CN103966314B - The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof - Google Patents
The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof Download PDFInfo
- Publication number
- CN103966314B CN103966314B CN201410102841.3A CN201410102841A CN103966314B CN 103966314 B CN103966314 B CN 103966314B CN 201410102841 A CN201410102841 A CN 201410102841A CN 103966314 B CN103966314 B CN 103966314B
- Authority
- CN
- China
- Prior art keywords
- pig
- peripheral blood
- real
- goal gene
- gene fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Abstract
The invention belongs to molecular pathology and immunological technique field, relate to the structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof.By gathering the lymphocytic total serum IgE of pig peripheral blood monokaryon, total serum IgE reverse transcription is become cDNA; Adopt regular-PCR amplification PD-1 goal gene fragment, detect through agarose gel electrophoresis, and reclaim purifying; By PD-1 goal gene fragment and pMD? 18-T carrier connects, and is converted in competent cell DH5 α, extracts recombinant plasmid; After colony screening, carry out sequencing analysis, to choose with the positive plasmid of goal gene fragment identical sequence as standard substance plasmid, be depicted as typical curve by copy concentrations; The gene abundance of PD-1 is measured according to fluorescent signal change and typical curve.Pig PD-1 gene abundance real-time detection method of the present invention have detect that flux is high, susceptibility is high, high specificity, easy and simple to handle, cost is low and the advantage such as quantitatively accurate.
Description
Technical field
The invention belongs to molecular pathology and immunological technique field, be specifically related to the structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof.
Background technology
Swine fever (Classicalswinefever, CSF) is that the one caused by Pestivirus suis (Classicalswinefevervirus, CSFV) is acute, hot, high degree in contact sexually transmitted disease.Research shows, CSFV main infection monocytes/macrophages system, causes serious lymphopenia, platelet aggregation and coagulation function obstacle, and the atrophy of the central immune organ such as thymus gland, marrow.CSFV is also by causing the reaction of body disease-resistant poison to reduce, suppress the apoptosis of cells infected, promote that the approach such as the apoptosis of non-infected cells cause body's immunity to damage.
Programmed death ligand (PD-1) and programmed death acceptor-1 (PD-1) thereof are CD28/B7 superfamily members, and wide expression is in various tissue.PD-1/PD-L costimulatory signal looks the degree of inflammation of body, immunological status is different with genetic background and activate or suppress, main maincenter and the peripheral immune tolerance participating in T cell.Compared with other CD28 superfamily members, PD-1/PD-L signal path plays more extensive and complicated immunoregulation effect, closely related with autoimmune disease, tumour, chronic infection and inflammation.In immunomodulatory, PD-1 and its part PD-Ls mediates the activation of PD-1:PD-L signal path jointly, premunition tolerance and immunosuppression signal in central immune and periphery immune response, there is restraining effect to the function of antigen specific T, B cell, the propagation of T cell, the secretion of cytokine and kill capability, most of function of T cell after blocking this path, can be recovered.Confirm through correlative study, the infection of some viruses can induce the expression of PD-1 and acceptor PD-Ls thereof, thus affects PD-1:PD-Ls path, makes the immune supervision of viral escape and kills and wounds, and causes body to produce immunosuppression and persistent infection.Therefore, PD-1 and part PD-Ls thereof becomes the focus that people pay close attention in the immunosuppressive disease researchs such as chronic sustained infections, immunotolerance disease, tumour in recent years gradually, and in animal immune inhibition disease or viral persistence infection, the research of T cell immunosuppression path PD-1:PD-Ls is just at the early-stage, and the research particularly in porcine viral diseases is rare report also.
In recent years, real-time fluorescence quantitative PCR (Real-TimePCR) technology is that gene abundance detection provides brand-new method, compare with traditional method, have that susceptibility is high, high specificity, easy and simple to handle, cost is low and be quantitatively accurately widely used, it can reach the object of monitoring in real time by the fluorescence signal intensity detecting target sequence pcr amplification.But the Real-TimePCR detection system of the abundance of PD-1 gene in pig peripheral blood monocyte is set up and the research of application there is not been reported.
Summary of the invention
The technical problem to be solved in the present invention is: the construction process that the invention provides a kind of pig peripheral blood monokaryon lymphocyte PD-1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid;
The present invention establishes a kind of real-time fluorescence quantitative PCR detection method of PD-1 gene abundance on this basis, and the method has the advantages such as susceptibility is high, high specificity;
The present invention, by the Changing Pattern of PD-1 in research peripheral blood lymphocytes, for the quantitative analysis of pig PD-1 Molecular Detection provides technology platform, and can be used for analyzing pig infection virus disease as in the Changing Pattern of the transcriptional level of PD-1 gene after CSF.
technical scheme of the present invention:
The construction process of pig peripheral blood monokaryon lymphocyte PD-1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid, comprises the following steps:
Gather the peripheral blood of piglet, isolate peripheral blood mononuclear lymphocyte, extract the lymphocytic total serum IgE of peripheral blood mononuclear, total serum IgE reverse transcription is become cDNA, cDNA is stored in-20 DEG C, adopt regular-PCR method amplification PD-1 goal gene fragment;
Adopt regular-PCR method amplification PD-1 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaims purifying; Then PD-1 goal gene purified fragments is connected with pMD18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Reaction system wherein during regular-PCR amplification is 25 μ L, reaction system is as follows: 2 μ L sample cDNA templates, 2.5 μ L10 × PCRBuffer, 2 μ LdNTP, concentration is forward primer and each 0.5 μ L of reverse primer of 20 μm of ol/L, the Taq DNA polymerase of 0.5 μ L, all the other are aseptic tri-distilled water;
Wherein, forward primer F is: 5 '-GTGGGAGGCTGCCTTGGA-3 ',
Reverse primer R is: 5 '-GGAGGGGAGTGCAGAGGTG-3 '.
Described pig PD-1 goal gene fragment is SEQIDNo.1;
Response procedures during described regular-PCR amplification is: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 10min.
A Real-time detection method of abundance for pig peripheral blood monokaryon lymphocyte PD-1 gene, comprises the following steps:
(1) the pig PD-1 goal gene fragment reclaiming purifying is connected with pMD18-T carrier, is then converted in competent cell DH5 α, extract recombinant plasmid; After colony screening, carry out sequencing analysis, choose with the positive plasmid of PD-1 goal gene fragment identical sequence as standard substance plasmid, the DNA concentration of bioassay standard product plasmid, and be converted into the copy concentrations of plasmid, by 1:10 concentration gradient dilution positive plasmid doubly;
(2) with the positive plasmid diluted for template, carry out real-time fluorescence quantitative PCR amplified reaction, detect fluorescent signal with real-time fluorescence quantitative PCR instrument, after reaction terminates, draw out typical curve, then measure the gene abundance of PD-1 in sample DNA according to the change of fluorescent signal and typical curve;
Wherein the reaction system of real-time fluorescence quantitative PCR amplification is 20 μ L, and comprise 2 μ L plasmid templates, concentration is forward primer F and each 0.2 μ L, SYBRGreenIPreMix10 μ L, the tri-distilled water 7.6 μ L of reverse primer R of 20 μm of ol/L;
Wherein, forward primer F is: 5 '-GTGGGAGGCTGCCTTGGA-3 ',
Reverse primer R is: 5 '-GGAGGGGAGTGCAGAGGTG-3 '.
Described goal gene fragment is SEQIDNo.1; Described real-time fluorescence quantitative PCR amplification program is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; 60 DEG C of annealing and extension 34s, collect fluorescent signal when 60 DEG C, then 40 circulations.
The positive plasmid concentration range of described dilution is 3.05 × 10
10-3.05 × 10
1copy/μ L; Described typical curve is Y=-3.71X+21.62.
Application in the transcriptional level Changing Pattern of described Real-time detection method of abundance PD-1 gene after analyzing pig infection virus disease.
positive beneficial effect of the present invention:
The present invention is by synthesis forward primer, reverse primer, amplification pig PD-1 goal gene fragment, establish the method for the real-time fluorescence quantitative PCR of PD-1 gene abundance in pig peripheral blood monocyte, for the better transcriptional level to PD-1 in porcine viral diseases carries out accurate quantitative analysis, and then the Changing Pattern of PD-1 in research peripheral blood lymphocytes, for the quantitative analysis of pig PD-1 Molecular Detection provides technology platform, and the biological function played in porcine viral diseases for PD-1 and application system thereof lay the foundation.
Technical scheme disclosed in this invention is compared with conventional art, and susceptibility is higher, utilizes the method set up to 10
9~ 10
19 groups of different concns standard positive plasmids of copies/ μ L detect, and result shows: in the present invention, the Monitoring lower-cut of PD-1 is 10copies/ μ L, its concentration and C
tgood linear relationship is had, coefficient R between value
2=0.998; Utilize the method set up to carry out replica test, organize replica test result between interior and group and show, the variation coefficient, all within 3%, has good repeatability; Occur single narrow peak (Fig. 4) from solubility curve figure, PD-1 molecular melting curve, and agarose gel electrophoresis analysis shows, Real-timeRT-PCR amplification is single specificity object fragment (Fig. 5), illustrates that the present invention has good specificity; The technical program also has and detects that flux is high, easy and simple to handle, cost is low and the feature such as quantitatively accurate in addition.
The present invention confirms by experiment, and pig infects after CSFV, and the expression amount copying PD-1 along with virus in body raises gradually, illustrates that the variation relation of the infection of CSFV and virus load and pig PD-1 gene abundance is very close; And after confirming pig infection CSFV there is certain relation between changing in the expression of PD-1 expression change and IL-2 and IL-10 cytokine, pig PD-1 have activated PD-1:PD-Ls signal path after expressing and raising, cause the decline of pig T cell immunologic function and proliferation activity, cause infected pigs's immunologic function to reduce.
Pig PD-1 gene real-time fluorescence quantitative PCR detection method of the present invention, for detect porcine viral diseases as swine fever, pig circular ring virus 2, pig breathe with reproductive syndrome etc. in the damnification of immunity function that causes the expression Changing Pattern of PD-1 provide technology platform, thus enriched the mechanism that swine fever causes damnification of immunity function further.
Accompanying drawing explanation
Fig. 1 is that sepharose detects pig PD-1 gene amplification result;
Fig. 2 is pig PD-1 Real time PCR amplification curve;
Fig. 3 is pig PD-1 Real time PCR typical curve;
Fig. 4 is pig PD-1 Real time PCR standard substance solubility curves;
Fig. 5 is pig PD-1 real time fluorescent quantitative product specificities analytical results;
Fig. 6 is the copy number that pig infects PD-1 gene in CSFV different times peripheral blood lymphocytes;
Fig. 7 is that pig infects CSFV virus load detected result in CSFV different times blood plasma;
Fig. 8 is the copy number that pig infects CSFV different times IL-2 gene;
Fig. 9 is the copy number that pig infects CSFV different times IL-10 gene.
Embodiment
In the present invention, the concept of gene copy number, gene abundance TYP; Real-timePCR, real-time fluorescence quantitative PCR represent same concept; ddH
2o represents distilled water; CSF represents swine fever; CSFV represents Pestivirus suis, and carbox fluorescenceindiacetate succinimidyl ester (carboxyfluoresceinsuccinimidylaminoester, CFSE) is a kind of fluorescence dye that can mark active somatic cell.
Laboratory animal in embodiment and bacterial classification: 30 age in days sodium selenites, raise in shield retaining; Strain Shimen CSFV provided by Chinese veterinary medicament inspection, and median infective dose is 10
5× TCID
50; Competent escherichia coli cell DH5 α, for this laboratory is preserved.
Main agents and instrument: lymphocyte separation medium, purchased from Tianjin Hao sun biological products Science and Technology Ltd.; PCR primer purifying reclaims test kit, purchased from Shanghai Sangon Biological Engineering Technology And Service Co., Ltd; Taq DNA polymerase, Reverse Transcription box, pMD18-T carrier, all purchased from the precious biotechnology company limited in Dalian; SYBRGreenI, purchased from Invitrogen company.
embodiment 1the structure of pig PD-1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid
Gather the peripheral blood of 45 age in days piglets, the specification sheets with reference to lymphocyte separation medium is separated the lymphocyte of peripheral blood, carries out the extraction of total serum IgE with reference to Invitrogen company's T RIzol test kit specification sheets and pertinent literature.The total serum IgE extracted becomes cDNA with reference to the reverse transcription of Reverse Transcription box specification sheets, be stored in-20 DEG C for subsequent use, for the template of the PD-1 goal gene fragment that increases.
Adopt regular-PCR method amplification PD-1 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaims purifying; Then PD-1 goal gene purified fragments is connected with pMD18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Described goal gene fragment is sequence SEQIDNo.1:
GTGGGAGGCTGCCTTGGACCCAGCCCACAGCTGGGGGGAACAGGGCGGGAGGAGAGAGGCACAAGGTCGGGGGTTCAGGGAGGAGGGGCTCGTGCAATGCCCAGGCTGGAAGAGAGGTCCTGGCAGCCATGGGGCCACCTCTGCACTCCCCTCC。
In order to build the common PCR reaction system of PD-1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid:
Common PCR reaction system is 25 μ L, reaction system is as follows: 2 μ L sample DNA templates, negative control with aseptic tri-distilled water for template, 2.5 μ L10 × PCRBuffer, 2 μ LdNTP, the each 0.5 μ L(20 μm ol/L of forward and reverse primer), 0.5 μ LTaqDNA polysaccharase (Dalian Bao Bio-Engineering Company), all the other volumes are supplied with aseptic tri-distilled water; Reaction system is softly mixed, carries out amplified reaction in regular-PCR instrument.
Regular-PCR program is: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 10min.
Wherein pig PD-1 real-time fluorescence quantitative PCR primer is synthesized by certain biotech firm, and primer sequence is as follows:
Forward primer F is: 5 '-GTGGGAGGCTGCCTTGGA-3 ',
Reverse primer R is: 5 '-GGAGGGGAGTGCAGAGGTG-3 '.
Regular-PCR product is carried out 2% agarose electrophoretic analysis, voltage 100V, observe product after 35min under ultraviolet lamp, result display amplifies single band, and clip size is at about 156bp.
Amplification is shown in that in accompanying drawing 1, figure, M is DL2000 molecular weight standard, and 1 is the amplified production of PD-1 gene, and amplified band is more clear, affects without primer dimer.Extension increasing sequence is after clone, order-checking, the comparison of nucleic acid homology is carried out in GenBank, result shows, in sequence SEQIDNo.1 and the GenBank obtained, the sequence homology of pig PD-1 gene (NM_001204379) is 100%, illustrate that primer and amplified production are all correct, can be used for next step experimental study.After specific fragment is carried out sepharose recovery, carry out Cloning Transformation, transfer to Shanghai Sangon Biological Engineering Technology And Service Co., Ltd to carry out sequencing analysis the positive colony of acquisition.
embodiment 2:the foundation of pig PD-1 real-time fluorescence quantitative PCR system
(1) preparation of plasmid DNA template
Adopt regular-PCR amplification method amplification PD-1 goal gene fragment, goal gene fragment detected through 2% agarose gel electrophoresis and reclaims purifying, being converted in competent cell DH5 α after connecting with pMD18-T carrier (TaKaRa, Dalian), extracting recombinant plasmid; After colony screening, carry out sequencing analysis, sequencing result shows sequence 100% homology with pig PD-1 gene in GenBank, and illustrate that obtained sequence is correct, positive plasmid can be used for the making of plasmid standard.Use this standard substance plasmid DNA concentration of trace dna albumen spectrophotometric determination to be 95.4 μ g/mL, primary standard product plasmid solution is carried out 1:10 doubling dilution doubly.
(2) making of the calculating of standard plasmid concentration and PD-1 typical curve
Extract the positive colony plasmid through sequence verification, the DNA concentration conversion of plasmid is become copy number.The method of calculation of plasmid copy number are: copy number (copies/ μ L)=concentration (μ g/ μ L) × 6.02 × 10
23(copies/ μ L)/MW(g/mol).
Wherein MW=(cloning vector length+object fragment length) (bp)) × 660g/mol/bp.
Known: cDNA=95.4 μ g/mL, plasmid PMD18-T sequence length is 2692bp, PD-1 gene insert length is 156bp; The average molar mass of single base is 660g/mol, and calculation formula is:
Molecular weight (MW)=(2692+156) × 660=1.88 × 10
6g/mol.
Plasmid copy concentration: 6.02 × 10
23× (95.4 × 10
-9) ÷ (1.88 × 10
6)=3.05 × 10
10copies/ μ L.
Using the plasmid solution of above-mentioned known copy concentration as standard plasmid, when carrying out Real-timePCR Specification Curve of Increasing, by 10 times of gradient dilutions, (concentration range is 3.05 × 10
10-3.05 × 10
1copies/ μ L).
The plasmid of known copy number is carried out 1:10 times of gradient dilution, obtain plasmid standard.
With the plasmid diluted for template, carry out real-time fluorescence quantitative PCR amplified reaction, reaction adopts Real-timePCR test kit SYBRPremixExTaqTM(Invitrogen company), reaction system is 20 μ L:2 μ L standard plasmid templates, F, R primer (20 μm of ol/L) each 0.2 μ L, SYBRGreenIPreMix10 μ L, tri-distilled water 7.6 μ L.(template is 2 μ LddH all to arrange negative control in each Real-timePCR reaction
2o), Real-timePCR program is: 95 DEG C of warm start 30s; 94 DEG C of sex change 5s; 60 DEG C of annealing and extension 34s, collect fluorescent signal when 60 DEG C, 40 circulations.F, R primer is wherein identical with embodiment 1.
Typical curve and all testing samples all arrange 3 parallel reactors.Reaction is carried out in ABI7500 quantitative PCR apparatus (U.S. LifeTechnologies), utilizes ABI7500 software detection and collects fluorescent signal, and carrying out data analysis.
The amplification curve (see accompanying drawing 2) of reaction drawn out voluntarily by ABI7500 software Real time PCR software.Amplification curve display from left to right 6 curves represents standard substance 10 successively
7, 10
6, 10
5, 10
4, 10
3, 10
2the amplification curve of gradient dilution liquid, 6 plasmid standard amplification curves are more smooth, present typical S type, and each cycle threshold (Ct value) interval is even.
The cycle threshold (Ct value) of each concentration gradient of standard substance provided according to amplification curve and reaction, the typical curve (see accompanying drawing 3) of reaction drawn out voluntarily by ABI7500 software.The coefficient R of this typical curve
2=0.997, slope is-3.71, and typical curve is Y=-3.71X+21.62, and wherein Y is the Ct value of real-time fluorescence quantitative PCR reaction, and X is the gene constructed standard plasmid copy number logarithmic value of PD-1.Calculate its amplification efficiency Eff%=86.028%, meet the requirement of ABI7500 quantitative fluorescence analysis to typical curve.
Measure the solvent temperature of standard substance in real-time fluorescence quantitative PCR process of each concentration dilution gradient, and draw solubility curve (see accompanying drawing 4).The solubility curve type peak of standard substance and sample is single, and standard substance solvent temperature identical (91.5 ± 0.5 DEG C), show that amplified reaction product solvent temperature is homogeneous, specificity is good, and without primer dimer.
The gene abundance of PD-1 in sample DNA can be measured according to the change of fluorescent signal and typical curve.
embodiment 3: the susceptibility of pig PD-1 real-time fluorescence quantitative PCR system, specificity and repeatability are analyzed
Pig PD-1 recombinant plasmid constructed by embodiment 1 is adopted to recombinate standard plasmid as the positive; Adopt the pig PD-1 real-time fluorescence quantitative PCR detection system that embodiment 2 is set up; The ABI7500 quantitative real time PCR Instrument that real-time fluorescence quantitative PCR instrument adopts LifeTechnologies company (U.S.) to produce carries out.
With 10 of 10 times of serial dilutions
1~ 10
9copies/ μ L pig PD-1 positive restructuring standard plasmid does sensitivity test, and result shows, the Monitoring lower-cut of PD-1 is 10copies/ μ L.
Specificity analyses is done to pig PD-1 molecule Real-time-PCR solubility curve (see accompanying drawing 4) and product agarose gel electrophoresis (see accompanying drawing 5), result shows, there is single narrow peak in solubility curve, can be increased the specific fragment onesize with expection object fragment, do not generate nonspecific products and primer dimer.
In carrying out respectively batch by the method set up and batch between repeatability detect, result shows, in batch and batch between the variation coefficient be less than 3%, repeatability good (see table 1).
Table 1 pig PD-1 real time fluorescence quantifying PCR method criticize interior and batch between reproducibility result
embodiment 4: utilize the real time fluorescence quantifying PCR method that the present invention sets up, analyze pig infects PD-1 gene abundance in rear peripheral blood mononuclear lymphocyte Changing Pattern in virus disease.
Adopt the pig PD-1 real-time fluorescence quantitative PCR system that embodiment 2 is set up; The ABI7500 quantitative real time PCR Instrument that real-time fluorescence quantitative PCR instrument adopts LifeTechnologies company (U.S.) to produce.
The sodium selenite of 15 30 ages in days is raised to 45 ages in days, detects by IDEXX antibody against swine fever virus detection kit, determine that CSFV antibody is for negative, is divided into control group (5) and experimental group (10) at random.Experimental group and control group isolated rearing, wherein experimental group is by musculi colli injection CSFV diluent 0.1mL/ head; Control group sterilizing PBS makes same treatment.
The 0th after 45 age in days piglets are infected respectively at CSFV, 3, 7, 10, within 14 and 21 days, adopt peripheric venous blood, and with the same age in days piglet not infecting CSFV for contrast, be separated infected group and control group peripheral blood mononuclear lymphocyte simultaneously, and extract total serum IgE, utilize Reverse Transcription box (Dalian is precious biological) reverse transcription synthesis cDNA, utilize the Auele Specific Primer that embodiment 1 provides, the real-time fluorescence quantitative PCR system adopting embodiment 2 to set up detects, calculate according to typical curve and can obtain PD-1 gene copy number (i.e. gene abundance) in infected group and control group peripheral blood mononuclear lymphocyte, see accompanying drawing 6.
Result shows, with do not infect compared with CSFV sodium selenite, at the metainfective different times of CSFV, because the immunological status of body is different, the abundance of each phase PD-1 gene is different, remarkable (P < 0.05) rising compared with control group in 3rd ~ 10 days, wherein raises significantly (P < 0.05) on the 3rd day after infection; Within 7th day, continue to raise, within the 10th day, start to decline compared with control group extremely significantly (P < 0.01), but, continue afterwards to reduce, and there is no statistical significance compared with control group still significantly (P < 0.05).As can be seen here, the abundance of pig PD-1 gene has larger associating with the swine fever course of disease.
embodiment 5:after Pestivirus suis (CSFV) infected pigs, PD-1 expresses the relation in change and blood plasma between virus load
CSFV carrying capacity real-time fluorescence quantitative PCR primer and probe are synthesized by certain biotech firm, primer and probe sequence as follows:
Forward primer F:5 '-CCCTGAAGTGGATTAGAA-3 ',
Reverse primer R:5 '-TACCCTTGTTGATCCTATC-3 ',
TaqMan probe: 5 '-(FAM) TTCACCGACTGTCCATTGTGG (Eclipse)-3 ';
Respectively within the 0th, 3,7,10,14 and 21 day, taking peripheral blood after CSFV infects 45 age in days piglets, extracting the total serum IgE of CSFV in peripheral blood, utilizing Reverse Transcription box (Dalian is precious biological) reverse transcription synthesis cDNA.Reverse transcription reaction system is: 2 μ L5 × PrimeScriptBuffer, 0.5 μ LPrimeScriptRTEnzymeMixI, 0.5 μ LOligodT primer, 0.5 μ LRandom6mers, 1 μ g total serum IgE and RNaseFreedH2O.Reverse transcription reaction condition is: 37 DEG C of reactions 15 minutes, 85 DEG C 5 seconds, synthesis cDNA is placed in-20 DEG C and saves backup.Real-time fluorescence quantitative PCR detects the carrying capacity of CSFV, reagent is premixExTaq (probeqPCR) (Dalian is precious biological), carry out at ABI7500 instrument, real-time fluorescence quantitative PCR reaction system is 20 μ L systems: 10 μ LPremixExTaq, 0.4 μ L forward primer (10 μm of ol/L), 0.4 μ L reverse primer (10 μm of ol/L), 0.8 μ LTaqMan probe (10 μm of ol/L), 0.4 μ LROXPreferenceDye, 2 μ L template DNAs and 6 μ L tri-distilled waters.Reaction system is: 95 DEG C of warm starts 10 seconds, 40 circulations, 95 DEG C of sex change 15 seconds, 56 DEG C of annealing and extend 45 seconds.The carrying capacity of CSFV in blood plasma is calculated according to typical curve.
Result shows, after CSFV infects, the 3rd day virus load starts to raise, and within the 7th day, reaches peak value, reduces (see accompanying drawing 7) gradually afterwards.
4 results can be found out in conjunction with the embodiments, and along with virus copying in body, the expression amount of PD-1 raises gradually, illustrate that the variation relation of the infection of CSFV and virus load and pig PD-1 gene abundance is very close.
embodiment 6:relation between pig CSFV infection rear PD-1 expression change and IL-2, IL-10 cytokine-expressing change
Adopt the pig PD-1 real-time fluorescence quantitative PCR system that embodiment 2 is set up, the CSFV of embodiment 4 is adopted to infect the peripheral blood of after 45 age in days piglets the 0th, 3,7,10,14 and 21 day, with the product of its peripheral blood mononuclear lymphocytic total serum IgE reverse transcription cDNA for template, expression change CSFV being infected to porcine cytokine IL-2, IL-10 of latter 0th, 3,7,10,14 and 21 day detects.
The ABI7500 quantitative real time PCR Instrument that real-time fluorescence quantitative PCR instrument adopts LifeTechnologies company (U.S.) to produce carries out.
Result shows, IL-2mRNA expression level infects the 7th day expression level at CSFV and reduces (P<0.05) (see accompanying drawing 8), when PD-1 expression is increased (the 7th day), IL-10 expression level raises and change extremely significantly (P<0.01) (see accompanying drawing 9).
After CSFV infects, PD-1 expression amount raises, and activate PD-1:PD-Ls signal path, the reduction causing IL-2 to express (the 7th day), is shown in accompanying drawing 9.Simultaneously, the expression amount of IL-10 raises (the 7th day), illustrates that the expression of IL-10 have impact on the expression of PD-1 after CSFV infects.And IL-10 is a kind of inhibitive ability of immunity cytokine, so after CSFV infects, the rising that pig PD-1 expresses, have activated PD-1:PD-Ls signal path, and the reduction of IL-2 and the rising of IL-10, makes body be in immunosuppressant state.
SEQUENCELISTING
<110> Xinxiang University
The structure of <120> pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and should
With
<130> molecular pathology and immunological investigation
<160>6
<170>PatentInversion3.4
<210>1
<211>154
<212>DNA
<213> artificial sequence
<400>1
gtgggaggctgccttggacccagcccacagctggggggaacagggcgggaggagagaggc60
acaaggtcgggggttcagggaggaggggctcgtgcaatgcccaggctggaagagaggtcc120
tggcagccatggggccacctctgcactcccctcc154
<210>2
<211>18
<212>DNA
<213> artificial sequence
<400>2
gtgggaggctgccttgga18
<210>3
<211>19
<212>DNA
<213> artificial sequence
<400>3
ggaggggagtgcagaggtg19
<210>4
<211>18
<212>DNA
<213> artificial sequence
<400>4
ccctgaagtggattagaa18
<210>5
<211>19
<212>DNA
<213> artificial sequence
<400>5
tacccttgttgatcctatc19
<210>6
<211>21
<212>DNA
<213> artificial sequence
<400>6
ttcaccgactgtccattgtgg21
Claims (1)
1. the construction process of pig peripheral blood monokaryon lymphocyte PD-1 real-time fluorescence quantitative PCR positive criteria recombinant plasmid, is characterized in that: the method comprises the following steps:
Gather the peripheral blood of piglet, isolate peripheral blood mononuclear lymphocyte, extract the lymphocytic total serum IgE of peripheral blood mononuclear, total serum IgE reverse transcription is become cDNA, cDNA is stored in-20 DEG C, adopt regular-PCR method amplification PD-1 goal gene fragment;
Adopt regular-PCR method amplification PD-1 goal gene fragment, this goal gene fragment is detected through agarose gel electrophoresis, and reclaims purifying; Then PD-1 goal gene purified fragments is connected with pMD18-T carrier, is converted in competent cell DH5 α, extract recombinant plasmid, after colony screening, carry out sequencing analysis, obtain the positive criteria recombinant plasmid with goal gene fragment identical sequence;
Reaction system wherein during regular-PCR amplification is 25 μ L, reaction system is as follows: 2 μ L sample cDNA templates, 2.5 μ L10 × PCRBuffer, 2 μ LdNTP, concentration is forward primer and each 0.5 μ L of reverse primer of 20 μm of ol/L, the Taq DNA polymerase of 0.5 μ L, all the other are aseptic tri-distilled water;
Response procedures during described regular-PCR amplification is: 95 DEG C of warm start 1min; 94 DEG C of sex change 30s; 55 DEG C of annealing 30s; 72 DEG C extend 30s, 30 circulations, and last 72 DEG C extend 10min;
Wherein, forward primer F is: 5 '-GTGGGAGGCTGCCTTGGA-3 '
Reverse primer R is: 5 '-GGAGGGGAGTGCAGAGGTG-3 ';
Described pig PD-1 goal gene fragment is SEQIDNo.1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410102841.3A CN103966314B (en) | 2014-03-19 | 2014-03-19 | The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410102841.3A CN103966314B (en) | 2014-03-19 | 2014-03-19 | The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103966314A CN103966314A (en) | 2014-08-06 |
| CN103966314B true CN103966314B (en) | 2016-04-20 |
Family
ID=51236316
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410102841.3A Active CN103966314B (en) | 2014-03-19 | 2014-03-19 | The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103966314B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110923297A (en) * | 2019-10-25 | 2020-03-27 | 湖北省农业科学院畜牧兽医研究所 | Method for detecting pig genome off-target integration risk |
| CN112661837A (en) * | 2021-01-15 | 2021-04-16 | 新乡学院 | Preparation and application of escherichia coli preference soluble pig PD-1 recombinant protein |
| CN113564256A (en) * | 2021-08-12 | 2021-10-29 | 川北医学院 | Detection device of stomach cancer specificity LncRNA-GACAT3 |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001059124A1 (en) * | 2000-02-09 | 2001-08-16 | Sapporo Immuno Diagnostic Laboratory | Microplate fluorescent screening method for detecting gene anomaly allowing convenient and less expensive treatment of specimens on mass scale |
| CN101424642A (en) * | 2008-11-14 | 2009-05-06 | 中国科学院上海应用物理研究所 | Target molecule detecting method based on nanometer aurum and nucleic acid structure |
-
2014
- 2014-03-19 CN CN201410102841.3A patent/CN103966314B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001059124A1 (en) * | 2000-02-09 | 2001-08-16 | Sapporo Immuno Diagnostic Laboratory | Microplate fluorescent screening method for detecting gene anomaly allowing convenient and less expensive treatment of specimens on mass scale |
| CN101424642A (en) * | 2008-11-14 | 2009-05-06 | 中国科学院上海应用物理研究所 | Target molecule detecting method based on nanometer aurum and nucleic acid structure |
Non-Patent Citations (1)
| Title |
|---|
| 猪PD-1分子及其配体的实时荧光定量RT-PCR检测方法的建立;彭金美等;《中国兽医科学》;20100420;第40卷(第4期);摘要，第411页右栏第1段，第411-412页第1节，第412页第2节，图1，第413页第3节 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103966314A (en) | 2014-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947838B (en) | African swine fever virus non-structural gene real-time fluorescence LAMP (loop-mediated isothermal amplification) detection primer group, kit and detection method | |
| Dheda et al. | Validation of housekeeping genes for normalizing RNA expression in real-time PCR | |
| CN107586887B (en) | PCR differential diagnosis kit for porcine circovirus type 2 and type 3 and detection method thereof | |
| EP3436606B1 (en) | Plasma derived cell-free mitochondrial deoxyribonucleic acid | |
| Prescott et al. | Rapid detection of Cyprinid herpesvirus 3 in latently infected koi by recombinase polymerase amplification | |
| CN103966314B (en) | The structure of pig peripheral blood monokaryon lymphocyte PD-1 recombinant plasmid, gene abundance real-time detection method and application thereof | |
| WO2022095781A1 (en) | Molecular marker for predicting and monitoring disease course of novel coronavirus pneumonia and use thereof | |
| CN113832260B (en) | Multiplex nano PCR detection primer pair, kit and application method for goose astrovirus, goose parvovirus and goose embedded cup virus | |
| Li et al. | Global transcriptional profiles in peripheral blood mononuclear cell during classical swine fever virus infection | |
| CN1710101A (en) | Fluorescent quantitative DCR kit for detecting swine pseudo rabies virus and its use | |
| CN104032038A (en) | Detection kit and detection method for siniperca chuatsi rhabdoviruses | |
| CN114381552A (en) | Primer, probe and detection method for detecting porcine circovirus type 4 based on CRISPR-Cas12a | |
| CN103966313B (en) | Construction of pig peripheral bloodmononuclear lymphocytePD-L1 (programmed death-ligand1) recombinantplasmids, real-time gene abundance detection method and application of method | |
| CN111154915A (en) | PCR differential diagnosis kit for porcine circovirus type 4 and type 3 and detection method thereof | |
| CN103966312B (en) | The structure of pig peripheral blood monokaryon lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof | |
| CN103820481B (en) | The structure of chicken peripheral blood mononuclear lymphocyte PD-L2 recombinant plasmid, gene abundance real-time detection method and application thereof | |
| CN103789335B (en) | Construction method of recombinant plasmid of PD-L1 (programmed death-ligand 1) in chicken peripheral blood mononuclear lymphocytes, real-time gene abundance detection method and application of detection method | |
| CN113462817A (en) | PCR primer, probe, kit and detection method for detecting African swine fever virus capsid integrity | |
| CN105002292A (en) | Yersinia pestis fluorescent quantitation primer, detection method and kit | |
| CN107236023B (en) | Antigen composition for detecting tuberculosis infection and application thereof | |
| CN111020059A (en) | PCR detection method for porcine circovirus type 3 | |
| Wen et al. | Analysis of Genetic Variation of VP2 Gene in 6 FPV Strainsin China | |
| CN113293235B (en) | Primer for frog virus detection and application thereof | |
| CN113699219B (en) | Nested PCR (polymerase chain reaction) primer group for simultaneously detecting mycoplasma hyopneumoniae and chlamydia suis and application thereof | |
| Chen et al. | Genomic Characteristics of a Chicken Infectious Anemia Virus in Contaminated Attenuated Vaccine |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |