CN103768617B - Nanometer gold miR-375 conjugate and its preparation method and application - Google Patents
Nanometer gold miR-375 conjugate and its preparation method and application Download PDFInfo
- Publication number
- CN103768617B CN103768617B CN201410056298.8A CN201410056298A CN103768617B CN 103768617 B CN103768617 B CN 103768617B CN 201410056298 A CN201410056298 A CN 201410056298A CN 103768617 B CN103768617 B CN 103768617B
- Authority
- CN
- China
- Prior art keywords
- mir
- nanometer gold
- conjugate
- preparation
- nucleotide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
The invention discloses a kind of nanometer gold miR-375 conjugate and its preparation method and application.This conjugate comprises nanogold particle and double chain nucleotide, and described double chain nucleotide is the miR-375 that two chains all have the double-strand of 28 bases, or, to encode identical function double chain nucleotide 95 ~ 100% with the miR-375 sequence homology of double-strand; Wherein, described double chain nucleotide all contains two loop-stem structures, and 5 ' end of antisense strand contains six carbon alkyl hydrosulfides, and with nanogold particle coupling.This nanometer gold miR-375 conjugate is external has significant Developing restraint effect in hepatoma carcinoma cell and body to hepatocellular carcinoma in nude mice, in the treatment use of hepatocarcinoma, have beneficial effect, also can be applicable to the treatment of other digestive system tumors in the future.
Description
Technical field
The present invention relates to hepatocarcinoma field, refer to a kind of nanometer gold miR-375 conjugate and its preparation method and application particularly.
Background technology
Primary hepatoma (hepatocellular carcinoma; HCC; Be called for short hepatocarcinoma) be a kind of tumor of high malignancy, there is the feature of high incidence and high mortality.Excision remains the first-selection of current Hepatoma therapy, but the hepatocarcinoma patient of applicable surgical intervention is less than 20%, and postoperative 5 years survival rates are only 30%, 5 years relapse rates but up to 80%.In late period during major part patient assessment, lose the chance of excision; General liver cancer patient make a definite diagnosis after mean survival time (MST) be 3 ~ 8 months, we still lack effective remedy measures to advanced liver cancer at present.
MicroRNAs (miRNAs) is a group leader about 22 nucleotide, conservative non-coding tiny RNA, is played an important role by the expression of post-transcriptional level controlling gene in bioprocess.MiRNA has Space-time speciality in expression, is extensively present in various animal and plant, participates in multiple important vital movement; It is predicted, in human body cell, the gene of more than 30% is all subject to the regulation and control of miRNA.The change of MiRNAs expression can regulate tumor that relevant important biomolecule process occurs, as cell differentiation, and proliferation and apoptosis etc.; Thus system evaluation certain determine that the change of phenotype tumor miRNA express spectra is conducive to the tumorigenic mechanism of our more deep understandings.At present, the express spectra research of multiple human tumor miRNAs is carried out rapidly, and identifies the miRNAs of many unconventionality expressions.The research display of function assessment, the effect of these unconventionality expressions miRNAs is similar to oncogene or antioncogene, and the single miRNA of curative regulation and control just can affect many biological pathways simultaneously thus obtain good therapeutic effect.
In previous research work, we apply miRNA chip detection human hepatocarcinoma cells strain (SK-HEP-1, HepG2, Hep3B, Huh7, MHCC97-H, MHCC97-L, SMMC-7721) the miRNAs express spectra and in primary normal liver cell, and the gene expression data base NCBI'sGene Expression Omnibus taking the lead in chip data to be committed to US National Biotechnology Information center:
http:// www.ncbi.nlm.nih.gov/geo/; GEOaccessions number:GSE20077.By comparing the miRNAs differential expression of hepatoma carcinoma cell and normal liver cell, we obtain the miRNAs of 37 unconventionality expressions.Wherein miR-375 lowers one of the most significant miRNAs in hepatoma carcinoma cell, further investigation finds that miR-375 all significantly lowers and played in the developing of hepatocarcinoma in hepatoma carcinoma cell and liver cancer tissue and presses down cancer effect, further disclose 2 important target genes that AEG-1 and ATG7 is miR-375, confirm that the miR-375 of liposome or lentivirus mediated can suppress the growth of hepatoma carcinoma cell in vivo and in vitro.These work show that miR-375 is a better target spot of liver cancer treatment.
MiR-375 finds express at islet cells and regulate and control the secretion of insulin and the formation of islets of langerhans the earliest.Further research finds, miR-375 generally presents low expression particularly in digestive system tumor in tumor tissues, as hepatocarcinoma, gastric cancer, the esophageal carcinoma, cancer of pancreas etc.In these tumors, process LAN miR-375 can suppress target gene as the expression of AEG-1, JAK2, IGF1R, PDK1,14-3-3Z and YAP1 thus the malignant phenotype of Tumor suppression.Therefore, miR-375 has played important effect in the generation and evolution of digestive system tumor, is the novel targets of potential digestive system tumor drug development.
At present, import the method for miRNA and comprise viral vector, liposome-mediated, Assisted Transfection synthetic and electrotransfection etc.But all there are some intrinsic defects in these methods of carrying miRNA in integral level application in the future, comprise bad immunoreation, potential biological insecurity, cytotoxicity, lower tissue-targeting and carry efficiency etc., needing further to improve and optimizate.Recently, nanotechnology new development to miRNA carry and importing brings new hope.The appearance of multivalence oligonucleotide nano gold becomes the powerful tool of a kind of new drug conveying and gene regulation.Nanometer gold miRNA conjugate (miRNA-Au NPs) can enter cell or animal tissue and not by means of liposome or polymeric carrier, the nucleotide on its surface can resist the Degradation of nuclease, same consecutive nucleotides in specific ionization solution is more stable, and the immunoreation produced is far below liposome and viral vector etc.But not yet have applying nano gold to carry the application report of miRNA Hepatoma therapy so far.
Summary of the invention
The object of this invention is to provide a kind of nanometer gold miR-375 conjugate and its preparation method and application.Adopt alkyl hydrosulfide coupling mode, i.e. biochemistry Au-S covalent bond absorption coupling; The miR-375 nucleotide of double-strand is coupled on nanogold particle.Nanometer gold miR-375 conjugate be used for external in hepatoma carcinoma cell and body to the purposes of the Developing restraint effect of hepatocellular carcinoma in nude mice, also there is potential therapeutic effect in the tumor (as gastric cancer, the esophageal carcinoma, cancer of pancreas, colon cancer etc.) of this conjugate to other digestive system in addition.
For solving the problems of the technologies described above, a kind of nanometer gold miR-375 conjugate provided by the invention, this conjugate comprises nanogold particle and double chain nucleotide,
Described double chain nucleotide is the miR-375 that two chains all have the double-strand of 28 bases,
Or, to encode identical function double chain nucleotide 95 ~ 100% with the miR-375 sequence homology of double-strand;
Wherein, described double chain nucleotide all contains two loop-stem structures (stem-loop structure), and 5 ' end of antisense strand contains six carbon alkyl hydrosulfides, and with nanogold particle coupling.
Loop-stem structure can make the miR-375 of double-strand to enter after cell can smoothly digested go out ripe miR-375 sequence.
Further, the positive-sense strand in described double chain nucleotide contains the ripe miR-375 base sequence of " UUUGUUCGUUCGGCUCGCGUGA " 22.
Again further, the mol ratio of described nano gold spherical granule and described double chain nucleotide is 1 ︰ 1 ~ 40.
Again further, 5 ' end of the positive-sense strand of described double chain nucleotide is also containing fluorophor Cy3.
Again further, described nanogold particle is ball-type.
Again further, the particle diameter of described nanogold particle is 10 ~ 60nm.
Again further, the particle diameter of described nanogold particle is 10 ~ 20nm.
Present invention also offers a kind of nanometer gold miR-375 conjugate, comprise the following steps:
1) the nanometer gold suspension that sodium citrate is stable is got, the centrifugal 10min process of 6000g, resuspended with 0.1%DEPC water; Be placed in stir process on room temperature magnetic stirring apparatus to spend the night, after 121 DEG C of high pressure steam sterilization 60min in 4 DEG C of refrigerators preserve, for subsequent use;
2) preparation of 0.1%DEPC: get in DEPC to the 500ml ultra-pure water of 0.446ml1.12g/ml, is placed in excusing from death washer excusing from death process 2h till without oily liquid pearl;
3) preparation of 10mM PBS: the KH accurately taking KCl, 0.2g of NaCl, 0.2g of 8g with analytical balance
2pO
4with the Na of 2.9g
2hPO
4.12H
2o, is dissolved in 100ml without in enzyme sterilized water, after ultrasonic abundant dissolving, is settled to 1L with without enzyme sterilized water;
4) 0.18MPBS preparation: according to PBS preparation program, first with the PBS without enzyme sterilized water preparation 0.2M, pH8.0, is more proportionally diluted to 0.18M;
5) design the miR-375 nucleotide of chemosynthesis double-strand, wherein in positive antisense strand, unpaired base forms 2 special loop-stem structures, and connects Cy3 fluorophor at 5 ' end of its positive-sense strand, and 5 ' end of its antisense strand connects six carbon alkyl hydrosulfides, and structure is as follows:
6) miR-375 nucleotide pretreatment: the miR-375 nucleotide getting 5nmole, is dissolved in 555.6ul ultra-pure water, point takes on 200 μ l, and masking foil parcel lucifuge is preserved in-80 DEG C of refrigerators, for subsequent use; A pipe 100mgOEG-Thiol is taken out from-20 DEG C of refrigerators, after redissolving on ice, carry out subpackage, namely to without adding 5.4 μ l stock solutions in enzyme PCR pipe respectively, carry out nitrogen and dry up protection, be settled to 45 μ l with fresh dehydrated alcohol time to be used, mixing is fully dissolved in after ethanol until it and joins in reactant liquor;
7) coupling: joined by RNA double-stranded complex in the nanometer gold suspension of the 10-25 times amount processed, the final concentration of nucleic acid is about 3 μMs, is placed in and reacts 24h under concussion on room temperature shaker; Regulate pH to 7.0 ~ 8.0, salinity to 0.1M, be placed in 4 DEG C of refrigerators and continue reaction 40h, and ensuing every 12 hours increase a salinity 0.1M, final salinity is made to reach 0.3M, 24h after adding pretreated miR-375 nucleotide, add OEG-Thiol alcoholic solution, make its final concentration be 30 μm of ol/ml;
8) the centrifugal 20min of purification process: 8000g, 4 DEG C of centrifugal solutions, remove unnecessary reagent, Red oil precipitation washing liquid 0.3M PBS is resuspended, and centrifugal and resuspension process repeats 3 times, obtain nanometer gold miR ?375 conjugates, end, 0.3M PBS was resuspended, in 4 DEG C preserve, for subsequent use.
Present invention also offers a kind of conjugate for the preparation of the application in the medicine of Therapeutic cancer, cancer wherein comprises hepatocarcinoma, gastric cancer, the esophageal carcinoma, cancer of pancreas or colon cancer.
Beneficial effect of the present invention is:
Nanometer gold miR-375 conjugate of the present invention has good pharmacological profile, good stability is had in the PBS of 4 DEG C or ultra-pure water solution, need not help just can enter cell by ectogenic transfection reagent, and effectively can improve the expression of miR-375 in hepatoma carcinoma cell, thus effectively play miR-375's but cancer effect.This nanometer gold miR-375 conjugate is external has significant Developing restraint effect in hepatoma carcinoma cell and body to hepatocellular carcinoma in nude mice, in the treatment use of hepatocarcinoma, have beneficial effect, also can be applicable to the treatment of other digestive system tumors in the future.
Accompanying drawing explanation
Fig. 1 is the schematic diagram of nanometer gold miR-375 conjugate;
Fig. 2 is the axonometric chart of nanometer gold miR-375 conjugate;
Fig. 3 is characterization and the Detection of Stability figure of nanometer gold material.
In figure, A. nanometer gold ultraviolet absorpting spectrum, adopt ultraviolet-visible spectrophotometer to carry out nanometer gold full wavelength scanner, the nanometer gold prepared by display has maximum absorption band at 520nm place;
B. the Electronic Speculum qualification of nanogold particle, adopt transmission electron microscope to carry out the detection of pattern, particle diameter and distribution to nanometer gold, result shows: homogeneity and the dispersibility of the nanogold particle of preparation are better;
C. nanometer gold grain size distribution, adopts Nano Measurer software to carry out size statistical analysis to nanometer gold transmission electron microscope (TEM) result, the particle diameter integrated distribution showing this nanogold particle at about 13nm, in normal distribution;
D. nano-Au solution temperature stability test pattern.Adopt particle size analyzer monitoring nanometer gold particle diameter variation tendency in time at different conditions.
Fig. 4 is the qualification figure before and after nanometer gold miR-375 coupling;
In figure, ultraviolet full wavelength scanner collection of illustrative plates before and after A. nanometer gold coupling miR-375 nucleic acid;
Electron-microscope scanning figure before and after B and C. nanometer gold coupling miR-375.
Fig. 5 is miR-375-Au NPs when without the need to entering hepatoma carcinoma cell efficiently when transfection reagent.
Fig. 6 is the detection that miR-375-Au NPs carries miR-375 efficiency.
In figure, #:p<0.01.
Fig. 7 is that the external growing multiplication to hepatoma carcinoma cell of miR-375-Au NPs has obvious inhibitory action.
In figure, *: P<0.05; #:P<0.01.
Fig. 8 is that the growth curve display miR-375-AuNPs of HepG2 hepatoma carcinoma cell transplanted tumor in nude mice has obvious inhibitory action to hepatoma carcinoma cell transplanted tumor in nude mice.
In figure, *: P<0.05; #:P<0.01.
Detailed description of the invention
In order to explain the present invention better, illustrate main contents of the present invention further below in conjunction with specific embodiment, but content of the present invention is not only confined to following examples.
Embodiment 1 particle diameter is the Preparation and identification of the nanogold particle of about 13nm
1) chloroazotic acid preparation: be that 1:3 prepares according to concentrated hydrochloric acid and concentrated nitric acid volume ratio, namely measure 90ml concentrated hydrochloric acid with graduated cylinder and be placed in the clean beaker of 500ml, measure 30ml concentrated nitric acid again, under agitation slowly join in concentrated hydrochloric acid along Glass rod, in yellowish-brown (nitrosyl chloride produces, and has chlorine abnormal smells from the patient, and all preparations and use all need be carried out in fume hood) after stirring, with ParafilmTM beaker mouth, and it is for subsequent use to be labeled as chloroazotic acid with marking pen.
2) HAuCl of 10ml25mM
4the preparation of solution: the HAuCl taking 0.0995g
4.3H
2o is dissolved in 10ml ultra-pure water, fully after mixing masking foil wrap up 4 DEG C keep in Dark Place, for subsequent use.
3) 100ml1mM HAuCl
4the preparation of solution: the HAuCl getting 4ml25mM
4solution, in the brown volumetric flask of 100ml, is settled to 100ml with ultra-pure water, 4 DEG C keep in Dark Place, for subsequent use.
4) preparation of 14ml38.8mM (1%) sodium citrate solution: accurately take 0.16gNa
3c
6h
5o
7.2H
2o, in 14ml ultra-pure water, turns upside down and makes it fully dissolve.
5) chloroazotic acid for preparing of three-neck flask (being connected with condensing tube) stirring magneton will be housed and soak 30min, discard chloroazotic acid, with tap water 3 times, then use dry for standby in ultra-pure water rinse 2 times to baking oven.
6) oil bath pan temperature is set to 130 DEG C, and puts up reflux above oil bath pan.
7) in three-neck flask, the HAuCl of 50ml1mM is added with pipettor
4solution, is placed in oil bath by three-neck flask, its temperature is risen to and starts backflow.
8) in the reactant liquor just starting to reflux, disposablely 5ml38.8mM (1%) sodium citrate solution is added fast, after solution is by light yellow crimson, start timing, cessation reaction after continuation stirring and refluxing 15min, three-neck flask is shifted out oil bath, naturally cools to room temperature.
9), after the whole liquid of question response is cooled to room temperature, the nanometer gold suspension prepared is moved in 50ml centrifuge tube, is placed in 4 DEG C of refrigerators and saves backup.
10) UV absorption spectromtry: adopt ultraviolet-visible spectrophotometer, within the scope of wavelength 200 ~ 800nm, measures the absorption spectrum of nanometer gold suspension.Open ultraviolet spectrophotometer preheating 15min, get 0.5ml nanometer gold suspension ultra-pure water and be diluted to 6 times of volumes.Carry out baseline scan with ultra-pure water, the nanometer gold suspension got after 3ml dilution carries out Sample Scan in quartz colorimetric utensil, obtains nanometer gold ultraviolet spectra and absorbs collection of illustrative plates.
11) grain diameter measurement: adopt Brook haven zatePALS particle size analyzer to measure, open testing graininess software after opening particle size analyzer preheating 10min.Get 1 ~ 3ml sample to measure in cuvette, determine sample particle size and the situation that is evenly distributed, derive granularity graph and analyze.
12) transmission electron microscope (TEM) detects: under 200KV accelerating potential, adopts JEM-2100 (HR) to observe the pattern of sample and granularity.Directly the nanometer gold suspension prepared being dropped in covers on the copper mesh of ultrathin carbon films in advance, carries out evacuation after natural drying.The nanometer gold sample prepared is placed in JEM-2100 (HR) observe, derives granularity graph and analyze.
As shown in Figure 3: the nanometer gold of preparation can steady in a long-term in 4 DEG C, fundamental property be constant in ultra-pure water, also can preserve and stablize relatively for a long time in 4 DEG C of 1mMPBS solution, but then relatively poor at normal temperature condition stability inferior.
Embodiment 2
The coupling method of nanometer gold and miR-375, step is as follows:
1) preparation of 0.1%DEPC: get in DEPC to the 500ml ultra-pure water of 0.446ml1.12g/ml, is placed in excusing from death washer excusing from death process 2h till without oily liquid pearl;
2) preparation of 10mM PBS: the KH accurately taking KCl, 0.2g of NaCl, 0.2g of 8g with analytical balance
2pO
4with the Na of 2.9g
2hPO
4.12H
2o, is dissolved in 100ml without in enzyme sterilized water, after ultrasonic abundant dissolving, is settled to 1L with without enzyme sterilized water;
3) 0.18MPBS preparation: according to PBS preparation program, first with the PBS without enzyme sterilized water preparation 0.2M, pH8.0, is more proportionally diluted to 0.18M;
4) the miR-375 nucleotide of also chemosynthesis double-strand is designed, its positive-sense strand is " 5 '-GCGUUUUGUUCGUUCGGCUCGCGUGAGG-3 ' ", " UUUGUUCGUUCGGCUCGCGUGA " in positive-sense strand 22 bases are the base sequence of ripe miR-375, its antisense strand is " 3 '-CGCAAAACACGCUCCCCGAGCAGCGCCC-5 ' ", wherein in positive antisense strand, unpaired base forms 2 special loop-stem structures, and connect Cy3 fluorophor at 5 ' end of its positive-sense strand, 5 ' end of its antisense strand connects six carbon alkyl hydrosulfides, and structure is as follows:
5) miR-375 nucleotide pretreatment: the miR-375 nucleotide getting 5nmol, is dissolved in 555.6ul ultra-pure water, point takes on 200 μ l, and masking foil parcel lucifuge is preserved in-80 DEG C of refrigerators, for subsequent use.A pipe (100mg) OEG-Thiol is taken out from-20 DEG C of refrigerators; after redissolving on ice; carry out subpackage; namely to without adding 5.4 μ l stock solutions in enzyme PCR pipe respectively; carry out nitrogen and dry up protection; be settled to 45 μ l with fresh dehydrated alcohol (G.R.) time to be used, mixing is fully dissolved in after ethanol until it and joins in reactant liquor.
6) pretreatment of nanometer gold:
1. the nanometer gold suspension that sodium citrate is stable is got, resuspended with 0.1%DEPC water after centrifugal (6000g/10min) process;
2. be placed in stir process on room temperature (air-conditioning temperature control 18 DEG C) magnetic stirring apparatus to spend the night;
3. after 121 DEG C of high pressure steam sterilization 60min in 4 DEG C of refrigerators preserve, for subsequent use;
4. characterize after pretreatment: adopt ultraviolet spectrophotometer, transmission electron microscope and particle size analyzer to carry out relevant parameter to it and measure uninfluenced to verify its character after above-mentioned relevant treatment.
7) coupling:
1. RNA double-stranded complex is joined (10-25 times amount makes the final concentration of nucleic acid be about 3 μMs) in the nanometer gold suspension processed, on room temperature (18 DEG C) shaking table, react 24h under concussion;
2. regulate about pH to 7.0, salinity to 0.1M, be placed in 4 DEG C of refrigerators and continue reaction 40h, and ensuing every 12 hours increase a salinity 0.1M, make final salinity reach of short duration ultrasonic 20s after 0.3M(regulates at every turn); 24h after adding pretreated miR-375 nucleotide, adds OEG-Thiol alcoholic solution, makes its final concentration be 30 μm of ol/ml;
3. purification process: 8000g/20min, 4 DEG C of centrifugal solutions, remove unnecessary reagent, Red oil precipitation washing liquid 0.3M PBS(0.3MNaCl, 10mM phosphate buffer, pH7) resuspended, centrifugal and resuspension process repeats 3 times, obtain nanometer gold miR ?375 conjugates (Fig. 1 and 2).Final 0.3M PBS is resuspended, in 4 DEG C preserve, for subsequent use.
8) UV absorption spectromtry: adopt ultraviolet-visible spectrophotometer, within the scope of wavelength 200 ~ 800nm, measures the absorption spectrum of nanometer gold suspension.Open ultraviolet spectrophotometer preheating 15min.Get 0.5ml nanometer gold suspension and be placed in 5ml EP pipe, be diluted to 6 times of volumes with ultra-pure water.Carry out baseline scan with ultra-pure water, the nanometer gold suspension got after 3ml dilution carries out Sample Scan in quartz colorimetric utensil, obtains nanometer gold ultraviolet spectra and absorbs collection of illustrative plates.
9) grain diameter measurement: adopt Brook haven zatePALS particle size analyzer to measure, open computer desktop testing graininess software after opening particle size analyzer preheating 10min.Get 1ml sample to measure in cuvette, determine sample particle size and the situation that is evenly distributed, derive granularity graph and analyze.
10) transmission electron microscope (TEM) detects: under 200KV accelerating potential, adopts JEM-2100 (HR) to observe the pattern of sample and granularity.Directly the nanometer gold suspension prepared being dropped in covers on the copper mesh of ultrathin carbon films in advance, carries out evacuation after natural drying.The nanometer gold sample prepared is placed in JEM-2100 (HR) observe, derives granularity graph and analyze.
Fig. 4 A adopts ultraviolet-visible spectrophotometer to carry out nanometer gold full wavelength scanner, and display nanometer gold is before and after coupling miR-375 nucleic acid, and its characteristic absorption peak position is slightly to right red shift;
Fig. 4 B and 4C adopts transmission electron microscope to detect nanometer gold, finds that nanogold particle particle diameter and pattern before and after coupling there occurs slight change, confirms that nucleic acid is successfully coupled to nanometer gold surface.
Embodiment 3
MiR-375-Au NPs directly enters hepatoma carcinoma cell and significantly raises the detection of miR-375:
1) cell culture: hepatoma cell strain Huh7, Hep3B, HepG2 cell is placed in Dulbecco ' s modified Eagle medium (DMEM) culture medium of 10% hyclone, 37 DEG C, 5%CO
2and cultivate in the cell culture incubator of saturated humidity; When cell grows to about 90% fusion, abandon the old culture fluid in culture bottle, sterilizing PBS washs 1 time.The tryptic digestive juice adding 0.25% digests, and keeps flat culture bottle, at the bottom of Digestive system is paved with bottle.Observe under inverted microscope, find cell kytoplasm retraction, gap increase after, immediately inhale abandon Digestive system, add 6 ~ 8ml fresh containing 10% hyclone DMEM culture fluid stop digestion, repeatedly blow and beat attached cell along culture bottle edge, make it to form uniform single cell suspension.Draw a small amount of cell suspension point to count on cell counting count board, according to cell quantity, the ratio of cell suspension in 1 ︰ 2 or 1 ︰ 3 is inoculated in new culture bottle, be placed in cell culture incubator and continue to cultivate;
2) miR-375-Au NPs process: cell is inoculated in 6 holes the previous day by process, makes it the fusion reaching about 40% when processing.Complete blank group (completely blankcontrol group is set, be called for short Blank control), nanometer gold (Au NPs) processed group (as negative control group) and nanometer gold miR-375 conjugate (miR-375-Au NPs) processed group, often group arranges 3 multiple holes, process accordingly by setting, containing 10% hyclone DMEM culture fluid in add Au NPs or miR-375-Au NPs and make its final concentration be 50nM, hatch 48 hours altogether;
3) the cellular uptake situation of fluorescence microscope miR-375-Au NPs: miR-375-AuNPs hatches the cell after 48, PBS rinsing 3 times, 4', 6-diamidino-2-phenylindone (4', 6-diamidino-2-phenylindole, DAPI) every hole 200ul dyes 5 minutes, PBS post rinse three times, add 1ml PBS enters cell in culture plate situation in fluorescence microscopy Microscopic observation miR-375-AuNPs, with under the visual field, nucleus is dyed blue-fluorescence by DAPI, and miR-375-Au NPs presents red fluorescence owing to indicating fluorophor Cy3.
4) expression of miR-375 detects: the RNA extraction agent box MirVana processing latter 48 hours application enrichment miRNA
tMmiRNA Isolation Kit(purchased from American Ambion company) extracting RNA, adopt the method for TaqMan qRT-PCR to detect the change that miR-375-Au NPs raises miR-375 expression.The reagent of application has TaqMan MicroRNA Assayshsa-miR-375 (P/N:4373027), RUN6B (P/N:4373381), Reverse Transcriptase kit TaqMan MicroRNA Reverse Transcription Kit (P/N:4366597) and gene expression premix reagent TaqMan Gene Expression Master Mix (P/N:4369514), above reagent equal purchased from American Applied Biosystems, Inc. Applied Biosystems.
1. diluted sample: get primary sample RNA and add appropriate sterilizing 3dH
2o is 2ng/ μ L. to final concentration
2. reverse transcription (Reverse Transcription, RT) reaction system:
A. RT Master Mix is first joined
B. RT-primers(single tube 3 μ l is added);
C. after adding dilution, RNA SAMPLE, single tube 5 μ l(5 μ L is 10ng containing RNA amount), noticing that each miRNA wants specific reverse transcription, take RUN6B as internal reference;
D. reverse transcription reaction:
3. PCR: react orifice plate and blooming with optics 384, reaction system is 20 μ l.
A.cDNA dilutes: reverse transcription RT-15 μ l system adds sterilizing 3dH
2o100 μ l diluted for use.
B. reaction system: notice that each sample does three repetitions, each miRNA has specific reverse transcription, take RUN6B as internal reference;
4. PCR reaction condition:
5. data analysis: analyze real-time PCR data by 2-△ △ Ct method, and the comparison of applying that Student ' s t test carries out between each sample.
As shown in Figure 5: under the fluorescence visual field, the miR-375-Au NPs of Cy3 labelling is had to send red fluorescence in the hepatoma carcinoma cell entered, and be mainly distributed in Cytoplasm, nucleus is designated as blueness by DAPI, and each cell has efficiently entering of miR-375-Au NPs substantially.
As shown in Figure 6: miR-375-Au NPs can significantly improve the expression of miR-375 in hepatoma carcinoma cell.
Embodiment 4
The external inhibitory action to hepatoma carcinoma cell of miR-375-Au NPs:
1) hepatoma H22 cells cell culture is placed in Dulbecco ' smodified Eagle medium (DMEM) culture medium of 10% hyclone, 37 DEG C, 5% CO
2and cultivate in the cell culture incubator of saturated humidity; When cell grows to about 90% fusion, abandon the old culture fluid in culture bottle, sterilizing PBS washs 1 time.Add about 1.5ml containing 0.25% tryptic digestive juice digest, keep flat culture bottle, at the bottom of Digestive system is paved with bottle.Observe under inverted microscope, find cell kytoplasm retraction, gap increase after, immediately inhale abandon Digestive system, add 6 ~ 8ml fresh containing 10% hyclone DMEM culture fluid stop digestion, repeatedly blow and beat attached cell along culture bottle edge, make it to form uniform single cell suspension.Draw a small amount of cell suspension point to count on cell counting count board, according to cell quantity, the ratio of cell suspension in 1 ︰ 2 or 1 ︰ 3 is inoculated in new culture bottle, be placed in cell culture incubator and continue to cultivate;
2) HepG2 cell is inoculated in adhere-wall culture in 96 orifice plates with 5000 cells/well, next day processes, complete blank group (completely blank control group is set, be called for short Blank control), nanometer gold (Au NPs) processed group (as negative control group) and nanometer gold miR-375 conjugate (miR-375-Au NPs) processed group, often group arranges 6 multiple holes, process accordingly by setting, Au NPs or miR-375-Au NPs adds makes its final concentration be 100nM;
3) 96 orifice plate cells of correspondence are accurately changed a subculture (without phenol red) by after cell process 24 little time points, 48 little time points and 72 little time points, and the 100 every holes of μ l, separately add 3 holes and do acellular blank, to remove background.CellTiter
aQueous One SolutionReagent cell proliferation detecting kit puts 37 DEG C of incubation 10min makes it dissolve completely;
4) every hole adds 20 μ l CellTiter
aQueous One Solution Reagent;
5) 37 DEG C are placed in, 5%CO in 96 porocyte culture plate lucifuges
2and hatch 2 hours under the condition of saturated humidity;
6) in BIO-RAD680 Bole microplate reader, reading 490nm(630nm is reference wavelength) absorption value at place.The porose absorbance meansigma methods that deducts acellular blank be the correction absorbance in each hole.
7) average and calculate standard deviation for each group, making cell proliferation charts for finned heat.
As shown in Figure 7: miR-375-Au NPs is external has obvious inhibitory action to hepatoma carcinoma cell, show and preferably press down cancer effect.
Embodiment 5:
MiR-375-Au NPs is to the inhibitory action of hepatoma carcinoma cell transplanted tumor in nude mice:
1) HepG2 cell is suspended from the DMED culture medium of serum-free with 5 × 10
6individual cell/100 μ l/ amount inoculated with subcutaneous injections only in nude mice back to form hepatocellular carcinoma in nude mice model;
2) after 10 days, will become the mice of tumor to be divided into 3 groups at random, often organize 8.From the 10th day, intratumor injection process in every 4 days once, used vernier caliper measurement tumor size simultaneously, injected 7 times altogether.First group is complete blank group (completely blank control group is called for short Blank control), the PBS solution of every mouse intratumor injection 100 μ l at every turn.Second group is nanometer gold (Au NPs) processed group (as negative control group), and the Au NPs solution of every mouse intratumor injection 100 μ l at every turn, the amount of Au NPs is 1nmol.3rd group is nanometer gold miR-375 conjugate (miR-375-Au NPs) processed group, and the miR-375-Au NPs solution of every mouse intratumor injection 100 μ l at every turn, the amount of miR-375-Au NPs is 1nmol.
3) gross tumor volume (V) is long × wide according to formula V=(
2) × 0.5 calculates.Draw the growth curve of each group of transplanted tumor in nude mice according to the gross tumor volume size calculated and carry out statistics and compare.
Obvious inhibitory action is had to hepatoma carcinoma cell transplanted tumor in nude mice as shown in Figure 8 in miR-375-Au NPs body.
Other unspecified part is prior art.Although above-described embodiment is to invention has been detailed description; but it is only the present invention's part embodiment; instead of whole embodiment, people can also obtain other embodiments according to the present embodiment under without creative prerequisite, and these embodiments all belong to scope.
Claims (6)
1. a nanometer gold miR-375 conjugate, is characterized in that: this conjugate comprises nanogold particle and double chain nucleotide,
Described double chain nucleotide is the miR-375 that two chains all have the double-strand of 28 bases,
Or, to encode identical function double chain nucleotide 95 ~ 100% with the miR-375 sequence homology of double-strand;
Wherein, described double chain nucleotide all contains two loop-stem structures, and 5 ' end of antisense strand contains six carbon alkyl hydrosulfides, and with nanogold particle coupling; Positive-sense strand in described double chain nucleotide contains " UUUGUUCGUUCGGCUCGCGUGA " 22 base sequences;
The mol ratio of described nano gold spherical granule and described double chain nucleotide is 1: 1 ~ 40;
5 ' end of the positive-sense strand of described double chain nucleotide is also containing fluorophor Cy3.
2. nanometer gold miR-375 conjugate according to claim 1, is characterized in that: described nanogold particle is ball-type.
3. nanometer gold miR-375 conjugate according to claim 1 and 2, is characterized in that: the particle diameter of described nanogold particle is 10 ~ 60nm.
4. nanometer gold miR-375 conjugate according to claim 3, is characterized in that: the particle diameter of described nanogold particle is 10 ~ 20nm.
5. a preparation method for nanometer gold miR-375 conjugate according to claim 1, is characterized in that: comprise the following steps
1) the nanometer gold suspension that sodium citrate is stable is got, the centrifugal 10min process of 6000g, resuspended with 0.1%DEPC water; Be placed in stir process on room temperature magnetic stirring apparatus to spend the night, after 121 DEG C of high pressure steam sterilization 60min in 4 DEG C of refrigerators preserve, for subsequent use;
2) preparation of 0.1%DEPC: get in DEPC to the 500ml ultra-pure water of 0.446ml 1.12g/ml, is placed in ultrasonic cleaner supersound process 2h till without oily liquid pearl;
3) preparation of 10mM PBS: the KH accurately taking KCl, 0.2g of NaCl, 0.2g of 8g with analytical balance
2pO
4with the Na of 2.9g
2hPO
4.12H
2o, is dissolved in 100ml without in enzyme sterilized water, after ultrasonic abundant dissolving, is settled to 1L with without enzyme sterilized water;
4) 0.18MPBS preparation: according to PBS preparation program, first with the PBS without enzyme sterilized water preparation 0.2M, pH8.0, is more proportionally diluted to 0.18M;
5) the miR-375 nucleotide of also chemosynthesis double-strand is designed, wherein in positive antisense strand, unpaired base forms 2 special loop-stem structures, and connect Cy3 fluorophor at 5 ' end of its positive-sense strand, 5 ' end of its antisense strand connects six carbon alkyl hydrosulfides, and structure is as follows:
6) miR-375 nucleotide pretreatment: the miR-375 nucleotide getting 5nmole, is dissolved in 555.6ul ultra-pure water, point takes on 200 μ l, and masking foil parcel lucifuge is preserved in-80 DEG C of refrigerators, for subsequent use; A pipe 100mg OEG-Thiol is taken out from-20 DEG C of refrigerators, after redissolving on ice, carry out subpackage, namely to without adding 5.4 μ l stock solutions in enzyme PCR pipe respectively, carry out nitrogen and dry up protection, be settled to 45 μ l with fresh dehydrated alcohol time to be used, mixing is fully dissolved in after ethanol until it and joins in reactant liquor;
7) coupling: joined by RNA double-stranded complex in the nanometer gold suspension of the 10-25 times amount processed, the final concentration of nucleic acid is about 3 μMs, is placed on room temperature shaker and reacts 24h under concussion; Regulate pH to 7.0 ~ 8.0, salinity to 0.1M, be placed in 4 DEG C of refrigerators and continue reaction 40h, and ensuing every 12 hours increase a salinity 0.1M, final salinity is made to reach 0.3M, 24h after adding pretreated miR-375 nucleotide, add OEG-Thiol alcoholic solution, make its final concentration be 30 μm of ol/ml;
8) the centrifugal 20min of purification process: 8000g, 4 DEG C of centrifugal solutions, remove unnecessary reagent, Red oil precipitation washing liquid 0.3M PBS is resuspended, and centrifugal and resuspension process repeats 3 times, obtains nanometer gold miR-375 conjugate, end, 0.3M PBS was resuspended, in 4 DEG C preserve, for subsequent use.
6. the conjugate in Claims 1 to 4 described in any one is for the preparation of the application in the medicine of Therapeutic cancer, and cancer wherein comprises hepatocarcinoma, gastric cancer, the esophageal carcinoma, cancer of pancreas or colon cancer.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410056298.8A CN103768617B (en) | 2014-02-19 | 2014-02-19 | Nanometer gold miR-375 conjugate and its preparation method and application |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201410056298.8A CN103768617B (en) | 2014-02-19 | 2014-02-19 | Nanometer gold miR-375 conjugate and its preparation method and application |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103768617A CN103768617A (en) | 2014-05-07 |
CN103768617B true CN103768617B (en) | 2015-10-21 |
Family
ID=50561674
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201410056298.8A Active CN103768617B (en) | 2014-02-19 | 2014-02-19 | Nanometer gold miR-375 conjugate and its preparation method and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103768617B (en) |
Families Citing this family (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2017064685A1 (en) * | 2015-10-15 | 2017-04-20 | Centro De Neurociencias E Biologia Celular | A composition for controlled release of a biomolecule, method of preparation and uses thereof |
WO2021184006A1 (en) * | 2020-03-13 | 2021-09-16 | Duke University | Compositions for the treatment of nash and associated disorders and methods of using same |
CN111529713B (en) * | 2020-05-11 | 2021-10-22 | 山东大学 | AuNPs/miR-140 compound and preparation method and application thereof |
CN113181374B (en) * | 2021-05-08 | 2022-05-13 | 中南大学 | Spherical microRNA and preparation method and application thereof |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101423869A (en) * | 2008-12-18 | 2009-05-06 | 浙江大学 | Biomarker for detection and application |
-
2014
- 2014-02-19 CN CN201410056298.8A patent/CN103768617B/en active Active
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN101423869A (en) * | 2008-12-18 | 2009-05-06 | 浙江大学 | Biomarker for detection and application |
Non-Patent Citations (2)
Title |
---|
《A gold nanoparticle platform for the delivery of functional microRNAs into cancer cells》;Rajib Ghosh et al.;《A gold nanoparticle platform for the delivery of functional microRNAs into cancer cells》;20121027;807页右栏 * |
《miR-375在消化系肿瘤中的研究进展》;颜俊伟等;《miR-375在消化系肿瘤中的研究进展》;20140218;第22卷(第5期);摘要,655页右栏 * |
Also Published As
Publication number | Publication date |
---|---|
CN103768617A (en) | 2014-05-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN103768617B (en) | Nanometer gold miR-375 conjugate and its preparation method and application | |
CN107881218B (en) | Spherical nucleic acid fluorescent probe for detecting telomerase activity and preparation method and application thereof | |
CN105524924B (en) | Cyclic RNA circ-ZKSCAN1 use | |
CN104017868B (en) | SETD4 is the purposes in preparation treatment pancreatic cancer drug in the purposes prepared in diagnosis of pancreatic cancer and/or prognosis kit and SETD4 blocker | |
CN104383559B (en) | The expression vector of long-chain non-coding RNA LOC401317, tumor suppression reagent and application thereof | |
CN105018498A (en) | Application method of lnc RNA (long-chain non-coding ribonucleic acid) AFAP1-AS1 | |
CN107805663A (en) | Application of the Lnc03729 genes as biomarker in the pre- diagnostic reagent of adenocarcinoma of lung | |
CN104818334A (en) | Tiny RNA related to lung adenocarcinoma metastasis | |
CN110423819A (en) | A kind of participation Human colorectal carcinoma proliferation and drug resistant lncRNA and its application | |
CN109468382A (en) | Application of the lncRNA in adenocarcinoma of lung diagnosis and treatment | |
CN108753770B (en) | Gene nanoprobe for targeted lung cancer treatment and preparation method and application thereof | |
CN104774925B (en) | Application of the BRCA2 3 ' non-translational regions in diagnosing tumor, treatment and prognostic agent is prepared | |
CN110229901A (en) | Gene hsa_circ_0027089 relevant to triple negative breast cancer diagnosis and treatment and its application | |
CN103800917B (en) | Nanometer gold miR-885-5p conjugate and its preparation method and application | |
CN109880902A (en) | A kind of application of long-chain non-coding RP11-499F3.2 in head and neck cancer clinical detection and the treatment of reversing tumor Cetuximab drug resistance | |
CN108486104A (en) | Targeting fluorescent probe and the application of cancer cell are detected based on DNA- silver nanoclusters | |
Li et al. | Detection of nano Eu2O3 in cells and study of its biological effects | |
CN108743521B (en) | RNA nano hydrogel for targeted therapy of lung cancer and preparation method and application thereof | |
CN101457224A (en) | MiR-21 antisense digonucleotides and use thereof | |
CN110229900A (en) | Gene hsa_circ_0103520 relevant to breast cancer diagnosis and treatment and its application | |
CN114457161B (en) | Application of lncRNA AC145207.5 in colorectal cancer diagnosis, treatment and drug sensitivity improvement | |
Chen et al. | Cytidine mediated AuAg nanoclusters as bright fluorescent probe for tumor imaging in vivo | |
CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
CN101445534A (en) | Use of high efficiency siRNA for preparing tumor migration inhibition drug | |
CN114948984A (en) | Application of PIM1siRNA in preparation of medicine for treating arsenic-induced cell malignant transformation disease |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant |