CN103966313A - Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method - Google Patents
Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method Download PDFInfo
- Publication number
- CN103966313A CN103966313A CN201410102234.7A CN201410102234A CN103966313A CN 103966313 A CN103966313 A CN 103966313A CN 201410102234 A CN201410102234 A CN 201410102234A CN 103966313 A CN103966313 A CN 103966313A
- Authority
- CN
- China
- Prior art keywords
- real
- plasmid
- pig
- pcr
- goal gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention belongs to the technical field of molecular pathology and immunology, and relates to construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, a real-time gene abundance detection method and an application of the method. TotalRNA of pig peripheral bloodmononuclear lymphocytes is collected and reverselytranscribed into cDNA (complementary DNA); PD-L1 target gene fragments are amplified through a general PCR (polymerase chain reaction), detected throughagarose gel electrophoresis, recovered and purified; the PD-L1 targetgene fragments are connected with pMD18-T carriers and converted into competent cells DH5alpha, and the recombinantplasmids are extracted; sequencing analysis is performed after cloning and screening, positive plasmids with the same sequence as the target gene fragments are selected to serve as standard plasmids, and a standard curve is drawn according to the copy concentration; thePD-L1 gene abundance is measured according to fluorescence signal changes and the standard curve. The real-time pig PD-L1 gene abundancedetection method has the advantages of high detection throughput, high susceptibility, high specificity, convenience inoperation, low cost, accuracy inquantification and the like.
Description
Technical field
The invention belongs to molecular pathology and immunological technique field, be specifically related to structure, gene abundance real-time detection method and the application thereof of pig peripheral blood monokaryon lymphocyte PD-L1 recombinant plasmid.
Background technology
Swine fever (Classical swine fever, CSF) is that the one being caused by Pestivirus suis (Classical swine fever virus, CSFV) is acute, hot, height contagious disease.Research shows, CSFV main infection monocytes/macrophages system, causes serious lymphopenia, platelet aggregation and coagulation function obstacle, and the atrophy of the central immune organ such as thymus gland, marrow.CSFV can also be by causing that the reaction of body disease-resistant poison reduces, suppresses the approach such as the apoptosis of the apoptosis of cells infected, promotion non-infected cells and causes body's immunity damage.
Programmed death part (PD-L1) and programmed death acceptor-1 (PD-1) thereof are CD28/B7 superfamily members, and wide expression is in various tissues.It is different and activate or suppress that PD-1/PD-L costimulatory signal is looked degree of inflammation, immunological status and the genetic background of body, mainly participates in maincenter and the peripheral immune tolerance of T cell.Compared with other CD28 superfamily members, PD-1/PD-L signal path is being brought into play more extensive and complicated immunoregulation effect, closely related with autoimmune disease, tumour, chronic infection and inflammation.Aspect immunomodulatory, PD-L1 and its acceptor PD-1 mediate the activation of PD-1:PD-L signal path jointly, premunition tolerance and immunosuppression signal in maincenter immunity and periphery immune response, secretion and the kill capability of the function to antigen specific T, B cell, the propagation of T cell, cytokine have restraining effect, block the most of function that can recover T cell after this path.Confirm through correlative study, the infection of some viruses can be induced the expression of PD-L1 and acceptor PD-1 thereof, thereby affects PD-1:PD-Ls path, makes the supervision of viral escape from immune system and kills and wounds, and causes that body produces immunosuppression and persistent infection.Therefore, PD-L1 and acceptor PD-1 thereof become the focus that people pay close attention in the immunosuppressive disease researchs such as chronic sustained infections, immunotolerance disease, tumour in recent years gradually, and aspect animal immune inhibition disease or viral persistent infection, the research of T Cellular immunity suppression path PD-1:PD-Ls is just at the early-stage, particularly also rare report of the research aspect porcine viral diseases.
In recent years, real-time fluorescence quantitative PCR (Real-Time PCR) technology provides brand-new method for gene abundance detects, compare with traditional method, have that susceptibility is high, high specificity, easy and simple to handle, cost is low and be quantitatively accurately widely used, it can reach by detecting the fluorescence signal intensity of target sequence pcr amplification the object of real-time monitoring.But the Real-Time PCR detection system of abundance to PD-L1 gene in pig peripheral blood monocyte is set up and the research of application there is not yet report.
Summary of the invention
The technical problem to be solved in the present invention is: the construction process that the invention provides a kind of pig peripheral blood monokaryon lymphocyte PD-L1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid;
The present invention has set up a kind of real-time fluorescence quantitative PCR detection method of PD-L1 gene abundance on this basis, and the method has the advantages such as susceptibility is high, high specificity;
The present invention is by the Changing Pattern of PD-L1 in research peripheral blood lymphocytes, for the quantitative analysis of pig PD-L1 Molecular Detection provides technology platform, and can be used for analyzing pig infect virus disease as CSF after the Changing Pattern of transcriptional level of PD-L1 gene.
technical scheme of the present invention:
The construction process of pig peripheral blood monokaryon lymphocyte PD-L1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid, comprises the following steps:
Gather the peripheral blood of piglet, isolate peripheral blood mononuclear lymphocyte, extract the lymphocytic total RNA of peripheral blood mononuclear, total RNA reverse transcription is become to cDNA, cDNA is stored in to-20 DEG C, adopt regular-PCR method amplification PD-L1 goal gene fragment;
Adopt regular-PCR method amplification PD-L1 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaim purifying; Then PD-L1 goal gene purifying fragment is connected with pMD 18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Reaction system when wherein regular-PCR increases is 25 μ L, reaction system is as follows: 2 μ L sample cDNA templates, 2.5 μ L 10 × PCR Buffer, 2 μ L dNTP, concentration is forward primer and the each 0.5 μ L of reverse primer of 20 μ mol/L, the TaqDNA polysaccharase of 0.5 μ L, all the other are aseptic tri-distilled water; Common PCR reaction program: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C are extended 30s, 30 circulations, and last 72 DEG C are extended 10min;
Wherein, forward primer F is: 5 '-AATGGCGAGGAAGACCTGAA-3 ',
Reverse primer R is: 5 '-CAGCAGTAAACCCCTGCATCT-3 '.
Described goal gene fragment is SEQ ID No.1; Response procedures when described regular-PCR amplification: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C are extended 30s, 30 circulations, and last 72 DEG C are extended 10min.
An abundance real-time detection method for pig peripheral blood monokaryon lymphocyte PD-L1 gene, comprises the following steps:
(1) the PD-L1 goal gene fragment that reclaims purifying is connected with pMD 18-T carrier, is then converted in competent cell DH5 α, extract recombinant plasmid; After colony screening, carry out sequencing analysis, choose with the positive plasmid of PD-L1 goal gene fragment identical sequence as standard substance plasmid, the DNA concentration of bioassay standard product plasmid, and be converted into the copy concentrations of plasmid, by 1:10 concentration gradient dilution positive plasmid doubly;
(2) taking the positive plasmid that dilutes as template, carry out real-time fluorescence quantitative PCR amplified reaction, detect fluorescent signal with real-time fluorescence quantitative PCR instrument, reaction is drawn out typical curve after finishing, and then measures the gene abundance of PD-L1 in sample DNA according to the variation of fluorescent signal and typical curve;
Wherein the reaction system of real-time fluorescence quantitative PCR amplification is 20 μ L, comprises 2 μ L plasmid templates, and concentration is forward primer F and the each 0.2 μ L of reverse primer R of 20 μ mol/L, SYBR Green I PreMix 10 μ L, tri-distilled water 7.6 μ L;
Wherein, forward primer F is: 5 '-AATGGCGAGGAAGACCTGAA-3 ',
Reverse primer R is: 5 '-CAGCAGTAAACCCCTGCATCT-3 '.
Described goal gene fragment is SEQ ID No.1.
The response procedures of described fluorescent quantitative PCR is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; Anneal and extend 34s for 60 DEG C, 60 DEG C time, collecting fluorescent signal, then 40 circulations.
The positive plasmid concentration range of described dilution is that concentration range is 9.66 × 10
10-9.66 × 10
1copies/ μ L; Described typical curve is Y=-3.266X+22.794.
The application of described detection method in the transcriptional level Changing Pattern of analyzing PD-L1 gene after pig infection virus disease.
positive beneficial effect of the present invention:
The present invention is by synthetic forward primer, reverse primer and PD-L1 goal gene fragment, set up the method for the real-time fluorescence quantitative PCR of PD-L1 gene abundance in pig peripheral blood monocyte, for better the transcriptional level of PD-L1 in porcine viral diseases being carried out to accurate quantitative analysis, and then the Changing Pattern of PD-L1 in research peripheral blood lymphocytes, for the quantitative analysis of pig PD-L1 Molecular Detection provides technology platform, and biological function and the application system thereof in porcine viral diseases, brought into play for PD-L1 lay the foundation.
Technical scheme of the present invention is compared with conventional art, and susceptibility is higher, utilizes the method for setting up to 10
9～10
19 groups of different concns standard positive plasmids of copies/ μ L detect, and result shows: in the present invention, under the detection of PD-L1, be limited to 10 copies/ μ L, its concentration and C
tbetween value, there is good linear relationship, coefficient R
2=0.998; Utilize the method for setting up to carry out replica test, organize replica test result between interior and group and show, the variation coefficient all, in 3%, has good repeatability; From solubility curve figure, there is single narrow peak (Fig. 4) in PD-L1 molecular melting curve, and agarose gel electrophoresis analysis shows, Real-time RT-PCR amplification is single specificity object fragment (Fig. 5), illustrates that the present invention has good specificity; The technical program also has that the flux of detection is high, easy and simple to handle, cost is low in addition and the feature such as quantitatively accurate.
The present invention confirms by experiment, and pig infects after CSFV, and the expression amount that copies PD-L1 along with virus in body raises gradually, illustrates that the infection of CSFV and the variation relation of virus load and pig PD-L1 gene abundance are very close; And confirm that pig infects between the expression variation that PD-L1 after CSFV expresses variation and IL-2 and IL-10 cytokine and had certain relation, pig PD-L1 has activated PD-L1:PD-Ls signal path after expressing and raising, cause pig T cellular immune function decreased, caused infected pigs's Immune Dysfunction.
Pig PD-L1 gene real-time fluorescence quantitative PCR detection method of the present invention, for detecting porcine viral diseases as CSF(swine fever) the expression Changing Pattern of PD-L1 provides technology platform in the damnification of immunity function that caused, thus further enrich swine fever and caused the mechanism of damnification of immunity function.
Brief description of the drawings
Fig. 1 is that sepharose detects pig PD-L1 gene amplification result;
Fig. 2 is pig PD-L1 Real time PCR amplification curve;
Fig. 3 is pig PD-L1 Real time PCR typical curve;
Fig. 4 is pig PD-L1 Real time PCR standard substance solubility curves;
Fig. 5 is pig PD-L1 real time fluorescent quantitative product specificity analyses result;
Fig. 6 is the copy number that pig infects PD-L1 gene in CSFV different times peripheral blood lymphocytes;
Fig. 7 is that pig infects CSFV virus load detected result in CSFV different times blood plasma;
Fig. 8 is the copy number that pig infects CSFV different times IL-2 gene;
Fig. 9 is the copy number that pig infects CSFV different times IL-10 gene.
Embodiment
In the present invention, the concept of gene copy number, gene abundance TYP; Real-time PCR, real-time fluorescence quantitative PCR represent same concept; ddH
2o represents distilled water; CSF represents swine fever; CSFV represents Pestivirus suis, and carbox fluorescenceindiacetate succinimidyl ester (carboxyfluorescein succinimidyl amino ester, CFSE) is a kind of fluorescence dye that can mark active somatic cell.
Laboratory animal in embodiment and bacterial classification: 30 age in days sodium selenites, in shield retaining, raise; Strain Shimen CSFV is provided by Chinese veterinary medicament inspection, and median infective dose is 10
5× TCID
50; Competent escherichia coli cell DH5 α, for preserving in this laboratory.
Main agents and instrument: lymphocyte separation medium, purchased from Tianjin Hao sun biological products Science and Technology Ltd.; PCR product purification reclaims test kit, purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; Taq archaeal dna polymerase, reverse transcription test kit, pMD 18-T carrier, all purchased from Dalian precious biotechnology company limited; SYBR Green I, purchased from Invitrogen company.
embodiment 1the structure of pig PD-L1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid
Gather the peripheral blood of 45 age in days piglets, separate the lymphocyte of peripheral blood with reference to the specification sheets of lymphocyte separation medium, carry out the extraction of total RNA with reference to Invitrogen company's T RIzol test kit specification sheets and pertinent literature.Extract total RNA with reference to reverse transcription test kit specification sheets, reverse transcription becomes cDNA, be stored in-20 DEG C for subsequent use, for the template of the PD-L1 goal gene fragment that increases.
Adopt regular-PCR method amplification PD-L1 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaim purifying; Then PD-L1 goal gene purifying fragment is connected with pMD 18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Described goal gene fragment is sequence SEQ ID No.1:
AATGGCGAGGAAGACCTGAATGTTCAGCACAGTAGCTACAGCCAGAGGGCCCAGCTGTTGAAGGACCAGCTCTTCTTGGGAAAGGCCTCACTTCAGATCACAGATGTGAAATTGCAAGATGCAGGGGTTTACTGCTG。
In order to build the common PCR reaction system of PD-L1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid:
Common PCR reaction system is 25 μ L, reaction system is as follows: 2 μ L sample DNA templates, negative control is taking aseptic tri-distilled water as template, 2.5 μ L 10 × PCR Buffer, 2 μ L dNTP, the each 0.5 μ L(20 μ mol/L of forward and reverse primer), 0.5 μ L TaqDNA polysaccharase (Dalian Bao Bio-Engineering Company), all the other volumes are supplied with aseptic tri-distilled water; Reaction system is softly mixed, carry out amplified reaction in regular-PCR instrument.
Regular-PCR program is: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C are extended 30s, 30 circulations, and last 72 DEG C are extended 10min.
Wherein pig PD-L1 real-time fluorescence quantitative PCR primer is synthesized by certain biotech firm, and primer sequence is as follows:
Forward primer F is: 5 '-AATGGCGAGGAAGACCTGAA-3 ',
Reverse primer R is: 5 '-CAGCAGTAAACCCCTGCATCT-3 '.
Regular-PCR product is carried out to 2% agarose electrophoretic analysis, and voltage 100V observes product after 35min under ultraviolet lamp, and result demonstration amplifies single band, and clip size is in 137bp left and right.
Amplification is shown in accompanying drawing 1, and in figure, M is DL2000 molecular weight standard, and 1 is the amplified production of PD-L1 gene, and amplified band is more clear, affects without primer dimer.Extension increasing sequence is after clone, order-checking, in GenBank, carry out the comparison of nucleic acid homology, result shows, in the sequence SEQ ID No.1 obtaining and GenBank, the sequence homology of pig PD-L1 gene (NM_001025221.1) is 100%, illustrate that primer and amplified production are all correct, can be used for next step experimental study.Specific fragment is carried out, after sepharose recovery, cloning conversion, transfer to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to carry out sequencing analysis the positive colony of acquisition.
embodiment 2:the foundation of pig PD-L1 real-time fluorescence quantitative PCR system
(1) preparation of plasmid DNA template
Adopt regular-PCR amplification method amplification PD-L1 goal gene fragment, goal gene fragment is detected and reclaims purifying through 2% agarose gel electrophoresis, after connecting with pMD 18-T carrier (TaKaRa, Dalian), be converted in competent cell DH5 α, extract recombinant plasmid; After colony screening, carry out sequencing analysis, in sequencing result demonstration and GenBank, sequence 100% homology of pig PD-L1 gene, illustrates that obtained sequence is correct, and positive plasmid can be used for the making of plasmid standard.Using this standard substance plasmid of trace dna albumen spectrophotometric determination DNA concentration is 300 μ g/mL, and primary standard product plasmid solution is carried out to 1:10 doubling dilution doubly.
(2) making of the calculating of standard plasmid concentration and PD-L1 typical curve
Extract the positive colony plasmid through sequence verification, the DNA concentration conversion of plasmid is become to copy number.The method of calculation of plasmid copy number are: copy number (copies/ μ L)=concentration (μ g/ μ L) × 6.02 × 10
23(copies/ μ L)/MW(g/mol).
Wherein MW=(cloning vector length+object fragment length) (bp)) × 660 g/mol/ bp.
Known: cDNA=300 μ g/mL, plasmid PMD18-T sequence length is 2692bp, PD-L1 gene Insert Fragment length is 137bp; The average molar mass of single base is 660 g/mol, and calculation formula is:
Molecular weight (MW)=(2692+137) × 660=1.87 × 10
6g/mol.
Plasmid copy concentrations: 6.02 × 10
23× (300 × 10
-9) ÷ (1.87 × 10
6)=9.66 × 10
10copies/ μ L.
Using the plasmid solution of above-mentioned known copy concentration as standard plasmid, in the time carrying out Real-time PCR Specification Curve of Increasing, by 10 times of gradient dilutions, (concentration range is 9.66 × 10
10-9.66 × 10
1copies/ μ L).
The plasmid of known copy number is carried out to 1:10 times of gradient dilution, obtain plasmid standard.
Taking the plasmid that diluted as template, carry out real-time fluorescence quantitative PCR amplified reaction, reaction adopts Real-time PCR test kit SYBR PremixExTaqTM(Invitrogen company), reaction system is 20 μ L:2 μ L standard plasmid templates, F, the each 0.2 μ L of R primer (20 μ mol/L), SYBR Green I PreMix 10 μ L, tri-distilled water 7.6 μ L.(template is 2 μ LddH in each Real-time PCR reaction, negative control to be all set
2o), Real-time PCR program is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; Anneal and extend 34s, 60 DEG C time, collecting fluorescent signal, 40 circulations for 60 DEG C.F, R primer are wherein identical with embodiment 1.
Typical curve and all testing samples all arrange 3 parallel reactors.Reaction is carried out in ABI 7500 quantitative PCR instrument (U.S. Life Technologies), utilizes ABI 7500 software detection and collects fluorescent signal, goes forward side by side line number according to one's analysis.
ABI 7500 software Real time PCR softwares are drawn out the amplification curve (seeing accompanying drawing 2) of reaction voluntarily.Amplification curve shows that 6 curves represent standard substance 10 successively from left to right
7, 10
6, 10
5, 10
4, 10
3, 10
2the amplification curve of gradient dilution liquid, 6 plasmid standard amplification curves are more smooth, present typical S type, and each cycle threshold (Ct value) interval is even.
The cycle threshold (Ct value) of the each concentration gradient of standard substance providing according to amplification curve and reaction, ABI 7500 softwares are drawn out the typical curve (seeing accompanying drawing 3) of reaction voluntarily.The coefficient R of this typical curve
2=0.998, slope is-3.266, and typical curve is Y=-3.266X+22.794, and wherein Y is the Ct value of real-time fluorescence quantitative PCR reaction, and X is the gene constructed standard plasmid copy number logarithmic value of PD-L1.Calculate its amplification efficiency Eff%=102.392%, meet the requirement of ABI 7500 quantitative fluorescence analysis to typical curve.
The solvent temperature of the standard substance of measuring each concentration dilution gradient in real-time fluorescence quantitative PCR process, and draw solubility curve (seeing accompanying drawing 4).The solubility curve type peak of standard substance and sample is single, and standard substance solvent temperature identical (83.5 ± 0.5 DEG C), shows amplified reaction product solvent temperature homogeneous, and specificity is good, and without primer dimer.
Can measure the gene abundance of PD-L1 in sample DNA according to the variation of fluorescent signal and typical curve.
embodiment 3: susceptibility, specificity and the repeatability of pig PD-L1 real-time fluorescence quantitative PCR system are analyzed
Adopt the constructed pig PD-L1 recombinant plasmid of embodiment 1 as the positive standard plasmid of recombinating; The pig PD-L1 real-time fluorescence quantitative PCR detection system that adopts embodiment 2 to set up; ABI 7500 quantitative real time PCR Instruments that real-time fluorescence quantitative PCR instrument adopts Life Technologies company (U.S.) to produce carry out.
With 10 of 10 times of serial dilutions
1～10
9the positive restructuring of copies/ μ L pig PD-L1 standard plasmid does sensitivity test, and result shows, is limited to 10 copies/ μ L under the detection of PD-L1.
Pig PD-L1 molecule Real-time-PCR solubility curve (seeing accompanying drawing 4) and product agarose gel electrophoresis are done to specificity analyses, result shows, there is single narrow peak in solubility curve, can increase and the specific fragment of expecting that object fragment is onesize, not generate non-specific product and primer dimer (seeing accompanying drawing 5).
In criticize respectively by the method for setting up and batch between repeatability detect, result shows, in batch and batch between the variation coefficient be less than 3%, well (in table 1) of repeatability.
Table 1 pig PD-L1 real time fluorescence quantifying PCR method criticize in criticize between reproducibility result
embodiment 4: the real time fluorescence quantifying PCR method that utilizes the present invention to set up, analyze pig and infect the Changing Pattern of PD-L1 gene abundance in rear peripheral blood mononuclear lymphocyte in virus disease.
The pig PD-L1 real-time fluorescence quantitative PCR system that adopts embodiment 2 to set up; ABI 7500 quantitative real time PCR Instruments that real-time fluorescence quantitative PCR instrument adopts Life Technologies company (U.S.) to produce.
The sodium selenite of 15 30 ages in days is raised to 45 ages in days, with the detection of IDEXX antibody against swine fever virus detection kit, determine that CSFV antibody is negative, be divided at random control group (5) and experimental group (10).Experimental group and control group isolated rearing, wherein experimental group is injected CSFV diluent 0.1 mL/ head by musculi colli; Control group is made same treatment with sterilizing PBS.
Infect the 0th after 45 age in days piglets respectively at CSFV, 3, 7, 10, within 14 and 21 days, adopt peripheric venous blood, and taking the same age in days piglet that do not infect CSFV as contrast, separate infected group and control group peripheral blood mononuclear lymphocyte simultaneously, and extract total RNA, utilize the synthetic cDNA of reverse transcription test kit (Dalian is precious biological) reverse transcription, the Auele Specific Primer that utilizes embodiment 1 to provide, the real-time fluorescence quantitative PCR system that adopts embodiment 2 to set up detects, calculate and can obtain PD-L1 gene copy number in infected group and control group peripheral blood mononuclear lymphocyte (being gene abundance) according to typical curve, see accompanying drawing 6.
Result shows, compared with not infecting CSFV sodium selenite, at the metainfective different times of CSFV, because the immunological status difference of body, the abundance difference of each phase PD-L1 gene, after infection, significantly (P < 0.05) rising compared with control group in 3rd ~ 10 days, wherein raises significantly (P < 0.05) on the 3rd day; Within the 7th day, continue to raise, compared with control group extremely significantly (P < 0.01), within the 10th day, start to decline, but compared with control group still significantly (P < 0.05), continue afterwards to reduce, and there is no statistical significance.As can be seen here, the abundance of pig PD-L1 gene and the swine fever course of disease have larger associated.
embodiment 5:after Pestivirus suis (CSFV) infected pigs, PD-L1 expresses the relation between virus load in variation and blood plasma
CSFV carrying capacity real-time fluorescence quantitative PCR primer and probe are synthesized by certain biotech firm, and primer and probe sequence are as follows:
Forward primer F:5 '-CCCTGAAGTGGATTAGAA-3 ',
Reverse primer R:5 '-TACCCTTGTTGATCCTATC-3 ',
TaqMan probe: 5’-(FAM) TTCACCGACTGTCCATTGTGG (Eclipse)-3’
Infect the peripheral blood of taking for the 0th, 3,7,10,14 and 21 days after 45 age in days piglets respectively at CSFV, extract the total RNA of CSFV in peripheral blood, utilize the synthetic cDNA of reverse transcription test kit (Dalian is precious biological) reverse transcription.Reverse transcription reaction system is: 2 μ L 5 × PrimeScript Buffer, 0.5 μ L PrimeScript RT Enzyme Mix I, 0.5 μ L Oligo dT primer, 0.5 μ L Random 6 mers, the total RNA of 1 μ g and RNase Free dH2O.Reverse transcription reaction condition is: 37 DEG C reaction 15 minutes, 85 DEG C 5 seconds, synthetic cDNA is placed in-20 DEG C and saves backup.Real-time fluorescence quantitative PCR detects the carrying capacity of CSFV, reagent is premix Ex Taq (probe qPCR) (Dalian is precious biological), carry out at ABI 7500 instruments, real-time fluorescence quantitative PCR reaction system is 20 μ L systems: 10 μ L Premix Ex Taq, 0.4 μ L CSFV forward primer (10 μ mol/L), 0.4 μ L reverse primer (10 μ mol/L), 0.8 μ L TaqMan probe (10 μ mol/L), 0.4 μ L ROX Preference Dye, 2 μ L template DNAs and 6 μ L tri-distilled waters.Reaction system is: 95 DEG C of warm starts 10 seconds, 45 circulations: 95 DEG C of sex change 15 seconds, 56 DEG C of annealing and extending 45 seconds.Calculate the carrying capacity of CSFV in blood plasma according to typical curve.
Result shows, infects latter the 3rd day virus load start to raise at CSFV, within the 7th day, reaches peak value, reduces gradually afterwards (seeing accompanying drawing 7).
4 results can be found out in conjunction with the embodiments, and along with virus copying in body, the expression amount of PD-L1 raises gradually, illustrate that the infection of CSFV and the variation relation of virus load and pig PD-L1 gene abundance are very close.
embodiment 6:relation after pig CSFV infects between PD-L1 expression variation and IL-2, the variation of IL-10 cytokine-expressing
The pig PD-L1 real-time fluorescence quantitative PCR system that adopts embodiment 2 to set up, the peripheral blood that adopts the CSFV of embodiment 4 to infect after 45 age in days piglets the 0th, 3,7,10,14 and 21 days, taking the product of the lymphocytic total RNA reverse transcription cDNA of its peripheral blood mononuclear as template, after CSFV is infected, the expression of porcine cytokine IL-2, the IL-10 of 0th, 3,7,10,14 and 21 days changes and detects.
ABI 7500 quantitative real time PCR Instruments that real-time fluorescence quantitative PCR instrument adopts Life Technologies company (U.S.) to produce carry out.
Result shows, IL-2 mrna expression level infects the 7th day expression level at CSFV and reduces (P<0.05), in the time that PD-L1 expression is increased (the 7th day), IL-10 expression level raises and significantly (P<0.01) of change very, sees accompanying drawing 8.
After CSFV infects, PD-L1 expression amount raises, and activates PD-L1:PD-Ls signal path, and the reduction (the 7th day) that causes IL-2 to express, is shown in accompanying drawing 9.In this simultaneously, the expression amount of IL-10 raises (the 7th day), illustrates that the expression of IL-10 has affected the expression of PD-L1 after CSFV infects.And IL-10 is a kind of inhibitive ability of immunity cytokine, so after CSFV infection, the rising that pig PD-L1 expresses, has activated PD-1:PD-Ls signal path, and the reduction of IL-2 and the rising of IL-10, makes body be in immunosuppressant state.
SEQUENCE LISTING
<110> Xinxiang University
The structure of <120> pig peripheral blood monokaryon lymphocyte PD-L1 recombinant plasmid, gene abundance real-time detection method and
Application
<130> molecular pathology and immunology research
<160> 6
<170> PatentIn version 3.4
<210> 1
<211> 137
<212> DNA
<213> artificial sequence
<400> 1
aatggcgagg aagacctgaa tgttcagcac agtagctaca gccagagggc ccagctgttg 60
aaggaccagc tcttcttggg aaaggcctca cttcagatca cagatgtgaa attgcaagat 120
gcaggggttt actgctg 137
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
<400> 2
aatggcgagg aagacctgaa 20
<210> 3
<211> 21
<212> DNA
<213> artificial sequence
<400> 3
cagcagtaaa cccctgcatc t 21
<210> 4
<211> 18
<212> DNA
<213> artificial sequence
<400> 4
ccctgaagtg gattagaa 18
<210> 5
<211> 19
<212> DNA
<213> artificial sequence
<400> 5
tacccttgtt gatcctatc 19
<210> 6
<211> 21
<212> DNA
<213> artificial sequence
<400> 6
ttcaccgact gtccattgtg g 21
Claims (8)
1. the construction process of pig peripheral blood monokaryon lymphocyte PD-L1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid, is characterized in that: the method comprises the following steps:
Gather the peripheral blood of piglet, isolate peripheral blood mononuclear lymphocyte, extract the lymphocytic total RNA of peripheral blood mononuclear, total RNA reverse transcription is become to cDNA, cDNA is stored in to-20 DEG C, adopt regular-PCR method amplification PD-L1 goal gene fragment;
Adopt regular-PCR method amplification PD-L1 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaim purifying; Then PD-L1 goal gene purifying fragment is connected with pMD 18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Reaction system when wherein regular-PCR increases is 25 μ L, reaction system is as follows: 2 μ L sample cDNA templates, 2.5 μ L 10 × PCR Buffer, 2 μ L dNTP, concentration is forward primer and the each 0.5 μ L of reverse primer of 20 μ mol/L, the TaqDNA polysaccharase of 0.5 μ L, all the other are aseptic tri-distilled water; Common PCR reaction program: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C are extended 30s, 30 circulations, and last 72 DEG C are extended 10min;
Wherein, forward primer F is: 5 '-AATGGCGAGGAAGACCTGAA-3 ',
Reverse primer R is: 5 '-CAGCAGTAAACCCCTGCATCT-3 '.
2. construction process according to claim 1, is characterized in that: described goal gene fragment is SEQ ID No.1.
3. construction process according to claim 1 and 2, is characterized in that: response procedures when described regular-PCR amplification: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C are extended 30s, 30 circulations, and last 72 DEG C are extended 10min.
4. an abundance real-time detection method for pig peripheral blood monokaryon lymphocyte PD-L1 gene, is characterized in that: the method comprises the following steps:
(1) the PD-L1 goal gene fragment that reclaims purifying is connected with pMD 18-T carrier, is then converted in competent cell DH5 α, extract recombinant plasmid; After colony screening, carry out sequencing analysis, choose with the positive plasmid of PD-L1 goal gene fragment identical sequence as standard substance plasmid, the DNA concentration of bioassay standard product plasmid, and be converted into the copy concentrations of plasmid, by 1:10 concentration gradient dilution positive plasmid doubly;
(2) taking the positive plasmid that dilutes as template, carry out real-time fluorescence quantitative PCR amplified reaction, detect fluorescent signal with real-time fluorescence quantitative PCR instrument, reaction is drawn out typical curve after finishing, and then measures the gene abundance of PD-L1 in sample DNA according to the variation of fluorescent signal and typical curve;
Wherein the reaction system of real-time fluorescence quantitative PCR amplification is 20 μ L, comprises 2 μ L plasmid templates, and concentration is forward primer F and the each 0.2 μ L of reverse primer R of 20 μ mol/L, SYBR Green I PreMix 10 μ L, tri-distilled water 7.6 μ L;
Wherein, forward primer F is: 5 '-AATGGCGAGGAAGACCTGAA-3 ',
Reverse primer R is: 5 '-CAGCAGTAAACCCCTGCATCT-3 '.
5. abundance real-time detection method according to claim 4, is characterized in that: described goal gene fragment is SEQ ID No.1.
6. abundance real-time detection method according to claim 4, is characterized in that: the response procedures of described fluorescent quantitative PCR is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; Anneal and extend 34s for 60 DEG C, 60 DEG C time, collecting fluorescent signal, then 40 circulations.
7. according to the abundance real-time detection method described in claim 4-6 any one, it is characterized in that: the positive plasmid concentration range of described dilution is that concentration range is 9.66 × 10
10-9.66 × 10
1copies/ μ L; Described typical curve is Y=-3.266X+22.794.
8. the application of the detection method described in claim 4-7 any one in the transcriptional level Changing Pattern of analyzing PD-L1 gene after pig infection virus disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410102234.7A CN103966313B (en) | 2014-03-19 | 2014-03-19 | Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410102234.7A CN103966313B (en) | 2014-03-19 | 2014-03-19 | Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103966313A true CN103966313A (en) | 2014-08-06 |
| CN103966313B CN103966313B (en) | 2017-01-11 |
Family
ID=51236315
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410102234.7A Active CN103966313B (en) | 2014-03-19 | 2014-03-19 | Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966313B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108085373A (en) * | 2018-01-04 | 2018-05-29 | 裴兵 | A kind of kit for detecting PDL-1mRNA gene expression amounts and its application |
| CN110229917A (en) * | 2019-06-18 | 2019-09-13 | 广东省生态环境技术研究所 | A kind of PCR primer and method detecting the oxidoreductase gene species composition of environmental microorganism arsenic |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1880446A (en) * | 2005-06-16 | 2006-12-20 | VIRxSYS公司 | Antibody complexes |
| WO2006138670A2 (en) * | 2005-06-16 | 2006-12-28 | Virxsys Corporation | Antibody complexes |
-
2014
- 2014-03-19 CN CN201410102234.7A patent/CN103966313B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1880446A (en) * | 2005-06-16 | 2006-12-20 | VIRxSYS公司 | Antibody complexes |
| WO2006138670A2 (en) * | 2005-06-16 | 2006-12-28 | Virxsys Corporation | Antibody complexes |
Non-Patent Citations (2)
| Title |
|---|
| 彭金美 等: "猪PD-1 分子及其配体的实时荧光定量RT-PCR检测方法的建立", 《中国兽医科学》 * |
| 彭金美: "猪程序性死亡因子1的克隆鉴定以及猪繁殖与呼吸综合症病毒感染对PD-L1/PD-L通路的影响", 《中国博士学位论文全文数据库 农业科技辑》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108085373A (en) * | 2018-01-04 | 2018-05-29 | 裴兵 | A kind of kit for detecting PDL-1mRNA gene expression amounts and its application |
| CN110229917A (en) * | 2019-06-18 | 2019-09-13 | 广东省生态环境技术研究所 | A kind of PCR primer and method detecting the oxidoreductase gene species composition of environmental microorganism arsenic |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103966313B (en) | 2017-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rakus et al. | Gene expression analysis of common carp (Cyprinus carpio L.) lines during Cyprinid herpesvirus 3 infection yields insights into differential immune responses | |
| CN108676920B (en) | Primer and kit for rapidly detecting mouse norovirus and RT-RPA method thereof | |
| TW201022492A (en) | Blood transcriptional signature of mycobacterium tuberculosis infection | |
| Prescott et al. | Rapid detection of Cyprinid herpesvirus 3 in latently infected koi by recombinase polymerase amplification | |
| CN102181581A (en) | Ternary PCR (polymerase chain reaction) kit for canine distemper virus, enteritis parvovirus and Aleutian disease virus | |
| CN102140551B (en) | General real-time fluorescent RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) method and kit for detecting porcine reproductive and respiratory syndrome virus | |
| EP3436606B1 (en) | Plasma derived cell-free mitochondrial deoxyribonucleic acid | |
| Li et al. | Global transcriptional profiles in peripheral blood mononuclear cell during classical swine fever virus infection | |
| CN104032038A (en) | Detection kit and detection method for siniperca chuatsi rhabdoviruses | |
| CN1710101A (en) | Fluorescent quantitative DCR kit for detecting swine pseudo rabies virus and its use | |
| CN103966314B (en) | The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof | |
| Cong et al. | Development of a real-time reverse transcription recombinase polymerase amplification assay for rapid detection of spring viremia of carp virus | |
| Waugh et al. | Characterization of the chemokine response of RAW264. 7 cells to infection by murine norovirus | |
| Zhou et al. | Immune and cytokine/chemokine responses of PBMCs in rotavirus‐infected rhesus infants and their significance in viral pathogenesis | |
| Fletcher et al. | Transcriptional profiling of mycobacterial antigen-induced responses in infants vaccinated with BCG at birth | |
| CN103966313A (en) | Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method | |
| CN111154915A (en) | PCR differential diagnosis kit for porcine circovirus type 4 and type 3 and detection method thereof | |
| CN108998576B (en) | Specific primer pair, probe and detection kit for detecting spring carp virus | |
| CN103789335B (en) | Construction method of recombinant plasmid of PD-L1 (programmed death-ligand 1) in chicken peripheral blood mononuclear lymphocytes, real-time gene abundance detection method and application of detection method | |
| CN103820481B (en) | The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof | |
| CN103966312A (en) | Construction of pig peripheral bloodmononuclear lymphocytePD-L2 (programmed death-ligand 2) recombinantplasmids, real-time gene abundance detection method and application of method | |
| CN109913583A (en) | A kind of primer and its method of quick detection Koi herpesvirus | |
| CN112941240B (en) | Primer pair, kit and method for detecting goose astrovirus and goose goblet virus | |
| CN102827951A (en) | Qualitative and quantitative detection method of gene C-type duck hepatitis A virus | |
| CN107988429B (en) | Reagent for detecting rabies virus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |