 72 DEG C of 10min, 4 DEG C of preservations.Regular-PCR product after electrophoresis, identifies its brightness and specificity in 2.0% sepharose.Apply IBDV Rapid detection test strip that Henan Province hundred biotechnology difficult to understand company limited produces malicious papova carrying capacity of attacking against each other on antigen levels detect further and determine simultaneously.
Result shows, within metainfective 3rd, 5,7,10 day, all significantly IBDV can be detected at IBDV, and the virus load in the fabricius bursa arrives the highest in the 5th day after infection, reduces (see accompanying drawing 7) gradually afterwards.IBDV Rapid detection test strip detected result shows, IBDV all can detect IBDV in 3,5,7 days after infecting, and within the 10th day, can't detect IBDV, this is consistent with semiquantitive PCR result.
4 results can be found out in conjunction with the embodiments, and along with virus copying in body, the expression amount of PD-L2 raises gradually, illustrate that the variation relation of the infection of IBDV and virus load and chicken PD-L2 gene abundance is very close.
embodiment 6:relation between chicken IFN-γ V infection rear PD-L2 expression change and IFN-γ, IL-2 cytokine-expressing change
Adopt the chicken PD-L2 real-time fluorescence quantitative PCR system that embodiment 2 is set up, the IBDV of embodiment 4 is adopted to infect the peripheral blood of after 4 week age chick the 3rd, 5,7,10 day, with the product of its T lymphocytic total serum IgE reverse transcription cDNA for template, after infecting IBDV, the chicken cell factor IFN-γ, IL-2 expression change of the 3rd, 5,7,10 day detects.
The ABI7500 quantitative real time PCR Instrument that real-time fluorescence quantitative PCR instrument adopts LifeTechnologies company (U.S.) to produce carries out.
Result shows, IFN-γ mrna expression level continues to increase at IBDV period of infection (3-5 days) expression level, and after PD-L2 expression is increased (5 days), IFN-γ expression level sharply declines and be changed significantly (P<0.05), sees accompanying drawing 8.
IL-2mRNA expression level sharply raises after IBDV inoculation on the 3rd day, and along with the activation with PD-1:PD-Ls signal path that continues infected, the lasting reduction (5-10 days) causing IL-2 to express, is shown in accompanying drawing 9.Illustrate after IBDV infects, virus in vivo continue to copy the lasting rising causing IFN-γ gene expression amount, then the rising that chicken PD-L2 expresses is affected, finally have activated PD-1:PD-Ls signal path, after causing chicken rehabilitation, comparatively control group reduction is remarkable for IL-2, IFN-γ expression amount, and the immunosuppression of persistence appears in body.
Embodiment 7: after chicken IFN-γ V infects, PD-L2 expresses the relation between change and Immune Organs of Chichen T cell proliferation activity
Being separated the thymocyte of the 10th day rehabilitation chicken after IBDV infection chick in 4 week age in embodiment 4, after viable count, is 10 with the height sugar 1640 substratum adjustment cell concns containing 10%FBS (foetal calf serum)
6individual/mL, join in 12 porocyte culture plates, 2mL/ hole, it is dual anti-that every hole adds 100IU, 10 μMs of CFSE, 1ng/mL chicken CD3 monoclonal antibodies, 25IU/mL chicken recombinant il-2,37 DEG C of 5%CO
2in incubator, harvested cell after Dual culture 72h, utilizes flow cytometry to detect fluorescent signal.
Result shows, experimental group and control group average fluorescent strength (MFI) are respectively 55.7% (see accompanying drawing 11) and 36% (seeing appendix Figure 10), compared with control group, experimental group MFI significantly increases (P ﹤ 0.05), and after chicken infection IBDV rehabilitation is described, thymus T cells proliferation activity obviously reduces.
Above result all confirms after IBDV infects, and chicken PD-L2 have activated PD-1:PD-Ls signal path after expressing and raising, and the decline causing chicken T cell immunologic function and proliferation activity causes the sustainable existence of rehabilitation chicken or subclinical infection chicken immune inhibited reaction.
SEQUENCELISTING
<110> Xinxiang University
The structure of <120> chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and
Application
<130> molecular pathology and immunological investigation
<160>7
<170>PatentInversion3.4
<210>1
<211>113
<212>DNA
<213> artificial sequence
<400>1
ccgcaatgggaaagcactcacttcatcccaacatcatgattacatgggaagagcagcact60
gttacgcaacgaattgaaattgggacgtgcaatccttcacattaccagcgtca113
<210>2
<211>17
<212>DNA
<213> artificial sequence
<400>2
ccgcaatgggaaagcac17
<210>3
<211>21
<212>DNA
<213> artificial sequence
<400>3
tgacgctggtaatgtgaagga21
<210>4
<211>23
<212>DNA
<213> artificial sequence
<400>4
accagcgagataacccagccaat23
<210>5
<211>23
<212>DNA
<213> artificial sequence
<400>5
gccaaatgctcctgcaatcttca23
<210>6
<211>22
<212>DNA
<213> artificial sequence
<400>6
tccaccgcaaatgcttctaaac22
<210>7
<211>22
<212>DNA
<213> artificial sequence
<400>7
ctgctgacaccttcaccattcc22
Claims (8)
1. the construction process of chicken peripheral blood mononuclear lymphocyte PD-L2 real-time fluorescence quantitative PCR positive criteria recombinant plasmid, is characterized in that: the method comprises the following steps:
Gather the peripheral blood of chick, isolate lymphocyte, extract lymphocytic total serum IgE, total serum IgE reverse transcription is become cDNA, cDNA is stored in-20 DEG C, adopt regular-PCR method amplification PD-L2 goal gene fragment;
Adopt regular-PCR method amplification PD-L2 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaims purifying; Then PD-L2 goal gene purified fragments is connected with pMD18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Reaction system wherein during regular-PCR amplification is 25 μ L, and reaction system is as follows: 2 μ L sample cDNA templates, 2.5 μ L10 × PCRBuffer, 2 μ LdNTP, concentration is forward primer and each 0.5 μ L of reverse primer of 20 μm of ol/L, the Taq DNA polymerase of 0.5 μ L, and all the other are aseptic tri-distilled water;
Wherein, forward primer F:5 '-CCGCAATGGGAAAGCAC-3 ',
Reverse primer R:5 '-TGACGCTGGTAATGTGAAGGA-3 '.
2. construction process according to claim 1, is characterized in that: described goal gene fragment is the SEQIDNo.1 sequence of sequence table.
3. construction process according to claim 1 and 2, is characterized in that: wherein common PCR reaction program: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 10min.
4. a Real-time detection method of abundance for chicken peripheral blood mononuclear lymphocyte PD-L2 gene, is characterized in that: the method comprises the following steps:
(1) the PD-L2 goal gene fragment reclaiming purifying is connected with pMD18-T carrier, is then converted in competent cell DH5 α, extract recombinant plasmid; Sequencing analysis is carried out after colony screening, choose with the positive plasmid of PD-L2 goal gene fragment identical sequence as standard substance plasmid, the DNA concentration of bioassay standard product plasmid, and be converted into the copy concentrations of plasmid, by 1:10 concentration gradient dilution positive plasmid doubly;
Described goal gene fragment is the SEQIDNo.1 sequence of sequence table;
(2) with the positive plasmid diluted for template, carry out real-time fluorescence quantitative PCR amplified reaction, detect fluorescent signal with real-time fluorescence quantitative PCR instrument, after reaction terminates, draw out typical curve, then measure the gene abundance of PD-L2 in sample DNA according to the change of fluorescent signal and typical curve;
Wherein the reaction system of real-time fluorescence quantitative PCR amplification is 20 μ L, and comprise 2 μ L plasmid templates, concentration is forward primer F and each 0.2 μ L, SYBRGreenIPreMix10 μ L, the tri-distilled water 7.6 μ L of reverse primer R of 20 μm of ol/L;
Wherein, forward primer F:5 '-CCGCAATGGGAAAGCAC-3 ',
Reverse primer R:5 '-TGACGCTGGTAATGTGAAGGA-3 ';
Described detection method is not used in the Diagnosis and Treat of disease.
5. Real-time detection method of abundance according to claim 4, is characterized in that: wherein quantitative fluorescent PCR response procedures is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; 60 DEG C of annealing and extension 34s, collect fluorescent signal when 60 DEG C, then 40 circulations.
6. Real-time detection method of abundance according to claim 4, is characterized in that: described real-time fluorescence quantitative PCR instrument is ABI7500Fast type quantitative real time PCR Instrument.
7. the Real-time detection method of abundance according to any one of claim 4-6, is characterized in that: the positive plasmid concentration range of described dilution is 4.95 × 10
10-4.95 × 10
1copies/ μ L; The coefficient R of described typical curve
2=0.995, slope is-3.808.
8. the application in the transcriptional level Changing Pattern of the PD-L2 gene after analyzing chicken infection immunity inhibition disease of the detection method described in any one of claim 4-6; Described application is not used in the Diagnosis and Treat of disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410037328.0A CN103820481B (en) | 2014-01-26 | 2014-01-26 | The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410037328.0A CN103820481B (en) | 2014-01-26 | 2014-01-26 | The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103820481A CN103820481A (en) | 2014-05-28 |
| CN103820481B true CN103820481B (en) | 2016-01-13 |
Family
ID=50755770
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410037328.0A Active CN103820481B (en) | 2014-01-26 | 2014-01-26 | The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103820481B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018170712A1 (en) * | 2017-03-20 | 2018-09-27 | 深圳市博奥康生物科技有限公司 | Method for constructing human programmed death ligand 2 gene high-expression vector and application thereof |
| WO2022089426A1 (en) * | 2020-10-27 | 2022-05-05 | 细胞图谱有限公司 | Method for analyzing peripheral blood sample and kit |
-
2014
- 2014-01-26 CN CN201410037328.0A patent/CN103820481B/en active Active
Non-Patent Citations (5)
| Title |
|---|
| Matsuyama-Kato et al.Molecular characterization of immunoinhibitory factors PD-1/PD-L1 in chickens infected ith Marek’s disease virus.《Virology Journal》.2012,第9卷(第4期),1－12. * |
| XM_424812.4;automated computational analysis;《GENBANK》;20130619;1-2 * |
| Yao, Q.;Fischer, K. P.;Tyrrell, L. 等.IDENTIFICATION OF PROGRAMMED DEATH 1 (PD-1) AND ITS COGNATE LIGANDS (PD-L1, PD-L2) IN THE PEKIN DUCK AND EXPRESSION ANALYSIS IN THE DUCK HEPATITIS B MODEL.《JOURNAL OF HEPATOLOGY 》.2012,第56卷S319. * |
| 彭金美,等.猪PD21 分子及其配体的实时荧光定量RT-PCR检测方法的建立.《中国兽医科学》.2010,第40卷(第4期),410－414. * |
| 猪程序性死亡因子1的克隆鉴定以及猪繁殖与呼吸综合症病毒感染对PD-L1/PD-L通路的影响;彭金美;《中国博士学位论文全文数据库 农业科技辑》;20110115(第1期);19，24－26 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103820481A (en) | 2014-05-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20180355037A1 (en) | Anti-human adrb3 monoclonal antibody and application thereof in disease diagnosis and treatment | |
| Abd-Ellatieff et al. | Molecular characterization and phylogenetic analysis of a virulent Marek’s disease virus field strain in broiler chickens in Japan | |
| CN103966358A (en) | Fluorescent quantitative PCR detection kit for infectious spleen and kidney necrosis virus and Fluorescent quantitative PCR detection method of infectious spleen and kidney necrosis virus | |
| Zaragoza et al. | Persistence of gut mucosal innate immune defenses by enteric α-defensin expression in the simian immunodeficiency virus model of AIDS | |
| RU2422535C1 (en) | METHOD FOR Yersinia pestis Yersinia pseudotuberculosis STRAIN IDENTIFICATION | |
| EP2697248B1 (en) | Genetic variant of cytomegalovirus (cmv) | |
| CN110564880A (en) | Method for detecting live attenuated Brucella vaccine strain and wild strain and application | |
| CN103820481B (en) | The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof | |
| Buscaglia | Mixed infections of Marek's disease and reticuloendotheliosis viruses in layer flocks in Argentina | |
| CN103981288B (en) | A kind of non-diagnosis and treatment object fowl tumprigenicity virus multiple PCR detection method | |
| CN108048603A (en) | A kind of K subgroup avian leucosis virus detection kit | |
| Yu et al. | Human cytomegalovirus in cancer: The mechanism of HCMV-induced carcinogenesis and its therapeutic potential | |
| CN109055564B (en) | CircRNA marker for diagnosis and prognosis evaluation of chronic lymphocytic leukemia | |
| CN103966314B (en) | The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof | |
| CN110885366B (en) | Tumor marker heat shock factor 2binding protein of liver cancer and application thereof | |
| CN103789335B (en) | Construction method of recombinant plasmid of PD-L1 (programmed death-ligand 1) in chicken peripheral blood mononuclear lymphocytes, real-time gene abundance detection method and application of detection method | |
| Neerukonda et al. | A comparison of exosome purification methods using serum of Marek's disease virus (MDV)-vaccinated and-tumor-bearing chickens | |
| JP2019060869A (en) | Factor related to cancer transfer forming ability and prognosis prediction method of cancer patient using the factor | |
| CN109234451A (en) | A kind of Tilapia mossambica parvovirus TiPV CPA detection primer and application | |
| CN105256071A (en) | Method for quickly detecting carp herpes virus type III | |
| CN105543411B (en) | Primer and method for detecting use condition of variable adenylate site of IFFO1 gene mRNA | |
| WO2010053987A2 (en) | Monoclonal antibody production in b cells and uses therof | |
| RU2607025C1 (en) | Synthetic oligonucleotide primers and method for detecting rna atypical pestivirus of cattle | |
| CN103789432A (en) | Construction method of recombinant plasmid of PD-1 (programmed death-1) in chicken peripheral blood mononuclear lymphocytes, real-time gene abundance detection method and application of detection method | |
| CN103966313A (en) | Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |