CN107881218B - Spherical nucleic acid fluorescent probe for detecting telomerase activity and preparation method and application thereof - Google Patents
Spherical nucleic acid fluorescent probe for detecting telomerase activity and preparation method and application thereof Download PDFInfo
- Publication number
- CN107881218B CN107881218B CN201711178896.2A CN201711178896A CN107881218B CN 107881218 B CN107881218 B CN 107881218B CN 201711178896 A CN201711178896 A CN 201711178896A CN 107881218 B CN107881218 B CN 107881218B
- Authority
- CN
- China
- Prior art keywords
- chain
- nucleic acid
- cells
- spherical nucleic
- fluorescent probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/48—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase
- C12Q1/485—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving transferase involving kinase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6811—Selection methods for production or design of target specific oligonucleotides or binding molecules
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/90—Enzymes; Proenzymes
- G01N2333/91—Transferases (2.)
- G01N2333/912—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- G01N2333/91205—Phosphotransferases in general
- G01N2333/91245—Nucleotidyltransferases (2.7.7)
- G01N2333/9125—Nucleotidyltransferases (2.7.7) with a definite EC number (2.7.7.-)
- G01N2333/9128—RNA-directed DNA polymerases, e.g. RT (2.7.7.49)
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention discloses a spherical nucleic acid fluorescent probe for detecting telomerase activity, a preparation method and application thereof, wherein the spherical nucleic acid fluorescent probe takes gold nanoparticles as a carrier, and hybrid double-stranded DNA is loaded on the surface of the carrier; one DNA single strand in the hybrid double-stranded DNA is a TP-chain long chain, and the TP-chain long chain is sequentially provided with a telomerase primer TP, a sequence complementary with a telomerase amplification sequence and an auxiliary sequence from the 3' end; and the other DNA single strand in the hybrid double-stranded DNA is a fluorescent dye modified FL-chain which is complementary with the TP-chain long strand. The spherical nucleic acid fluorescent probe overcomes the heterogeneity of tumor cells, realizes the universal detection of tumors on the molecular level, and can realize the cross-platform detection of tumors from molecules, cells and tissues to living bodies and the visual navigation of tumor operations.
Description
Technical Field
The invention relates to a spherical nucleic acid fluorescent probe for detecting telomerase activity, a preparation method and application thereof, and belongs to the field of analysis and detection and medical diagnosis.
Background
Cancer is a disease with a high incidence and mortality, the common denominator of which is uncontrolled cell growth. Accurately distinguishing tumor cells from normal cells in vivo is of great significance for early diagnosis, treatment and prognosis evaluation of cancer, but remains a long-standing problem. Currently, a range of methods such as single cell sequencing, molecular imaging, mass spectrometry and tissue immunochemistry have been used to help address this difficulty. However, due to the heterogeneity of tumor cells and the lack of universal tumor markers, even tumors of the same type may have several to several dozen genotypes and phenotypes, and thus, these methods are not only costly but also less accurate. On the other hand, these methods lack versatility and cannot achieve cross-platform tumor detection from molecules, cells, tissues to living bodies.
Based on the common uncontrolled growth of tumor cells, a universal method for distinguishing tumor cells from normal cells is provided, so that the limitation of tumor cell heterogeneity is overcome, and almost all normal cells and tumor cells are accurately distinguished. Uncontrolled growth of cells requires activated telomerase to catalyze. Telomerase is a reverse transcriptase that adds a telomere repeat sequence (TTAGGG) six bases in length to the end of the telomere via its own RNA template. Telomeres are a special structure at the ends of chromosomes, and can protect chromosomes from degradation, rearrangement and end fusion, thereby ensuring the integrity of genomes. In normal cells, the length of telomeres is continuously shortened as the cells divide, resulting in senescence and apoptosis of the cells. However, in tumor cells, telomeric repeats are recruited to the end of the telomere as telomerase is activated, and their length is maintained, resulting in uncontrolled growth of tumor cells. Telomerase activity is also often highly expressed in rapidly dividing cells such as germ cells and embryonic cells. Therefore, telomerase is regarded as a valuable universal tumor marker, and detection of telomerase activity is of great significance for diagnosis, treatment and prognosis evaluation of tumors. Since the discovery of telomerase, a large number of methods for detecting telomerase activity have been proposed, and although the classical Polymerase Chain Reaction (PCR) -based telomere repeat amplification method (TRAP) has high sensitivity and detection limit, the detection of telomerase activity using cell lysates not only fails to provide direct information on telomerase activity in living cells, but also limits the application range.
Disclosure of Invention
The invention aims to provide a spherical nucleic acid fluorescent probe for detecting telomerase activity, a preparation method and application thereof. The technical problem to be solved is to realize the accurate distinction of tumor cells and normal cells by screening out a proper probe structure through molecular design.
The spherical nucleic acid is a nanoparticle which takes gold nanoparticles (AuNPs) as an inner core and loads a large number of high-density DNA chains on the surface, and has wide application prospect in disease diagnosis, drug delivery and gene therapy. The traditional transfection reagents such as liposome, artificially modified virus and the like have the problems of high toxicity, low transfection efficiency and the like, and spherical nucleic acid has high cellular uptake rate and transfection efficiency without the help of any transfection reagent and can also protect DNA from degradation by nuclease in cells. Gold nanoparticles serve as good substrates for immobilizing DNA, and DNA can be attached to the surface via gold-thiol covalent bonds, so AuNPs are particularly suitable as carriers for entry into cells.
The spherical nucleic acid fluorescent probe is of a telomerase sensitive fluorescent 'off-on' structure, and can emit light only under the action of telomerase, so that the detection of the telomerase activity is realized. The spherical nucleic acid fluorescent probe has simple preparation method and lower cost, and can be used for telomerase activity analysis in various tumor cell lysates, live cell imaging (distinguishing tumor cells from normal cells), flow cytometry detection of circulating tumor cells, identification of various tumor tissue slices, living tumor fluorescence imaging and visual navigation of tumor resection operation.
The spherical nucleic acid fluorescent probe for detecting the telomerase activity takes gold nanoparticles (AuNPs) as a carrier, and hybrid double-stranded DNA is loaded on the surface of the carrier. The range of the loading capacity of the probe for effective detection is more than or equal to 60 double-stranded DNAs.
One DNA single strand in the hybrid double-stranded DNA is a TP-chain, and the TP-chain is sequentially provided with a Telomerase Primer (TP) (known and unique and with the sequence: AATCCGTCGAGCAGAGTT) and a telomerase amplification sequence from the 3' endSequence complementary to the sequence and auxiliary sequence (R)1And R2) (ii) a The other DNA single strand in the hybrid double-stranded DNA is a fluorescent dye modified FL-chain short strand which is complementary with the TP-chain long strand, the number of complementary bases is consistent with that of the FL-chain short strand, and the number of bases ranges from 10 to 18.
The base sequence of the TP-chain long chain is as follows: 5' -HS-R1R2(CCCTAA)mAATCCGTCGAGCAGAGTT-3′；
Wherein: r1The number of bases of (2) is 3, 4, 5, 6, 7, 8, 9 or 10, and the sequence is any combination of adenine base (A), guanine base (G), thymine base (T), cytosine base (C) and uracil base (U).
R2The number of bases of (3) is 4, 5, 6, 7 or 8, and the sequence thereof is any combination of A, G, T, C and U.
(CCCTAA)mWherein m has a value of 3, 4 or 5.
The FL-chain short chain base sequence is as follows: 3' -R3R4-5′；
Wherein: r3Is a reaction with R2A complementary base sequence; r4Is a long chain medium (CCCTAA) with TP-chain with 6, 7, 8, 9 or 10 basesmComplementary base sequences, the number of complementary bases being at least six. R4Is less than the base number m in the long chain of TP-chain (CCCTAA), and is not uniform.
The 3' end of the FL-chain is modified with fluorescent dye, and the structure of the fluorescent dye comprises Cy3, Cy5, Cy5.5, FAM, FITC, TAMRA or Texas Red.
The hybrid double-stranded DNA is connected to the surface of the gold nano-particle through an Au-S bond to form the high-density loaded spherical nucleic acid fluorescent probe.
The particle size of the gold nanoparticles is 10-100 nm.
The preparation method of the spherical nucleic acid fluorescent probe for detecting the telomerase activity comprises the following steps:
1. preparation of gold nanoparticles
The synthesis of the gold nanoparticles adopts a method of reducing chloroauric acid by sodium citrate. Heating 100mL of aqueous solution containing 0.01wt% of chloroauric acid to boiling, rapidly adding 1-5mL of 1wt% sodium citrate solution under the condition of vigorous stirring, continuously heating, refluxing and stirring for 10-20 minutes, stopping stirring, naturally cooling to room temperature to obtain gold nanoparticle solution, and storing in a refrigerator at 4 ℃ for later use.
2. Preparation of spherical nucleic acid fluorescent probe
The ratio of the long TP-chain to the short FL-chain is 1: 1, heating to 90 ℃ for 5 minutes, and then naturally cooling to room temperature to obtain hybrid double-stranded DNA; adding the hybridized double-stranded DNA into the gold nanoparticle solution prepared in the step 1 according to the molar ratio of 200-300:1, oscillating at room temperature for 16h, then gradually adding PBS buffer solution and sodium chloride (2M) to enable the final concentration of phosphate in the reaction solution to reach 0.01M and the final concentration of sodium chloride to reach 0.2M, then centrifuging (13,000 revolutions for 20 minutes) and washing with the PBS buffer solution to remove the unconnected double-stranded DNA, then re-dispersing in the PBS buffer solution to obtain the spherical nucleic acid fluorescent probe, and storing at 4 ℃ for later use.
The phosphate concentration in the PBS buffer was 0.1M, pH 7.4.
The invention relates to an application of a spherical nucleic acid fluorescent probe for detecting telomerase activity, which is an application of the spherical nucleic acid fluorescent probe as a detection reagent when detecting the telomerase activity in living cells, thereby realizing the differentiation of all tumor cells and normal cells. For example, the detection and tracking of circulating tumor cells in the blood of cancer patients can be realized by detecting fluorescent signals through a flow cytometer. Can also be used for the fluorescence detection of the telomerase activity in tissue lysate and cell lysate.
The working principle of the spherical nucleic acid fluorescent probe is as follows:
the spherical nucleic acid probe takes AuNPs as a carrier, and a large amount of specially designed hybrid double-stranded DNA is loaded on the surface of each AuNPs to form a compact nucleic acid sphere. The long chain of TP-chain contains four functional regions which are connected with each other: (1) the 3' end is a telomerase primer sequence with 18 basic groups, which can specifically recognize telomerase and extend TTAGGG telomere repetitive sequences under the action of the telomerase; (2) several amplified sequences with telomereComplementary repetitive sequence (CCCTAA)m(ii) a (3) Sequences that pair with FL-chain moieties; (4) a spacer sequence for reserving space for the fluorescent dye, wherein the 5' end sulfhydryl can be covalently connected with AuNPs. The FL-chain is a DNA chain which is complementarily paired with the TP-chain long-chain part, and the 3' end of the FL-chain is modified with a fluorescent luminophore. The hybridized double-stranded DNA is modified to the surface of AuNPs through gold sulfhydryl bonds, fluorescent dye is close to the AuNPs, fluorescence is quenched, and the fluorescence state is off. Under the condition that telomerase exists, the TP-chain long chain is catalyzed and prolonged, when the TP-chain long chain is prolonged to a certain length, a more stable hairpin structure is formed, the FL-chain short chain is replaced and released into a solution or a cell plasma medium, the fluorescence is recovered, and the detection of the telomerase activity and the biological imaging are realized through a fluorescence signal. The invention can realize the cross-platform detection of tumors from molecules, cells and tissues to living bodies and the visual navigation of tumor operations.
Compared with the existing telomerase activity detection method, the method has the following advantages:
1. the surface of the spherical nucleic acid probe is loaded with high-density DNA chains to form a compact nucleic acid sphere which is easy to be taken by cells, and the use of transfection reagents such as liposome and the like is avoided.
2. The surface of the probe is loaded with a large number of DNA chains with charges, so that the agglomeration of AuNPs can be prevented, the stability of the AuNPs is improved, and the application range of the probe is enlarged.
3. The probe provided by the invention makes full use of the stability of the gold-sulfhydryl covalent bond and the protection effect of AuNPs on a DNA chain, so that the probe can stably exist in different media and is not influenced by nuclease in cells.
4. The telomerase primer chain can be extended under the action of telomerase to form a hairpin structure, the DNA chain modified by the fluorescent dye is replaced and released into a solution, and the replaced fluorescent DNA chain is in a free state and is not influenced by gold nanoparticles, so that a high-quality imaging effect can be obtained.
5. The probe provided by the invention is simple and convenient in preparation method, low in cytotoxicity and weak in background fluorescence, can be used for photographing and imaging without washing after being directly cultured with cells, and realizes fluorescence imaging and detection of telomerase activity in the cells. The method does not need cell lysis and other pretreatment steps, and has obvious advantages compared with other methods.
6. Based on the characteristic that AuNPs are easy to modify DNA, the prepared spherical nucleic acid nano probe is loaded with a large number of DNA chains specifically identified by telomerase on the surface, so that the using amount of the probe is reduced, the efficiency of detecting the activity of the telomerase is improved, and the cross-platform detection of tumors from molecules, cells and tissues to living bodies is realized.
Drawings
Fig. 1 is a schematic diagram of the principle of the present invention.
FIG. 2 is a transmission electron microscope photograph (a) of gold nanoparticles, and an ultraviolet absorption spectrum photograph (b) of gold nanoparticles and spherical nucleic acid probe.
FIG. 3 is the calculation of the number of DNA strands modified on the surface of gold nanoparticles: the working mechanism (a) of the mercaptoethanol substituted fluorescent DNA chain on the surface of the gold nano-particle, the concentration (b) of the fluorescent DNA chain calculated by a standard working curve and the fluorescence spectrogram (c) of the supernatant containing the fluorescent DNA chain.
FIG. 4 is a calculation of probe concentration.
FIG. 5 is a fluorescence spectrum of a probe incubated with telomerase at different dosages, with the corresponding fluorescence photograph (a, left), the linear relationship between the fold of fluorescence recovery and telomerase (a, right), and the linear relationship between the lysate containing different numbers of HeLa cells and the probe incubated with the corresponding fluorescence photograph (b, left), the fold of fluorescence recovery and the number of HeLa cells (b, right).
FIG. 6 is a comparison of telomerase activity in lysates of ten tumor cells and five normal cells.
FIG. 7 is a fluorescent picture of HeLa cells over time after addition of probes.
FIG. 8 is a fluorescent picture of HeLa cells after addition of different doses of probe.
FIG. 9 is a fluorescent photograph of HeLa cells treated with different doses of telomerase inhibitor and added with probes.
FIG. 10 is a comparison of telomerase activity between different tumor cell lines.
FIG. 11 is a flow chart of MRC-5(a) and HeLa (b) cells after addition of probes, respectively.
FIG. 12 is a flow chart of the mixed detection of MRC-5 and HeLa cells in different proportions after the probe is added to the cells respectively for culture: MRC-5: HeLa 999:1(a) and MRC-5: HeLa 9999:1 (b).
FIG. 13 shows the results of examination (a) of 5 tumor cells in one drop of blood and (b) of 10 tumor cells in one drop of blood, which were used to label tumor cells in human peripheral blood.
Fig. 14 is a fluorescent picture of mice over time after injection of probes at tumor sites in tumor model mice.
FIG. 15 is a fluorescence image of tumor tissue sections.
Fig. 16 is a photograph showing the visual detection of a living tumor.
FIG. 17 is a photograph of the fluorescence of HeLa cells after addition of Cy5 dye modified probe.
FIG. 18 is a photograph of the fluorescence of HeLa cells after addition of FITC dye modified probes.
Fig. 19 is a photograph of HeLa cell fluorescence after addition of FAM dye modified probes.
Detailed Description
The following examples are further illustrative of the present invention as to the technical content of the present invention, but the essence of the present invention is not limited to the following examples, and one of ordinary skill in the art can and should understand that any simple transformation or replacement based on the essence of the present invention should fall into the protection scope of the present invention.
Example 1:
1. preparation of gold nanoparticles
The synthesis of the gold nanoparticles adopts a method of reducing chloroauric acid by sodium citrate. Heating 100mL of aqueous solution containing 0.01wt% of chloroauric acid to boiling, rapidly adding 3.5mL of 1wt% sodium citrate solution under the condition of vigorous stirring, continuously heating, refluxing and stirring for 10 minutes, stopping stirring, naturally cooling to room temperature to obtain gold nanoparticle solution (the appearance is shown in figure 2a), and storing in a refrigerator at 4 ℃ for later use.
2. Preparation of spherical nucleic acid fluorescent probes
The TP-chain and the Cy5 dye-modified FL-chain were modified according to the following ratio of 1: 1, heating to 90 ℃ for 5 minutes, and then naturally cooling to room temperature to obtain hybrid double-stranded DNA; adding the hybrid double-stranded DNA into the gold nanoparticle solution prepared in the step 1 according to a molar ratio of 300:1, oscillating for 16h at room temperature, then gradually adding PBS buffer solution and sodium chloride (2M) to enable the final concentration of phosphate in the reaction solution to reach 0.01M and the final concentration of sodium chloride to reach 0.2M, and gradually adding the hybrid double-stranded DNA in the step to enable the electrolyte concentration of the solution to gradually and slowly increase, so that the number of double-stranded DNA modified on the surface of the gold nanoparticle can be increased, and the stability of the spherical nucleic acid probe can be improved; then, the double-stranded DNA not ligated was removed by centrifugation (13,000 rpm, 20 minutes) and washed with PBS buffer, and then redispersed in PBS buffer to obtain a spherical nucleic acid fluorescent probe (UV absorption spectrum shown in FIG. 2b), which was stored at 4 ℃ until use.
The phosphate concentration in the PBS buffer was 0.1M, pH 7.4.
3. Calculation of the number of DNA strands modified on the surface of gold nanoparticles
Referring to FIG. 3, mercaptoethanol (10mM) was added to the probe solution at high concentration and shaken overnight at room temperature, FL-chain was replaced with mercaptoethanol, dissociated from the AuNPs surface and released into the solution, and fluorescence was recovered. After the AuNPs are removed by centrifugation of the above solution, the fluorescence of the supernatant is measured with a fluorescence spectrophotometer. A standard curve is made by the known fluorescence intensity of the DNA chain modified by the dye, and the average number of the DNA strips modified on the surface of each gold nano particle is about 70 through calculation.
4. Calculation of Probe concentration
Referring to fig. 4, after the probe was diluted 3 times with PBS buffer, its uv absorption spectrum was measured with a uv spectrophotometer to obtain the intensity value of absorbance. According to lambert beer's law: a ═ ε bc, where A is the absorbance of the solution and ε is the extinction coefficient of AuNPs (ε)524＝2.7×108Lmol-1cm-1) B is a ratioThickness of the cuvette (1cm), c is the concentration of the solution. The original probe concentration was calculated to be 6 nM.
5. Preparation of cell lysate
The preparation of the cell lysate comprises the following specific operation steps: after the cells are fully paved on the bottom of the culture dish, removing the culture medium in the cell culture dish, washing twice by using cold PBS buffer solution, digesting the cells by using trypsin to ensure that adherent cells fall off from the bottom of the culture dish, then adding new cell culture medium, and blowing and beating the bottom of the culture bottle by using a pipette to ensure that the adherent cells fall off completely. The cells were collected into DEPC water-treated centrifuge tubes, centrifuged at 4 deg.C (1,200 rpm, 4 minutes) and the supernatant carefully discarded, taking care not to remove the underlying cells, and then lysis buffer (10mM Tris-HCl, 1% NP-40,0.25mM sodium deoxyholate, 10% glycerol,150mM NaCl,0.1mM AEBSF, pH 8.0) was added. Shaking at 4 deg.C for 30 min to completely lyse cells, centrifuging (11,000 rpm, 20 min), collecting supernatant, transferring to DEPC water-treated centrifuge tube, packaging the obtained solution, and storing in-80 deg.C refrigerator with cell lysate concentration of 107Individual cells/mL.
6. Detection of telomerase activity of different cell lines by spherical nucleic acid probe
In conjunction with FIG. 5, varying amounts of telomerase were added to a mixture containing 50. mu.L of probe (6nM), 20. mu.L of 10 XTAP reaction buffer and 4. mu.L of 10mM dNTPs (adjusted to a total volume of 200. mu.L with DEPC water) and incubated at 37 ℃ for 2 h. Under the action of telomerase, FL-chain is replaced, fluorescence is recovered, a fluorescence spectrophotometer is used for fluorescence determination, the fluorescence intensity and the telomerase concentration are in a linear relation at low concentration, and finally a platform can be reached. In addition, under a 633nm laser, the step change of the solution color can be seen, the visual detection is realized, and the visual photo is shown in an inset of fig. 5. The telomerase activity of different cells is detected by using spherical nucleic acid probes, and five normal cells, namely human cervical cancer cells (HeLa), human embryonic kidney cells (293T), human lung cancer cells (A549), human breast cancer cells (MCF-7), human oral epithelial cancer cells (KB), human bladder cancer cells (5637), human gastric cancer cells (N87), human pancreatic cancer cells (BXPC-3), human ovarian cancer cells (NIH: OVCAR-3), human liver cancer cells (Hep G2), ten tumor cells and human lung cells (MRC-5), human lung embryo fibroblasts (HFL1), human liver cells (QSG-7701), human breast cells (MCF10A) and human foreskin fibroblasts (HFF-1), are selected. The probe is respectively incubated with different cell lysates and then the fluorescence intensity is measured, the fluorescence intensity value of the tumor cell lysate is obviously stronger than that of the normal cell lysate (figure 6), which shows that the telomerase activity in the tumor cells is high expression.
Example 2: detection of telomerase Activity within cells
With reference to FIGS. 7-10, intracellular telomerase activity was imaged using spherical nucleic acid probes. HeLa cells were used as a basic model and cultured in a confocal culture dish for 24 hours. 50 μ L of probe (6nM) was then added to the petri dish and incubated for 2h, and imaged using a confocal laser fluorescence microscope. In telomerase positive HeLa cells, FL-chain was replaced and fluorescence recovered, so fluorescence signals in the cytoplasm were visible on confocal microscopy images. The telomerase inhibitor 3' -azidothymidine and HeLa cells are co-cultured for 48h, then 50 mu L of probe is added and cultured for 2h, and the fluorescence signal in the cells is obviously reduced by the observation of a laser confocal fluorescence microscope, which indicates that the telomerase activity in the cells is inhibited by the telomerase inhibitor (figure 9). The probes were incubated with different tumor cells (HeLa,293T, A549, MCF-7,5637, N87, BXPC-3, NIH: OVCAR-3, Hep G2 and KB) respectively and then fluorescence detection was performed, and the fluorescence intensities in different tumor cells were clearly different, indicating that telomerase activities in different tumor cells were different (FIG. 10).
Example 3: marking of tumor cells in human peripheral blood
Referring to FIGS. 11-13, tumor cells HeLa and normal cells MRC-5 were plated in a petri dish for 24 hours, and 50. mu.L (6nM) of the cells were added and cultured for 2 hours. HeLa and MRC-5 cells with different proportions are mixed and then detected by a flow cytometer to obtain fluorescent signals, and the tumor cells and normal cells doped with different proportions can be well distinguished (figures 11 and 12). On this basis, HeLa cells were seeded in 20mm dishes for 24 h. Then 50. mu.L of the probe was added to the dish and incubated for 2h, after which the cells were trypsinized and resuspended in 1ml PBS buffer. The 5 cells were taken out and mixed in 50. mu.L of human peripheral blood from which erythrocytes were removed, and the cells were collected by a flow cytometer and signals were detected, whereby the 5 cells mixed in the peripheral blood could be detected, and 9 cells could be detected in an experiment in which 10 cells were mixed (FIG. 13), indicating that the probe could be labeled to trace tumor cells in the human peripheral blood.
Example 4: in vivo imaging
1. Construction of a mouse model of tumor
4-week old athymic immunodeficient mice were housed in a pathogen-free animal house. Taking HeLa cells as a model, suspending 100 ten thousand cells in 100 mu LPBS, mixing the cells with 100 mu L matrigel, injecting the mixture into subcutaneous parts under armpits of an immunodeficiency mouse, and continuously feeding for about 4 weeks to obtain a cervical cancer tumor model mouse.
2. In vivo imaging
Referring to fig. 14, the tumor site of the mouse and the corresponding tumor-free site on the other side were directly injected with 100 μ L of probes, respectively, and the mouse was anesthetized and imaged by a small animal imaging system. Under the action of telomerase at the tumor part, the fluorescence chain is replaced, and the fluorescence is recovered, so that a fluorescence signal can be observed at the tumor part; the non-tumor sites did not detect a fluorescent signal due to the absence of telomerase.
Example 5: tumor tissue section imaging
1. Construction of a mouse model of tumor
The tumor mouse constructing method in this embodiment is the same as that in embodiment 4.
2. Tumor tissue section imaging
Referring to FIG. 15, the tumor model mice after the injection of the probe were euthanized, and the tumors were removed, fixed with 4% formaldehyde solution for 24 hours, and then 5 μm-thick tissue sections were prepared using a cryomicrotome. Soaking the section in xylene for 15 min, dripping the blocking tablet on the tissue of the glass slide, taking the cover glass to cover the glass slide from one end gradually to avoid air bubbles and obtain the tumor tissue section. The slice is imaged by using a laser confocal fluorescence microscope, so that a fluorescence signal in a tumor tissue cell can be observed, and the high expression of the telomerase activity of the tumor tissue is shown.
Example 6: visual detection of tumors
1. Construction of a mouse model of tumor
The tumor mouse constructing method in this embodiment is the same as that in embodiment 4.
2. Visual detection of tumors
Referring to fig. 16, the tumor site of the rat is directly injected with 100 μ L of probe, after 4h, the rat is killed and the epidermis is peeled off, irradiated by a 633nm laser, directly observed by naked eyes through a 650nm optical filter and imaged by a camera, and the rat can be used as a visual operation navigation in a clinical tumor resection operation.
Example 7: detection of telomerase activity in cells by probes modified by different dyes
1. Preparation of gold nanoparticles
The preparation method of gold nanoparticles in this example is the same as that of example 1.
2. Preparation of spherical nucleic acid fluorescent probes
Long TP-chain and FL-chain modified with different dyes (Cy5, FITC or FAM) were measured according to the following 1: 1, heating to 90 ℃ for 5 minutes, and then naturally cooling to room temperature to obtain hybrid double-stranded DNA; adding the hybrid double-stranded DNA into the gold nanoparticle solution prepared in the step 1 according to a molar ratio of 300:1, oscillating for 16h at room temperature, then gradually adding PBS buffer solution and sodium chloride (2M) to enable the final concentration of phosphate in the reaction solution to reach 0.01M and the final concentration of sodium chloride to reach 0.2M, and gradually adding the hybrid double-stranded DNA in the step to enable the electrolyte concentration of the solution to gradually and slowly increase, so that the number of double-stranded DNA modified on the surface of the gold nanoparticle can be increased, and the stability of the spherical nucleic acid probe can be improved; then, the double-stranded DNA not ligated was removed by centrifugation (13,000 rpm, 20 minutes) and washed with PBS buffer, and then redispersed in PBS buffer to obtain spherical nucleic acid fluorescent probes, which were stored at 4 ℃ until use.
The phosphate concentration in the PBS buffer was 0.1M, pH 7.4.
3. Detection of telomerase Activity within cells
With reference to FIGS. 17-19, intracellular telomerase activity was imaged using spherical nucleic acid probes modified with different dyes. HeLa cells were used as a basic model and cultured in a confocal culture dish for 24 hours. Then the probes are respectively added into a culture dish and cultured for 2h, and imaging is carried out by utilizing a laser confocal fluorescence microscope. Probes modified by different dyes have good imaging effect.
Claims (6)
1. A spherical nucleic acid fluorescent probe for detecting telomerase activity, which is characterized in that: the spherical nucleic acid fluorescent probe takes gold nanoparticles as a carrier, and hybrid double-stranded DNA is loaded on the surface of the carrier;
one DNA single strand in the hybrid double-stranded DNA is a TP-chain long chain, and the TP-chain long chain is sequentially provided with a telomerase primer TP, a sequence complementary with a telomerase amplification sequence and an auxiliary sequence from the 3' end; the other DNA single strand in the hybrid double-stranded DNA is a fluorescent dye modified FL-chain complementary with the TP-chain long strand; the long chain of TP-chain is TTTTTGCAGCCCCTAACCCTAACCCTAAAATCCGTCGAGCAGAGTT; the FL-chain is CGTCGGGGATTG; the hybrid double-stranded DNA is connected to the surface of the gold nanoparticle through an Au-S bond.
2. The spherical nucleic acid fluorescent probe according to claim 1, characterized in that:
the 3' end of the FL-chain is modified with a fluorescent dye, and the structure of the fluorescent dye comprises Cy3, Cy5, Cy5.5, FAM, FITC, TAMRA or Texas Red.
3. The spherical nucleic acid fluorescent probe according to claim 1, characterized in that:
the particle size of the gold nanoparticles is 10-100 nm.
4. The spherical nucleic acid fluorescent probe according to claim 1, characterized in that:
the range of the loading capacity of the probe for effective detection is more than or equal to 60 double-stranded DNAs.
5. The method for preparing the spherical nucleic acid fluorescent probe for detecting telomerase activity, according to claim 1, which comprises the following steps:
step 1: preparation of gold nanoparticles
Heating 100mL of aqueous solution containing 0.01wt% of chloroauric acid to boil, adding 1-5mL of 1wt% sodium citrate solution while stirring, continuously heating, refluxing and stirring for 10-20 minutes, stopping stirring, and naturally cooling to room temperature to obtain a gold nanoparticle solution;
step 2: preparation of spherical nucleic acid fluorescent probe
The ratio of the long TP-chain to the short FL-chain is 1: 1, heating to 90 ℃ for 5 minutes, and then naturally cooling to room temperature to obtain hybrid double-stranded DNA; adding the hybridized double-stranded DNA into the gold nanoparticle solution prepared in the step 1 according to the molar ratio of 200-300:1, oscillating for 16h at room temperature, then gradually adding PBS buffer solution and sodium chloride to enable the final concentration of phosphate in the reaction solution to reach 0.01M and the final concentration of sodium chloride to reach 0.2M, then centrifuging, washing with the PBS buffer solution to remove the unconnected double-stranded DNA, and then re-dispersing in the PBS buffer solution to obtain the spherical nucleic acid fluorescent probe.
6. Use of the spherical nucleic acid fluorescent probe for telomerase activity detection according to claim 1, characterized in that: the spherical nucleic acid fluorescent probe is applied to the preparation of a detection reagent for detecting the telomerase activity of living cells, so that the differentiation of all tumor cells and normal cells is realized.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711178896.2A CN107881218B (en) | 2017-11-23 | 2017-11-23 | Spherical nucleic acid fluorescent probe for detecting telomerase activity and preparation method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711178896.2A CN107881218B (en) | 2017-11-23 | 2017-11-23 | Spherical nucleic acid fluorescent probe for detecting telomerase activity and preparation method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107881218A CN107881218A (en) | 2018-04-06 |
| CN107881218B true CN107881218B (en) | 2021-09-28 |
Family
ID=61774635
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711178896.2A Active CN107881218B (en) | 2017-11-23 | 2017-11-23 | Spherical nucleic acid fluorescent probe for detecting telomerase activity and preparation method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107881218B (en) |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108866161A (en) * | 2018-06-27 | 2018-11-23 | 南京师范大学 | A kind of spherical shape nucleic acid probe and its preparation method and application |
| CN109266721B (en) * | 2018-10-08 | 2021-11-09 | 山东师范大学 | Method for detecting telomerase activity based on non-quenching molecular beacon |
| CN109504734B (en) * | 2018-11-13 | 2020-07-28 | 西安交通大学 | DNA motor for in-situ acceleration in living cells and preparation method and application thereof |
| CN109439318B (en) * | 2018-12-12 | 2022-02-01 | 中国科学院合肥物质科学研究院 | Ratio type viscous flare fluorescent probe and preparation method thereof |
| CN110157774B (en) * | 2019-05-23 | 2023-04-11 | 山东师范大学 | DNA functionalized nanogold probe and application thereof in detecting telomerase |
| CN113774112A (en) * | 2021-08-19 | 2021-12-10 | 青岛科技大学 | Method for detecting telomerase activity |
| CN113981039B (en) * | 2021-11-03 | 2024-06-07 | 长沙理工大学 | DNA nanosphere detection probe and preparation method and application thereof |
| CN114315939B (en) * | 2021-12-24 | 2023-09-15 | 中南大学 | Light-operated fluorescent probe and preparation method and application thereof |
| CN114705034B (en) * | 2022-04-14 | 2023-04-11 | 安徽道源食品有限公司 | Automatic drying control management system |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008104794A2 (en) * | 2007-03-01 | 2008-09-04 | Oxitec Limited | Nucleic acid detection |
| CN103993078A (en) * | 2014-05-09 | 2014-08-20 | 南京大学 | Nanoprobe for in situ imaging of telomerase activity in cells and preparation method thereof |
| CN106591423A (en) * | 2016-11-29 | 2017-04-26 | 山东大学 | Colorimetric detection method for activity of telomerase based on silver nanoprobe |
-
2017
- 2017-11-23 CN CN201711178896.2A patent/CN107881218B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008104794A2 (en) * | 2007-03-01 | 2008-09-04 | Oxitec Limited | Nucleic acid detection |
| CN103993078A (en) * | 2014-05-09 | 2014-08-20 | 南京大学 | Nanoprobe for in situ imaging of telomerase activity in cells and preparation method thereof |
| CN106591423A (en) * | 2016-11-29 | 2017-04-26 | 山东大学 | Colorimetric detection method for activity of telomerase based on silver nanoprobe |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107881218A (en) | 2018-04-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107881218B (en) | Spherical nucleic acid fluorescent probe for detecting telomerase activity and preparation method and application thereof | |
| CN101812528B (en) | Switch mode aptamer probe and application thereof in tumor living cell and vital detection | |
| Xue et al. | Visual detection of STAT5B gene expression in living cell using the hairpin DNA modified gold nanoparticle beacon | |
| CN109439318B (en) | Ratio type viscous flare fluorescent probe and preparation method thereof | |
| CN102220431A (en) | Probe for detecting nucleic acid in living cells and application method thereof | |
| Yan et al. | A NanoFlare‐Based Strategy for In Situ Tumor Margin Demarcation and Neoadjuvant Gene/Photothermal Therapy | |
| CN108299275A (en) | Polymethine compound and its purposes as fluorescent marker | |
| CN104818334B (en) | Relevant Microrna is shifted with adenocarcinoma of lung | |
| CN105106974A (en) | Sulfonated graphene quantum dot bioluminescence probe and application thereof | |
| CN105385691A (en) | Nucleic acid adapter used for detecting human high-metastasis colon cancer cell strain LoVo and detection kit | |
| Wen et al. | A hydrogel with supramolecular surface functionalization for cancer cell capture and multicellular spheroid growth and release | |
| Jia et al. | Metal–DNA coordination based bioinspired hybrid nanospheres for in situ amplification and sensing of microRNA | |
| CN102154474B (en) | Compound of molecular beacons for diagnosing lung cancers and preparation method thereof | |
| CN106929577A (en) | A kind of lncRNA biomarker related to adenocarcinoma of lung | |
| CN103768617B (en) | Nano-gold miR-375 conjugate and preparation method and application thereof | |
| CN104293921A (en) | Magnetic nano composite for treating lung cancer and preparation method thereof | |
| CN106032534A (en) | Ribonucleic acid aptamer capable of specifically being combined with human non-small cell lung cancer cells and screening method thereof | |
| CN104774966B (en) | Adenocarcinoma of lung miRNA labels | |
| CN109251962B (en) | Micron tube sensor and preparation method and application thereof | |
| US20230340570A1 (en) | Methods and systems for reducing particle aggregation | |
| JP2022519324A (en) | Nucleic acid analysis method | |
| CN110272981A (en) | A kind of miRNAs detection method based on telomere enzymatic amplification | |
| CN103800917B (en) | Nano-gold miR-885-5p conjugate and preparation method and application thereof | |
| CN110384680A (en) | A kind of temperature/pH responsiveness is double to carry medicine composite nanoparticle and its preparation method and application | |
| Zhang et al. | An APE1 gated signal amplified biosensor driven by catalytic hairpin assembly for the specific imaging of microRNA in situ |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |