CN103740739A - Chorispora bungeana endoplasmic reticulum type omega-3 fatty acid desaturation enzyme gene and application thereof - Google Patents
Chorispora bungeana endoplasmic reticulum type omega-3 fatty acid desaturation enzyme gene and application thereof Download PDFInfo
- Publication number
- CN103740739A CN103740739A CN201410024462.7A CN201410024462A CN103740739A CN 103740739 A CN103740739 A CN 103740739A CN 201410024462 A CN201410024462 A CN 201410024462A CN 103740739 A CN103740739 A CN 103740739A
- Authority
- CN
- China
- Prior art keywords
- gene
- cbfad3
- high mountain
- endoplasmic reticulum
- ion mustard
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a chorispora bungeana endoplasmic reticulum type omega-3 fatty acid desaturation enzyme gene ((i)CbFAD3(/i)) and an application thereof. The gene is selected from chorispora bungeana and an amino acid sequence of an endoplasmic reticulum type omega-3 fatty acid desaturation enzyme encoded by the gene is represented from a 1st site to a 386th site in a sequence table SEQ ID NO.2; a nucleotide sequence of the endoplasmic reticulum type omega-3 fatty acid desaturation enzyme is represented from a 1st site to a 1161st site in a sequence table SEQ ID NO.1. Compared with wild tobaccos, tobaccos with the trans-chorispora bungeana (i)CbFAD3(/i) gene have high cold resistance, drought resistance and salt resistance; the chorispora bungeana endoplasmic reticulum type omega-3 fatty acid desaturation enzyme gene ((i)CbFAD3(/i)) has the important effect of improving the stress resistance of the tobaccos.
Description
Technical field
The present invention relates to gene engineering technology field, relate in particular to high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene and application thereof.
Background technology
Low temperature, Drought and salt stain are the common abiotic stress of nature, are the important factors that affects crop yield and quality.Cultivation can be resisted New Crop Varieties that cold, Drought and salt coerces for improving agricultural productive force simultaneously, improves water resources and land utilization ratio significant.Tobacco is a kind of important cash crop, but the tobacco of many fine qualities self resistance is not strong, has not only limited its planting area, the impact of the climatic scourge that also makes it to be easy to be subject to happen suddenly.Therefore, identify new adversity gene, by genetic engineering technique, improve the comprehensive resistance of tobacco by the important channel that is improvement tobacco.
Fatty acid desaturase (Fatty acid desaturase) refers to that catalysis and carrier-bound fatty acid chain dehydrogenation form the enzyme of the two keys of C=C; according to the difference of effect substrate carrier, can be divided into acyl-CoA desaturase (Acyl-CoA desaturase); acyl group ACP desaturase (Acyl-ACP desaturase) and acyl group fat desaturase (Acyl-lipid desaturase) (Los and Murata, 1998).Omega-3-aliphatic acid desaturase (ω-3 Fatty acid desaturase) is the one of acyl group fat desaturase; only be present in plant and blue-green algae; according to it, in intracellular location, can be divided into " endoplasmic reticulum type " and " plastid type " (Gibson et al., 1994).The diene lipid acid (C16:2 or C18:2) that this enzyme can be combined in sn-1 or sn-2 position by catalysis and glycerine forms the 3rd two keys in ω-3 and is converted into triethenoid fatty acid (C16:3 or C18:3) (Ohlrogge and Browse, 1994).Triethenoid fatty acid (Trienoic fatty acids, TAs) be unsaturated fatty acids main in higher plant cell film, it is not only the integral part of film, the variation of its content also can respond different environment stresses, alleviate the injury that adverse circumstance causes plant, strengthen the resistance (Matsuda et al., 2007) of plant.Endoplasmic reticulum type omega-3-aliphatic acid desaturase is expressed at normal temperatures, expresses and has tissue specificity, and be subject to the multiple factor such as temperature, salt, arid, illumination, injury and hormone to regulate (Somerville and Browse, 1996).Research shows, endoplasmic reticulum type omega-3-aliphatic acid desaturase not only can improve plant cold resistance by increasing plant triethenoid fatty acid content, and plant is survived and also has vital role (Shimada et al., 2000 under the adverse environmental factors such as Drought and salt stain; Yu et al., 2009; Zhang et al., 2005; Wang et al., 2013).These researchs also disclose, the plant of improving resistance by increasing triethenoid fatty acid ratio (C18:3/C18:2) can maintain good membrane stage under abiotic stress, therefore membrane damage degree, significantly lower than common plant, has lower membrane permeability (relative conductivity value) and film lipid oxidation degree (MDA value) relatively.
High mountain ion mustard (Chorispora bungeana) is that Cruciferae ion mustard belongs to per nnial herb, be distributed on high height above sea level subalpine meadow and gravel matter hillside, its habitat characteristics is very cold, soil layer multigelation, air rarefaction, radiation is strong, strong wind, and gravel poor water retention property, often causes drought stress.High mountain ion mustard without remarkable resistance feature, is tolerance adverse environment in external structure and ecology strategy, must maintain the physiological metabolism of self and grow by expressing resistant gene, to avoid and to alleviate, coerces the harm causing.Therefore, high mountain ion mustard is the ideal material of research stress resistance of plant.At present, yet there are no the report that clones endoplasmic reticulum type omega-3-aliphatic acid desaturase gene from high mountain ion mustard, therefore from high mountain ion mustard clone identification endoplasmic reticulum type omega-3-aliphatic acid desaturase gene, by genetically engineered, forwarded in tobacco, the raising of tobacco resistance is had important practical significance.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene that improves the comprehensive resistance of tobacco.
Another technical problem to be solved by this invention is to provide based on this gene in the application aspect raising tobacco resistance.
For addressing the above problem, high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene of the present invention (Chorispora bungeana fatty acid desaturase 3,
cbFAD3), it is characterized in that: this gene source is in high mountain ion mustard, the aminoacid sequence of the endoplasmic reticulum type omega-3-aliphatic acid desaturase of described genes encoding is if the 1st of SEQ ID NO.2 in sequence table is to as shown in the of 386.
Described gene have the 1st of SEQ ID NO.2 in sequence table to the amino acid residue sequence shown in 386 through replacement, disappearance or the interpolation of one or more amino-acid residues and have with the identical activity of amino acid residue sequence of SEQ ID NO.2 by the derivative protein of SEQ ID NO.2; Described corresponding with described allelic sequence by the derivative protein of SEQ ID NO.2.
Its nucleotide sequence is if the 1st of SEQ ID NO.1 in sequence table is to as shown in the of 1161.
Described gene has the allelotrope with functionally active forming because of disappearance, insertion or the replacement of one or more bases in the 1st to 1161 of SEQ ID NO.1 in sequence table.
A kind of high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase, is characterized in that: its aminoacid sequence is if the 1st of SEQ ID NO.2 in sequence table is to as shown in the of 386.
The application of high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene as above aspect raising tobacco resistance.
The present invention compared with prior art has the following advantages:
1, the present invention is compared and is shown by nucleotide sequence, the high mountain ion mustard being obtained by order-checking
cbFAD3gene coding region total length 1161bp is as shown in SEQ ID NO.1, with model plant Arabidopis thaliana
atFAD3dNA homolog is the highest, reaches 91%.The present invention is by measuring respectively high mountain ion mustard
cbFAD3gene and Arabidopis thaliana
atFAD3the expression of gene under low temperature, Drought and salt are coerced changes to be found: under 4 ℃ of low temperature, and high mountain ion mustard
cbFAD3the expression amount of gene is 7.3 times at 25 ℃, within 3 hours after coercing, just reaches this peak value; And Arabidopis thaliana
atFAD3gene has only increased by 3.7 times, within 24 hours after coercing, just reaches this value.In addition high mountain ion mustard,
cbFAD3increasing amount and the time of response of gene under Drought and salt is coerced is also all better than Arabidopis thaliana At
fAD3gene.Thereby show high mountain ion mustard of the present invention
cbFAD3gene pairs is above-mentioned coerces more responsively, can to coercing, respond within a short period of time, and the dynamics of response is larger, therefore have higher resistance.
2, the present invention finds by amino acid sequence analysis, 386 amino acid of the amino acid sequence encode as shown in SEQ ID NO.2 of being derived by SEQ ID NO.1, and its molecular weight is 44.18KD.This aminoacid sequence comprises peculiar three the conservative Histidines of higher plant omega-3-aliphatic acid desaturase gene bunch " HDCGH ", and " HGWRISHRTHH " and " HHDIGTHVIHH ", therefore belongs to omega-3-aliphatic acid desaturase family member.
The present invention is by by high mountain ion mustard
cbFAD3gene is connected to the upper eukaryotic expression that carries out semi-lactosi induction in S. cervisiae INVScl that imports of carrier pYes2, expressing protein size conforms to (as shown in Figure 1) with the aminoacid sequence shown in SEQ ID NO.2, and adding this transgenic yeast of catalysis after external source linolic acid C18:2 to produce linolenic acid C18:3(as shown in Figure 2), thus verified: as the gene order of the 1st to 1161 of SEQ ID NO.1 can give expression to have functionally active as the 1st protein to the amino acid residue sequence as shown in the of 386 in SEQ ID NO.2.
3, the present invention is by by high mountain ion mustard
cbFAD3gene is connected to upper the importing in Agrobacterium GV3101 of carrier pBI121 and proceeds to tobacco Ben Saimushi (Nicotiana benthamiana) again.Utilize gas chromatograph-mass spectrometer to analyze discovery to the total fatty acids of transfer-gen plant, the C18:3/C18:2 ratio of its root, stem, leaf is respectively 3.1 times, 1.6 times of wild-type contrast tobacco and 1.9 times (as shown in Figure 9), shows the high mountain ion mustard proceeding to
cbFAD3gene has significantly improved the trienic acid content of tobacco really.By low temperature, Drought and salt, coerce experiment and find, the growth conditions (as shown in Fig. 3 ~ 8) of transgene tobacco and the physical signs (as shown in figure 10) of membrane stage are all significantly better than wild-type contrast tobacco.These all illustrate high mountain ion mustard
cbFAD3gene can improve cold-resistant, drought resisting and the saline-alkaline tolerance of transgene tobacco really simultaneously.
4, due to the high mountain ion mustard in the present invention
cbFAD3gene has ability and the resistance of stronger generation trienic acid, therefore, utilizes this gene by genetic engineering technique, can cultivate the tobacco with comprehensive resistance, thus the kind of improvement tobacco.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is high mountain ion mustard of the present invention
cbFAD3gene is the electrophoretic analysis on SDS-PAGE glue by the eukaryotic expression albumen of semi-lactosi induction 3d in yeast saccharomyces cerevisiae INVScl.
Fig. 2 is that the present invention contains high mountain ion mustard
cbFAD3the yeast saccharomyces cerevisiae INVScl of gene is at the total fatty acids gas chromatograph-mass spectrometer collection of illustrative plates adding after linolic acid C18:2.Wherein A is for adding before semi-lactosi induction; B is for adding after semi-lactosi induction.
Fig. 3 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild-type are to impinging upon the growth conditions of 25 ℃.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Fig. 4 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild-type are processed 24hr the growth conditions after 4 ℃ of recovery 4hr to impinging upon-2 ℃.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Fig. 5 is that the present invention turns high mountain ion mustard
cbFAD3growth conditions when the tobacco L2 of gene and wild-type are normally watered to impinging upon.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Fig. 6 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild-type are to impinging upon the growth conditions of cutting off the water supply after 10d rehydration 4hr.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Fig. 7 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild-type are to impinging upon the growth conditions under normal substratum.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Fig. 8 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild-type are to impinging upon the growth conditions applying after 10%NaCl processing 24hr.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Fig. 9 is that the present invention turns high mountain ion mustard
cbFAD3the unsaturated fatty acids ratio of the tobacco L2 of gene and wild-type contrast changes.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Figure 10 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild-type change the relative conductivity impinging upon before and after low temperature, Drought and salt Stress treatment.Wherein: WT is wild-type contrast; L2 is transfer-gen plant.
Embodiment
In the following example of the present invention, experiment material used is high mountain ion mustard (Chorispora bungeana) and tobacco Ben Saimushi (Nicotiana benthamiana).
embodiment 1high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene, the aminoacid sequence of the endoplasmic reticulum type omega-3-aliphatic acid desaturase of this genes encoding is if the 1st of SEQ ID NO.2 in sequence table is to as shown in the of 386, and its nucleotide sequence is if the 1st of SEQ ID NO.1 in sequence table is to as shown in the of 1161.
One, high mountain ion mustard
cbFAD3gene clone.
1. high mountain ion mustard
cbFAD3gene is conserved sequence amplified:
1.1. utilize the Plant RNA of Omega company to extract the total RNA in test kit extraction high mountain ion mustard callus.
1.2. utilize the PrimeScript 1st Strand cDNA synthetic agent box of Takara company to carry out reverse transcription reaction acquisition cDNA.
1.3. according to U.S. NCBI(National Center forBiotechnology Information) the following degenerated primer of the gene order of database retrieval design:
Sense Primer:5 '-GGGCGGC
kaTTCCTAAGCA
yt-3 ' (degeneracy=4)
Antisense Primer:5 '-GC
raGCATGGG
saGAGG
raCAG-3 ' (degeneracy=8)
1.3. high mountain ion mustard
cbFAD3gene conserved sequence pcr amplification:
Reaction system (50 μ l): cDNA 2.5 μ l, l) 0.5 μ l of TaKaRa LA Taq(5 U/ μ, 10 × LA Taq Buffer II(Mg2+ free) 5 μ l, MgCl
2(25 mM) 5 μ l, dNTP Mix(2.5 mM) 8 μ l, Sense Primer 1 μ l (10 μ M), Antisense Primer 1 μ l (10 μ M), ddH2O 27 μ l.
Reaction conditions: 94 ℃, 3min
(94 ℃, 1min; 56 ℃, 15s; 61 ℃, 15s; 72 ℃, 1min
)30 circulations
72℃，10min
1.4. high mountain ion mustard
cbFAD3the order-checking of gene conserved sequence:
(1) above-mentioned PCR product is carried out to electrophoresis (220V, 170A) on 1% sepharose, under ultraviolet lamp, cut and meet the big or small band of amplification, with the DNA gel of Axygen company, reclaim test kit and reclaim.
(2) high mountain ion mustard
cbFAD3the clone of gene conserved sequence and the evaluation of positive recombinant are carried out according to the pEASY-Blunt Cloning test kit of TransGen company.
(3) the positive recombinant identifying is delivered to the order-checking of Shanghai Majorbio company.
2. high mountain ion mustard
cbFAD3gene 3 ' end amplification:
2.1. according to high mountain ion mustard
cbFAD3the following Auele Specific Primer of gene conserved sequence design:
Outer Primer: 5’- TGAAAACGACGAGTCCTGGGTTCCGCTA-3’
Inner Primer: 5’- CTTCACTCCTTCATCCTCGTTCCTTACC -3’
2.2. high mountain ion mustard
cbFAD3the synthetic of gene cDNA (3 ' RACE) carries out according to the SmartRACE test kit specification sheets of Invitrogen company.
2. 3. carry out PCR reaction according to the SmartRACE test kit of Invitrogen:
(1) Outer PCR reaction.
Reaction system (50 μ l): cDNA (3 ' RACE) 2.5 μ l, Outer primer (10uM) 1 μ l, 10 × UPM, 5 μ l, ddH
20 34.5 μ l, 10 × BD Advantage, 2 PCR Buffer 5 μ l, dNTP Mix(20mM) 1 μ l, 50 × BD Advantage, 2 Phymerase Mix 1 μ l.
Reaction conditions:
(94 ℃ of 30s; 68 ℃, 30s; 72 ℃, 3min
)25 circulations.
(2) Inner PCR reaction.
Reaction system (50 μ l): Outer PCR cut back 5 μ l, Inner primer (10uM) 1 μ l, 10 × NUP, 5 μ l, ddH
20 32 μ l, 10 × BD Advantage, 2 PCR Buffer 5 μ l, dNTP Mix(20mM) 1 μ l, 50 × BD Advantage, 2 Phymerase Mix 1 μ l.
Reaction conditions with in the present embodiment 2.3 (1).
2.4. high mountain ion mustard
cbFAD3gene 3 ' end sequence measurement is with in the present embodiment 1.4.
3. high mountain ion mustard
cbFAD3the amplification of gene 5 ' end:
3.1. according to high mountain ion mustard
cbFAD3the following Auele Specific Primer of gene conserved sequence design:
Outer Primer： 5’- GAGGCACAGTGTATCTGAGCATTCGA -3’
Inner Primer：5’- GGTAAGGAACGAGGATGAAGGAGTGAAG -3’
3.2. high mountain ion mustard
cbFAD3the synthetic of gene cDNA (5 ' RACE) carries out according to the SmartRACE test kit specification sheets of Invitrogen company.
3. carry out PCR reaction according to the SmartRACE test kit of Invitrogen:
(1) Outer PCR reaction.
Reaction system (50 μ l): cDNA (5 ' RACE) 2.5 μ l, remaining reaction agent with in the present embodiment 2.3 (1).
Reaction conditions with in the present embodiment 2.3 (1).
(2) Inner PCR reaction.
Reaction system (50 μ l) and reaction conditions with in the present embodiment 2.3 (1).
3.4. high mountain ion mustard
cbFAD3gene 5 ' end sequence measurement is with in the present embodiment 1.4.
4. gene splicing:
4.1. by high mountain ion mustard
cbFAD3gene conserved sequence, 3 ' end and 5 ' end group, because sequencing result splices by DNAstar software, obtain gene cDNA sequence total length.
5. full length gene cDNA sequence amplification:
5.1. utilize cDNA for template design primer as follows:
CbFAD3s：5’-GCTCTAGAATGGTTGTTGCAATGGACCA-3’
CbFAD3a：5’-CGAGCTCCTAATTGATTTTAGATTTGTCAG-3’
Reaction system (50 μ l): cDNA 2.5 μ l, l) 0.5 μ l of TaKaRa LA Taq(5 U/ μ, 10 × LA Taq Buffer II(Mg2+ free) 5 μ l, MgCl2(25 mM) 5 μ l, dNTP Mix(2.5 mM) 8 μ l, CbFAD3s (10 μ M) 1 μ l, CbFAD3a (10 μ M) 1 μ l, ddH
2o 27 μ l.
Reaction conditions: 94 ℃, 3min
(94 ℃, 1min; 58 ℃, 30s; 72 ℃, 1min
)30 circulations
72℃，10min
5.2. high mountain ion mustard
cbFAD3gene cDNA sequence sequence measurement is with in the present embodiment 1.4.Order-checking obtains
cbFAD3the coding region of gene as shown in SEQ ID NO.1 in sequence table, from initiator codon to 1161 bases of terminator codon overall length.
embodiment 2high mountain ion mustard
cbFAD3the eukaryotic expression of gene in yeast saccharomyces cerevisiae INVScl
1. build carrier for expression of eukaryon pYES2-
cbFAD3
1.1. as follows according to coding region sequence design primer:
Z3-UP：5’-GGATCCACCATGGTTGTTGCAATGGACCA -3’
Z3-DN：5’- CGAGCTCTAATTGATTTTAGATTTGTCAG -3’
1.2. high mountain ion mustard
cbFAD3gene amplification:
Reaction system (50 μ l): cDNA 2.5 μ l, l) 0.5 μ l of TaKaRa LA Taq(5 U/ μ, 10 × LA Taq Buffer II(Mg2+ free) 5 μ l, MgCl2(25 mM) 5 μ l, dNTP Mix(2.5 mM) 8 μ l, CbFAD3s (10 μ M) 1 μ l, CbFAD3a (10 μ M) 1 μ l, ddH
2o 27 μ l.
Reaction conditions: 94 ℃, 3min
(94 ℃, 1min; 56 ℃, 15s; 63 ℃, 15s; 72 ℃, 1min
)30 circulations
72℃，10min
1.3. high mountain ion mustard
cbFAD3the recovery method of gene is same
embodiment 1middle 1.4. (1).
1.4. high mountain ion mustard CbFAD3 gene is cut and is connected with the enzyme of expression vector pYES2 plasmid:
(1) the restriction enzyme BamHI and the SacI that reclaim product and expression vector pYES2 plasmid (FunGenome company) Takara company are carried out respectively to double digestion.Reaction system (20 μ l): DNA 7 μ l, (50 U/ μ are 1 μ l l), and (50 U/ μ are 1 μ l l), 10 × K Buffer, 1 μ l, ddH for SacI1 for BamHI
2o 10 μ l.37 ℃, enzyme is cut 4hr.
(2) the recovery method that enzyme is cut product with
embodiment 1middle 1.4. (1).
(3) the fragment that is inserted into after enzyme being cut back to close is connected according to the DNA Ligation test kit of Takara company with carrier.
(4) getting 5 μ l connects products and adds in the competent cell of 50 μ l bacillus coli DH 5 alphas and transform, adopt penbritin (Amp) resistance screening, the bacterium colony growing is directly identified with PCR, and the positive colony identifying is delivered to the order-checking of Shanghai Majorbio company, and sequencing result obtains
cbFAD3the coding region of gene cDNA sequence, as shown in sequence table SEQ ID NO.1, confirms expression vector pYES-
cbFAD3successfully construct.
2. expression vector pYES-
cbFAD3import yeast saccharomyces cerevisiae INVScl
2.1. utilize the plasmid extraction test kit extraction of Axygen company to contain expression vector pYES-
cbFAD3the plasmid of positive colony.
2.2. will contain expression vector pYES-
cbFAD3plasmid according to the efficient yeast conversion test kit of FunGenome company, import in yeast saccharomyces cerevisiae INVScl.
2.3. utilize the efficient yeast plasmid of FunGenome company to reclaim test kit recovery yeast plasmid, and deliver to the order-checking of Shanghai Majorbio company, sequencing result obtains
cbFAD3the coding region of gene, as shown in sequence table SEQ ID NO.1, confirms expression vector pYES-
cbFAD3successfully import in yeast saccharomyces cerevisiae INVScl.
3. the expression of albumen and evaluation:
3.1. the extraction of expressing protein:
(1) will contain expression vector pYES-
cbFAD3yeast saccharomyces cerevisiae special culture solution (0.3%YSDMS+0.26%YNB+0.75% (NH for INVScl
4)
2sO
4+ 1%NP-40+2% raffinose) at 28 ℃, 180rpm shakes training 48hr.During induction, add 2% semi-lactosi to cultivate 3d.
(2) after inducing culture finishes, draw respectively not abduction delivering and the bacterium liquid of abduction delivering is in the centrifuge tube of 1.5ml of 1ml, the centrifugal 3min of 5000rpm, abandons supernatant.Add 1ml ddH
2after O is resuspended, the centrifugal 3min of 5000rpm, abandons supernatant.Repetitive operation once.Add 100 μ l 2 × SDS-PAGE sample-loading buffers (100mmol/L Tris pH6.8,4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine, 2% β mercaptoethanol), 100 ℃ of water-bath 10min.Be cooled to room temperature, 3000rpm, centrifugal 10s.Get 5 μ l supernatant liquors and carry out SDS-PAGE electrophoresis (voltage stabilizing: concentrated glue 80V, separation gel 120V).The albumen size that abduction delivering goes out is about 44.18KD(as shown in Figure 1), conform to the aminoacid sequence prediction shown in sequence table SEQ ID NO.2.
3.2. the functional verification of expressing protein:
(1) contain expression vector pYES-
cbFAD3the nutrient solution of yeast saccharomyces cerevisiae INVScl and cultural method with 3.1. in the present embodiment (1).During induction, adding 2% semi-lactosi and final concentration is that the C18:2(of 100 μ M is purchased from sigma company) cultivate 3d.
(2) after inducing culture finishes, collect respectively not abduction delivering and the bacterium liquid of abduction delivering is in the centrifuge tube of 50ml of 20ml, the centrifugal 3min of 5000rpm, abandons supernatant.Add 20ml ddH
2after O is resuspended, the centrifugal 3min of 5000rpm, abandons supernatant.Repetitive operation once.Add 5ml 1M NaOH (methyl alcohol), 70 ℃ of water-bath 30min.After cooling, add 6M HCl adjust pH to 1.Add 5ml 10%BF
3(methyl alcohol), 70 ℃ of water-bath 5min.After cooling, add the saturated NaCl solution of 10ml, with 5ml CH
2cl
2/ normal hexane (1:4, V:V) extracting twice, combining extraction liquid is dried to obtain total fatty acids.
(3) the U.S. 6890N of Agilent company type gas-chromatography and 5975C GC-MS are used in total fatty acids composition analysis.
Chromatographic condition: quartz capillary column (Agilent DB-FFAP, m), sample size is 0.2 μ l to μ m × 0.5,30.0m × 250.0 μ; Splitting ratio is 100:1; Injector temperature is 200 ℃; Temperature programming, from 70 ℃, rises to 190 ℃ with 10 ℃/min, keeps 2min, then rises to 230 ℃ of maintenance 12 min with 8 ℃/min; Column flow rate is 1.1 mL/min; Carrier gas is high-purity helium (99.999%).
Mass spectrum condition: ionizer is 70 eV; 230 ℃ of ion source temperatures; 150 ℃ of level Four bar temperature; Interface temperature is 250 ℃; Solvent delay is 1. 5 min.
Result demonstration (as shown in Figure 2) contains expression vector pYES-
cbFAD3the linolenic acid C18:3 that can catalysis produces of yeast saccharomyces cerevisiae INVScl.The gene coding region of explanation as shown in sequence table SEQ ID NO.1 can give expression to the protein as shown in the amino-acid residue of sequence table SEQ ID NO.2 of catalysis linolic acid C18:2 dehydrogenation generation linolenic acid C18:3 activity really.
embodiment 3turn high mountain ion mustard
cbFAD3the acquisition of genetic tobacco
1. build carrier for expression of eukaryon pBI121-
cbFAD3
1.1. as follows according to coding region sequence design primer:
ZF3： 5’-GCTCTAGAATGGTTGTTGCAATGGACCA- 3’
ZF3’： 5’ -CGAGCTCCTAATTGATTTTAGATTTGTCAG- 3’
1.2. high mountain ion mustard
cbFAD3gene amplification:
Reaction system is same
embodiment 2in 1.2
Reaction conditions: 94 ℃, 3min
(94 ℃, 1min; 60 ℃, 30s; 72 ℃, 1min
)30 circulations
72℃，10min
1.3. high mountain ion mustard
cbFAD3the recovery method of gene is same
embodiment 1middle 1.4. (1).
1.4. high mountain ion mustard CbFAD3 gene is cut and is connected with the enzyme of expression vector pBI121 plasmid:
(1) 1.2 recovery product and expression vector pBI121 plasmid (preserve in this laboratory) are carried out respectively to double digestion with restriction enzyme XbaI and the SacI of Takara company.Reaction system (20 μ l): DNA 7 μ l, (50 U/ μ are 1 μ l l), and (50 U/ μ are 1 μ l l), 10 × M Buffer, 2 μ l, ddH for SacI1 for XbaI
2o 10 μ l.37 ℃, enzyme is cut 4hr.
(2) the recovery method that enzyme is cut product with
embodiment 1middle 1.4. (1).
(3) the fragment that is inserted into after enzyme being cut back to close is connected according to the DNA Ligation test kit of Takara company with carrier.
(4) getting 5 μ l connects products and adds in the competent cell of 50 μ l bacillus coli DH 5 alphas and transform, adopt kantlex (Kan) resistance screening, the bacterium colony growing is directly identified with PCR, and the positive colony identifying is delivered to the order-checking of Shanghai Majorbio company, and sequencing result obtains
cbFAD3the coding region of gene cDNA sequence, as shown in sequence table SEQ ID NO.1, confirms expression vector pBI121-
cbFAD3successfully construct.
2. expression vector pBI121-
cbFAD3import Agrobacterium GV3101
2.1. utilize triparental mating by the plasmid pBI121-building
cbFAD3from bacillus coli DH 5 alpha, transfer to Agrobacterium GV3101.
2.2. utilize the plasmid extraction test kit extraction of Axygen company to contain expression vector pYES-
cbFAD3the plasmid of positive colony, and deliver to the order-checking of Shanghai Majorbio company, sequencing result obtains
cbFAD3the coding region of gene, as shown in sequence table SEQ ID NO.1, confirms expression vector pBI121-
cbFAD3successfully import in Agrobacterium GV3101.
3. utilize leaf dish method transformation of tobacco:
Picking contains pBI121-
cbFAD3single bacterium colony,, in 28 ℃, it is 0.6 ~ 0.8 that 180rpm cultivates about 12hr to OD 600 to be inoculated in 1ml YEP nutrient solution (Rif 40 μ g/ml, Kan 100 μ g/ml).By bacterium liquid in 1% ratio, proceed to 50ml new containing in antibiotic YEP nutrient solution, in 28 ℃, it is 0.4 ~ 0.6 that 180rpm cultivates 6hr to OD600.The young leaflet tablet of getting wild-type tobacco aseptic seedling, removes master pulse, is cut into 0.5cm
2fritter, put into bacterium liquid, soak 10min.Suck after unnecessary bacterium liquid with aseptic filter paper, by blade inoculation on MS+KT (2.0 μ g/ml)+NAA (0.4 μ g/ml) solid medium, 28 ℃ of dark 2d that cultivate.Blade after common cultivation is transferred to the enterprising row filter of MS+KT (2.0 μ g/ml)+NAA (0.4 μ g/ml)+Kan (80 μ g/ml)+Cef (300 μ g/ml) solid medium to be cultivated, 12h/d illumination cultivation, the growth of induced bud.After 30d, when indefinite bud grows to 1cm left and right, cut indefinite bud and transfer on 1/2MS+NAA (0.1 μ g/ml)+Cef (200 μ g/ml) and carry out root culture, obtaining whole plant.
4. transfer-gen plant checking:
Utilize the magnetic bead DNA of plants of Omega company to extract total DNA of test kit extraction transformation of tobacco, PCR detects
cbFAD3whether gene proceeds to, and to amplifying the plant of suitable band, further the total RNA(extracting method of extraction is same
in embodiment 1 1.1), obtain cDNA, take cDNA as template, further carry out PCR detection, identify and transform successful transfer-gen plant.Found that the successful transfer-gen plant of 5 strain, respectively called after L1, L2, L3, L4 and L5.
embodiment 4the application of high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene aspect raising tobacco resistance.By the total fatty acids analysis to transgene tobacco and resistance, detect and show that cold-resistant, the drought resisting of transgene tobacco and saline-alkaline tolerance are all significantly higher than wild-type contrast.
1. the total fatty acids analysis of transgene tobacco:
Choose the F1 generation (still called after L2) of the transfer-gen plant L2 crossing through MS+KT (2.0 μ g/ml) Screening of Media as total fatty acids analytic target.Root, stem, the leaf of getting respectively 1g strain to be detected add quartzite sand grind in mortar.Total fatty acids extraction and analytical procedure are same
embodiment 2middle 3.2. (2) ~ (3).Result shows, turns
cbFAD3the C18:3/C18:2 ratio of genetic tobacco root, stem, leaf all, higher than wild-type contrast tobacco (as shown in Figure 9), shows the high mountain ion mustard proceeding to
cbFAD3gene has significantly improved the trienic acid content of tobacco really.
2. the resistance of transgene tobacco detects:
The object that the F1 generation (still called after L2) of choosing the transfer-gen plant L2 crossing through MS+KT (2.0 μ g/ml) Screening of Media detects as cold-resistant, drought resisting and salt resistance, by wild-type plant in contrast.Low temperature stress: transfer-gen plant and adjoining tree are placed in to-2 ℃ simultaneously and process after 24hr, then recover 4hr in 4 ℃.Drought stress: by transfer-gen plant and adjoining tree natural drought 10day simultaneously, and then rehydration 4hr.Salt stress: apply 10%NaCl solution-treated 24hr simultaneously to transfer-gen plant and adjoining tree.After above-mentioned finishing dealing with, observe immediately Reducing sugar, and measure blade plasma membrane example rate of permeation.Found that, wild-type plant after processing is impaired serious, and here blade obviously withers, and transfer-gen plant still keeps good vitality (as shown in Fig. 3 ~ 8), and the plasma membrane seepage of transfer-gen plant is significantly less than wild-type (as shown in figure 10).Cold-resistant, the drought resisting and the saline-alkaline tolerance that show transgene tobacco are all significantly higher than wild-type contrast.
SEQ ID NO.1
1 ATGGTTGTTG CAATGGACCA ACGCAGCAGC AATGTGAAGG GAGATTCCGG CGCCGGAGAG CGGAAGGAGA GGGGTTTGA
81 TCCGAGCGCA CAGCCTCCGT TCAAGATCGG AGATATAAGG GCGGCGATTC CTAAGCACTG CTGGGTGAAG AGTCCTTTGA
161 GATCGATGAG TTACGTCGTC AGAGACATCA TCGCCGTCGC GTCTCTTGCC GTCGCCGCCG TGTATTTTGA CACCTGGTTC
241 CTCTGGCCTC TCTATTGGGC CGCCCAAGGA ACCCTTTTCT GGGCCATCTT CGTTCTCGGC CACGACTGTG GACATGGGAG
321 TTTCTCAGAC ATTCCTCTGC TCAATAGTGT GGTTGGTCAC ATTCTTCACT CCTTCATCCT CGTTCCTTAC CATGGTTGGA
401 GAATAAGCCA TCGGACACAC CACCAGAACC ATGGCCATGT TGAAAACGAC GAGTCCTGGG TTCCGCTACC AGAAAGGGTG
481 TACAAGAAAT TACCACACAG TACTCGAATG CTCAGATACA CTGTGCCTCT CCCCATGCTC GCTTATCCTC TCTATCTGTG
561 GTACAGAAGT CCAGGAAAAG AAGGGTCACA TTTTAACCCA AACAGTAGTT TATTTGCACC AAGCGAGAGA AAGCTTATCG
641 CAACATCAAC CACTTGTTGG TCCATTATGT TGTCCATTCT CATCTTTCTT TCTTTCACCG TTGGTCCACT CTCCGTTCTC
721 AAAGTCTACG GTGTCCCTTA CATCATCTTT GTGATGTGGT TGGACGCTGT CACGTATCTG CACCATCACG GTTACGACGA
801 GAAGTTGCCT TGGTACAGAG GCAAAGAATG GAGTTATCTA CGTGGAGGAT TAACGACAGT GGACAGAGAT TACGGGATCT
881 TCAACAACAT TCATCACGAC ATTGGAACTC ACGTCATACA CCATCTCTTC CCACAGATCC CTCACTATCA TCTTGTCGAT
961 GCCACGAAGG CAGCGAAACA CGTGTTGGGT AGATACTACA GAGAACCGAA GAGGTCAGGA GCGATACCGG TCCATTTGGT
1041 TGAGAGTTTG GTCGCTAGTA TTAAGAAAGA TCATTACGTT AGGGACACTG GTGATATCGT CTTCTACGAG ACTGATCCAG
1121 ATCTCTACGT TTATGCTTCT GACAAATCTA AAATCAATTA G
SEQ ID NO.2
1 MVVAMDQRSS NVKGDSGAGE RKEKGFDPSA QPPFKIGDIR AAIPKHCWVK SPLRSMSYVV RDIIAVASLA VAAVYFDTWF
81 LWPLYWAAQG TLFWAIFVLG HDCGHGSFSD IPLLNSVVGH ILHSFILVPY HGWRISHRTH HQNHGHVEND ESWVPLPERV
161 YKKLPHSTRM LRYTVPLPML AYPLYLWYRS PGKEGSHFNP NSSLFAPSER KLIATSTTCW SIMLSILIFL SFTVGPLSVL
241 KVYGVPYIIF VMWLDAVTYL HHHGYDEKLP WYRGKEWSYL RGGLTTVDRD YGIFNNIHHD IGTHVIHHLF PQIPHYHLVD
321 ATKAAKHVLG RYYREPKRSG AIPVHLVESL VASIKKDHYV RDTGDIVFYE TDPDLYVYAS DKSKIN
Claims (4)
1. high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene, it is characterized in that: this gene source is in high mountain ion mustard, the aminoacid sequence of the endoplasmic reticulum type omega-3-aliphatic acid desaturase of described genes encoding is if the 1st of SEQ ID NO.2 in sequence table is to as shown in the of 386.
2. high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene as claimed in claim 1, is characterized in that: its nucleotide sequence is if the 1st of SEQ ID NO.1 in sequence table is to as shown in the of 1161.
3. a high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase, is characterized in that: its aminoacid sequence is if the 1st of SEQ ID NO.2 in sequence table is to as shown in the of 386.
4. the application of high mountain ion mustard endoplasmic reticulum type omega-3-aliphatic acid desaturase gene as claimed in claim 1 or 2 aspect raising tobacco resistance.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410024462.7A CN103740739B (en) | 2014-01-20 | 2014-01-20 | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410024462.7A CN103740739B (en) | 2014-01-20 | 2014-01-20 | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103740739A true CN103740739A (en) | 2014-04-23 |
| CN103740739B CN103740739B (en) | 2015-09-23 |
Family
ID=50497804
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410024462.7A Active CN103740739B (en) | 2014-01-20 | 2014-01-20 | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103740739B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116064436A (en) * | 2023-02-17 | 2023-05-05 | 西南大学 | Loquat EjFADC1 gene, protein coded by same and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5866789A (en) * | 1991-12-31 | 1999-02-02 | Pioneer Hi-Bred International, Inc. | Fatty acid alteration by a 9 desaturase in transgenic plant tissue |
| CN1884500A (en) * | 2006-06-15 | 2006-12-27 | 中国人民解放军军事医学科学院生物工程研究所 | Omega-3-aliphatic acid desaturase, and its encoding gene and use thereof |
| CN102533804A (en) * | 2010-09-10 | 2012-07-04 | 兰州大学 | Artemisia sphaerocephala krasch delta 12 fatty acid dehydrogenase (As flavin adenine dinucleotide 2 (FAD2)) gene and application |
-
2014
- 2014-01-20 CN CN201410024462.7A patent/CN103740739B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5866789A (en) * | 1991-12-31 | 1999-02-02 | Pioneer Hi-Bred International, Inc. | Fatty acid alteration by a 9 desaturase in transgenic plant tissue |
| CN1884500A (en) * | 2006-06-15 | 2006-12-27 | 中国人民解放军军事医学科学院生物工程研究所 | Omega-3-aliphatic acid desaturase, and its encoding gene and use thereof |
| CN102533804A (en) * | 2010-09-10 | 2012-07-04 | 兰州大学 | Artemisia sphaerocephala krasch delta 12 fatty acid dehydrogenase (As flavin adenine dinucleotide 2 (FAD2)) gene and application |
Non-Patent Citations (2)
| Title |
|---|
| 刘建民，等: "高山被孢霉Δ5去饱和酶基因的克隆及异源表达研究", 《食品科学》, vol. 34, no. 15, 31 December 2013 (2013-12-31), pages 166 - 170 * |
| 石玉兰: "低温下高山离子芥细胞质膜的信号响应机制与抗寒性的关系", 《中国科学院研究生院博士学位论文》, 30 April 2008 (2008-04-30) * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116064436A (en) * | 2023-02-17 | 2023-05-05 | 西南大学 | Loquat EjFADC1 gene, protein coded by same and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103740739B (en) | 2015-09-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6103607B2 (en) | Plant suitable for high-density planting and use thereof | |
| CN101942449A (en) | Methods of increasing abiotic stress tolerance and/or biomass in plants and plants generated thereby | |
| CN101775381A (en) | Plant stress tolerance correlative protein kinase, encoding gene and application thereof | |
| CN107532179A (en) | Produce PUFA material and method and the composition containing PUFA | |
| CN107840872B (en) | Albumen and the application of wax plum CpWOX13 gene and its coding | |
| CN102532287B (en) | Stress-resistant protein PpLEA3-17 of bryophyte as well as encoding gene and application thereof | |
| CN102002101B (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| Xin et al. | Overexpression of the Ginkgo biloba WD40 gene GbLWD1-like improves salt tolerance in transgenic Populus | |
| Li et al. | Cloning, characterization and functional analysis of two type 1 diacylglycerol acyltransferases (DGAT1s) from Tetraena mongolica | |
| CN104004073B (en) | Derive from disease resistance associated protein TaCPK7-R of Semen Tritici aestivi and relevant biological material thereof and application | |
| CN105481958A (en) | Application of protein OsOSM1 to regulation and control over plant disease resistance | |
| JPWO2009072608A1 (en) | Genes for increasing production of plant oils and methods of use thereof | |
| CN106591320A (en) | Betula platyphylla BplSPL1 gene for promoting precocious flowering and encoded protein thereof | |
| CN102477435A (en) | Method for improving plant drought resistance using Poncirus trifoliata transcription factor gene PtrABF | |
| CN103740739B (en) | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof | |
| CN110452917A (en) | The application of bryony VyGOLS gene and its coding albumen in drought stress | |
| CN103183731A (en) | Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof | |
| CN107312077B (en) | Albumen and the application of wax plum CpSOC1 gene and its coding | |
| CN113046375B (en) | SpCPK33 gene and application of encoding protein thereof in regulation and control of drought tolerance of tomatoes | |
| WO2011010485A1 (en) | Process for production of eicosanoid, eicosanoid biosynthesis gene derived from marchantia polymorpha, and use of the gene | |
| JP2011239684A (en) | Improvement of material productivity of plant using transcription factor | |
| CN105177027A (en) | Peach fatty acid desaturase gene PpFAD2 and application thereof | |
| CN109810984A (en) | A kind of relevant Sesame SiGolS6 of drought resisting and its application | |
| CN102295691A (en) | BCCP2 gene and application on enhancing lipid content of plant and algae thereof | |
| Neelwarne | Red beet hairy root cultures |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200820 Address after: 730000 No.318, Donggang West Road, Chengguan District, Lanzhou City, Gansu Province Patentee after: NORTHWEST INSTITUTE OF ECO-ENVIRONMENT AND RESOURCES, CAS Address before: Chengguan District of Gansu city of Lanzhou province Donggang West Road 730000 No. 320 Patentee before: Institute of environment and Engineering in cold and dry areas, Chinese Academy of Sciences |