CN103740739B - High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof - Google Patents
High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof Download PDFInfo
- Publication number
- CN103740739B CN103740739B CN201410024462.7A CN201410024462A CN103740739B CN 103740739 B CN103740739 B CN 103740739B CN 201410024462 A CN201410024462 A CN 201410024462A CN 103740739 B CN103740739 B CN 103740739B
- Authority
- CN
- China
- Prior art keywords
- high mountain
- gene
- cbfad3
- ion mustard
- mountain ion
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention relates to a kind of high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene (CbFAD3), this gene source is in high mountain ion mustard, and the aminoacid sequence of the endoplasm net type omega-3-aliphatic acid desaturase of described genes encoding is if SEQ ID NO.2 in sequence table the 1st is to shown in 386; Its nucleotide sequence is if SEQ ID NO.1 in sequence table the 1st is to shown in 1161.What the present invention obtained turn high mountain ion mustard CbFAD3 genetic tobacco has higher cold-resistant, drought resisting and salt resistance than wild-type tobacco, can play a significant role in raising tobacco resistance.
Description
Technical field
The present invention relates to gene engineering technology field, particularly relate to high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof.
Background technology
Low temperature, Drought and salt stain are the common abiotic stress of nature, are the important factors affecting crop yield and quality.The New Crop Varieties that cultivation can resist cold simultaneously, Drought and salt is coerced for raising agricultural productive force, improve water resources and land utilization ratio significant.Tobacco is a kind of important cash crop, but self resistance of the tobacco of many fine qualities is not strong, not only limit its planting area, also makes it the impact being easy to be subject to burst climatic scourge.Therefore, identify new adversity gene, the important channel that the comprehensive resistance being improved tobacco by genetic engineering technique will be improvement tobacco.
Fatty acid desaturase (Fatty acid desaturase) refers to that catalysis and carrier-bound fatty acid chain dehydrogenation form the enzyme of C=C double bond; acyl-CoA desaturase (Acyl-CoA desaturase) can be divided into according to the difference of substrate specificity carrier; acyl group ACP desaturase (Acyl-ACP desaturase) and acyl group fat desaturase (Acyl-lipid desaturase) (Los and Murata, 1998).Omega-3-aliphatic acid desaturase (ω-3 Fatty acid desaturase) is the one of acyl group fat desaturase; only be present in plant and blue-green algae; " endoplasm net type " and " plastid type " (Gibson et al., 1994) can be divided in intracellular location according to it.This enzyme forms the 3rd double bond by the dienoic fatty acid (C16:2 or C18:2) that catalysis and glycerine are combined in sn-1 or sn-2 position ω-3 and is converted into triethenoid fatty acid (C16:3 or C18:3) (Ohlrogge and Browse, 1994).Triethenoid fatty acid (Trienoic fatty acids, TAs) be unsaturated fatty acids main in higher plant cell film, it is not only the integral part of film, the change of its content also can respond different environment stresses, alleviate the injury that adverse circumstance causes plant, strengthen the resistance (Matsuda et al., 2007) of plant.Endoplasm net type omega-3-aliphatic acid desaturase is expressed at normal temperatures, expresses and has tissue specificity, and regulates (Somerville and Browse, 1996) by the multiple factor such as temperature, salt, arid, illumination, injury and hormone.Research shows, endoplasm net type omega-3-aliphatic acid desaturase not only improves plant cold resistance by increasing plant triethenoid fatty acid content, survives also have vital role (Shimada et al., 2000 to plant under the adverse environmental factors such as Drought and salt stain; Yu et al., 2009; Zhang et al., 2005; Wang et al., 2013).These researchs also disclose, the plant of improving resistance by increasing triethenoid fatty acid ratio (C18:3/C18:2) can maintain good membrane stage under abiotic stress, therefore membrane damage degree is significantly lower than common plant, has lower membrane permeability (relative conductivity value) and membrane oxidation degree (MDA value) relatively.
High mountain ion mustard (Chorispora bungeana) is that Cruciferae ion mustard belongs to per nnial herb, be distributed on High aititude subalpine meadow and gravel matter hillside, its habitat characteristics is very cold, soil layer multigelation, air rarefaction, radiation is strong, strong wind, and gravel poor water retention property, often cause drought stress.High mountain ion mustard without remarkable resistant properties, is tolerance adverse environment in external structure and ecology strategy, must maintain the physiological metabolism of self and grow, to avoid and to alleviate the harm of coercing and causing by expressing resistant gene.Therefore, high mountain ion mustard is the ideal material of research stress resistance of plant.At present, yet there are no the report cloning endoplasm net type omega-3-aliphatic acid desaturase gene from high mountain ion mustard, therefore from high mountain ion mustard clone identification endoplasm net type omega-3-aliphatic acid desaturase gene, forwarded in tobacco by genetically engineered, the raising of tobacco resistance is had important practical significance.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene improving the comprehensive resistance of tobacco.
Another technical problem to be solved by this invention is to provide and is improving the application in tobacco resistance based on this gene.
For solving the problem, high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene of the present invention (Chorispora bungeana fatty acid desaturase 3,
cbFAD3), it is characterized in that: this gene source is in high mountain ion mustard, and the aminoacid sequence of the endoplasm net type omega-3-aliphatic acid desaturase of described genes encoding is if SEQ ID NO.2 in sequence table the 1st is to shown in 386.
Described gene has SEQ ID NO.2 the 1st in sequence table and has the protein derivative by SEQ ID NO.2 with the identical activity of amino acid residue sequence of SEQ ID NO.2 to the amino acid residue sequence shown in 386 through the replacement of one or more amino-acid residue, disappearance or interpolation; The described protein derivative by SEQ ID NO.2 is corresponding with described allelic sequence.
Its nucleotide sequence is if SEQ ID NO.1 in sequence table the 1st is to shown in 1161.
Described gene has disappearance because of one or more base in SEQ ID NO.1 the 1st to 1161 in sequence table, insertion or replacement and the allelotrope with functionally active formed.
A kind of high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase, is characterized in that: its aminoacid sequence is if SEQ ID NO.2 in sequence table the 1st is to shown in 386.
High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene as above is improving the application in tobacco resistance.
The present invention compared with prior art has the following advantages:
1, the present invention is shown by nucleic acid sequence alignment, the high mountain ion mustard obtained by order-checking
cbFAD3gene coding region total length 1161bp as shown in SEQ ID NO.1, with model plant Arabidopis thaliana
atFAD3genetic homology is the highest, reaches 91%.The present invention is by measuring high mountain ion mustard respectively
cbFAD3gene and Arabidopis thaliana
atFAD3the expression change of gene under low temperature, Drought and salt are coerced finds: under 4 DEG C of low temperature, high mountain ion mustard
cbFAD3the expression amount of gene is 7.3 times at 25 DEG C, within 3 hours after coercing, just reaches this peak value; And Arabidopis thaliana
atFAD3gene merely add 3.7 times, within 24 hours after coercing, just reaches this value.In addition, high mountain ion mustard
cbFAD3the increasing amount of gene under Drought and salt is coerced and time of response are also all better than Arabidopis thaliana At
fAD3gene.Thus show high mountain ion mustard of the present invention
cbFAD3gene pairs is above-mentioned coerces more responsive, can respond to coercing within a short period of time, and the dynamics of response is larger, therefore has higher resistance.
2, the present invention is found by amino acid sequence analysis, and 386 amino acid of the amino acid sequence encode as shown in SEQ ID NO.2 derived by SEQ ID NO.1, its molecular weight is 44.18KD.This aminoacid sequence comprises three histidine bunch " HDCGH " specific to higher plant omega-3-aliphatic acid desaturase gene, and " HGWRISHRTHH " and " HHDIGTHVIHH ", therefore belongs to omega-3-aliphatic acid desaturase family member.
The present invention is by by high mountain ion mustard
cbFAD3gene is connected to eukaryotic expression carrier pYes2 importing and carries out semi-lactosi induction in S. cervisiae INVScl, aminoacid sequence shown in expressing protein size with SEQ ID NO.2 conforms to (as shown in Figure 1), and this transgenic yeast of catalysis has produced linolenic acid C18:3(as shown in Figure 2 after adding external source linolic acid C18:2), thus to demonstrate: the gene order as SEQ ID NO.1 the 1st to 1161 can give expression to have functionally active as the 1st protein to the amino acid residue sequence shown in 386 in SEQ ID NO.2.
3, the present invention is by by high mountain ion mustard
cbFAD3gene is connected on carrier pBI121 and proceeds to tobacco Ben Saimushi (Nicotiana benthamiana) again in importing Agrobacterium GV3101.Utilize gas chromatograph-mass spectrometer to carry out analysis to the total fatty acids of transfer-gen plant to find, the C18:3/C18:2 ratio of its root, stem, leaf is 3.1 times, 1.6 times of wild type control tobacco and 1.9 times (as shown in Figure 9) respectively, shows the high mountain ion mustard proceeded to
cbFAD3gene significantly improves the trienic acid content of tobacco really.Found by low temperature, Drought and salt stress experiment, the growth conditions (as Suo Shi Fig. 3 ~ 8) of transgene tobacco and the physical signs (as shown in Figure 10) of membrane stage are all significantly better than wild type control tobacco.These all illustrate high mountain ion mustard
cbFAD3gene can improve cold-resistant, drought resisting and the saline-alkaline tolerance of transgene tobacco really simultaneously.
4, due to the high mountain ion mustard in the present invention
cbFAD3gene has ability and the resistance of stronger generation trienic acid, therefore, utilizes this gene can be cultivated the tobacco with comprehensive resistance by genetic engineering technique, thus the kind of improvement tobacco.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, the specific embodiment of the present invention is described in further detail.
Fig. 1 is high mountain ion mustard of the present invention
cbFAD3gene is induced the electrophoretic analysis of eukaryotic expression albumen on SDS-PAGE glue of 3d in yeast saccharomyces cerevisiae INVScl by semi-lactosi.
Fig. 2 is that the present invention contains high mountain ion mustard
cbFAD3the total fatty acids gas chromatograph-mass spectrometer collection of illustrative plates of yeast saccharomyces cerevisiae INVScl after adding linolic acid C18:2 of gene.Wherein A for add semi-lactosi induction before; B for add semi-lactosi induction after.
Fig. 3 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild type control are at the growth conditions of 25 DEG C.Wherein: WT is wild type control; L2 is transfer-gen plant.
Fig. 4 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and the wild type control growth conditions at-2 DEG C of process 24hr and after recovering 4hr at 4 DEG C.Wherein: WT is wild type control; L2 is transfer-gen plant.
Fig. 5 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and the wild type control growth conditions when normally watering.Wherein: WT is wild type control; L2 is transfer-gen plant.
Fig. 6 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and wild type control are cutting off the water supply 10d growth conditions after rehydration 4hr.Wherein: WT is wild type control; L2 is transfer-gen plant.
Fig. 7 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and the growth conditions of wild type control under normal incubation medium.Wherein: WT is wild type control; L2 is transfer-gen plant.
Fig. 8 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and the growth conditions of wild type control after applying 10%NaCl process 24hr.Wherein: WT is wild type control; L2 is transfer-gen plant.
Fig. 9 is that the present invention turns high mountain ion mustard
cbFAD3the tobacco L2 of gene and the unsaturated fatty acids ratio change of wild type control.Wherein: WT is wild type control; L2 is transfer-gen plant.
Figure 10 is that the present invention turns high mountain ion mustard
cbFAD3the relative conductivity change before and after low temperature, Drought and salt Stress treatment of the tobacco L2 of gene and wild type control.Wherein: WT is wild type control; L2 is transfer-gen plant.
Embodiment
In the following example of the present invention, experiment material used is high mountain ion mustard (Chorispora bungeana) and tobacco Ben Saimushi (Nicotiana benthamiana).
embodiment 1high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene, the aminoacid sequence of the endoplasm net type omega-3-aliphatic acid desaturase of this genes encoding is if SEQ ID NO.2 in sequence table the 1st is to shown in 386, and its nucleotide sequence is if SEQ ID NO.1 in sequence table the 1st is to shown in 1161.
One, high mountain ion mustard
cbFAD3gene clone.
1. high mountain ion mustard
cbFAD3gene is conserved sequence amplified:
1.1. the total serum IgE in the Plant RNA extraction test kit extraction high mountain ion mustard callus of Omega company is utilized.
1.2. utilize the PrimeScript 1st Strand cDNA synthetic agent box of Takara company to carry out reverse transcription reaction and obtain cDNA.
1.3. according to U.S. NCBI(National Center forBiotechnology Information) gene order of database retrieval designs following degenerated primer:
Sense Primer:5 '-GGGCGGC
kaTTCCTAAGCA
yt-3 ' (degeneracy=4)
Antisense Primer:5 '-GC
raGCATGGG
saGAGG
raCAG-3 ' (degeneracy=8)
1.3. high mountain ion mustard
cbFAD3gene conserved sequence pcr amplification:
Reaction system (50 μ l): cDNA 2.5 μ l, TaKaRa LA Taq(5 U/ μ l) 0.5 μ l, 10 × LA Taq Buffer II(Mg2+ free) 5 μ l, MgCl
2(25 mM) 5 μ l, dNTP Mix(2.5 mM) 8 μ l, Sense Primer 1 μ l (10 μMs), Antisense Primer 1 μ l (10 μMs), ddH2O 27 μ l.
Reaction conditions: 94 DEG C, 3min
(94 DEG C, 1min; 56 DEG C, 15s; 61 DEG C, 15s; 72 DEG C, 1min
)30 circulations
72℃，10min
1.4. high mountain ion mustard
cbFAD3gene conserved sequence checks order:
(1) above-mentioned PCR primer is carried out electrophoresis (220V, 170A) on the sepharose of 1%, under ultraviolet lamp, cut the band meeting amplification size, reclaim test kit with the DNA gel of Axygen company and reclaim.
(2) high mountain ion mustard
cbFAD3the clone of gene conserved sequence and the qualification of positive recombinant are carried out according to the pEASY-Blunt Cloning test kit of TransGen company.
(3) the positive recombinant identified is delivered to the order-checking of Shanghai Majorbio company.
2. high mountain ion mustard
cbFAD3gene 3 ' holds amplification:
2.1. according to high mountain ion mustard
cbFAD3gene conserved sequence designs following Auele Specific Primer:
Outer Primer: 5’- TGAAAACGACGAGTCCTGGGTTCCGCTA-3’
Inner Primer: 5’- CTTCACTCCTTCATCCTCGTTCCTTACC -3’
2.2. high mountain ion mustard
cbFAD3the synthesis of gene cDNA (3 ' RACE) is carried out according to the SmartRACE test kit specification sheets of Invitrogen company.
2. 3. carry out PCR reaction according to the SmartRACE test kit of Invitrogen:
(1) Outer PCR reacts.
Reaction system (50 μ l): cDNA (3 ' RACE) 2.5 μ l, Outer primer (10uM) 1 μ l, 10 × UPM 5 μ l, ddH
20 34.5 μ l, 10 × BD Advantage 2 PCR Buffer 5 μ l, dNTP Mix(20mM) 1 μ l, 50 × BD Advantage 2 Phymerase Mix 1 μ l.
Reaction conditions:
(94 DEG C of 30s; 68 DEG C, 30s; 72 DEG C, 3min
)25 circulations.
(2) Inner PCR reacts.
Reaction system (50 μ l): Outer PCR cut back 5 μ l, Inner primer (10uM) 1 μ l, 10 × NUP 5 μ l, ddH
20 32 μ l, 10 × BD Advantage 2 PCR Buffer 5 μ l, dNTP Mix(20mM) 1 μ l, 50 × BD Advantage 2 Phymerase Mix 1 μ l.
Reaction conditions with in the present embodiment 2.3 (1).
2.4. high mountain ion mustard
cbFAD3gene 3 ' holds sequence measurement with in the present embodiment 1.4.
3. high mountain ion mustard
cbFAD3gene 5 ' end increases:
3.1. according to high mountain ion mustard
cbFAD3gene conserved sequence designs following Auele Specific Primer:
Outer Primer： 5’- GAGGCACAGTGTATCTGAGCATTCGA -3’
Inner Primer：5’- GGTAAGGAACGAGGATGAAGGAGTGAAG -3’
3.2. high mountain ion mustard
cbFAD3the synthesis of gene cDNA (5 ' RACE) is carried out according to the SmartRACE test kit specification sheets of Invitrogen company.
3. carry out PCR reaction according to the SmartRACE test kit of Invitrogen:
(1) Outer PCR reacts.
Reaction system (50 μ l): cDNA (5 ' RACE) 2.5 μ l, remaining reaction agent with in the present embodiment 2.3 (1).
Reaction conditions with in the present embodiment 2.3 (1).
(2) Inner PCR reacts.
Reaction system (50 μ l) and reaction conditions with in the present embodiment 2.3 (1).
3.4. high mountain ion mustard
cbFAD3gene 5 ' end sequence measurement is with in the present embodiment 1.4.
4. gene splicing:
4.1. by high mountain ion mustard
cbFAD3gene conserved sequence, 3 ' end and 5 ' end group are spliced by DNAstar software because of sequencing result, obtain gene cDNA sequence total length.
5. full length gene cDNA sequence amplification:
5.1. utilize cDNA for template design primer as follows:
CbFAD3s：5’-GCTCTAGAATGGTTGTTGCAATGGACCA-3’
CbFAD3a：5’-CGAGCTCCTAATTGATTTTAGATTTGTCAG-3’
Reaction system (50 μ l): cDNA 2.5 μ l, TaKaRa LA Taq(5 U/ μ l) 0.5 μ l, 10 × LA Taq Buffer II(Mg2+ free) 5 μ l, MgCl2(25 mM) 5 μ l, dNTP Mix(2.5 mM) 8 μ l, CbFAD3s (10 μMs) 1 μ l, CbFAD3a (10 μMs) 1 μ l, ddH
2o 27 μ l.
Reaction conditions: 94 DEG C, 3min
(94 DEG C, 1min; 58 DEG C, 30s; 72 DEG C, 1min
)30 circulations
72℃，10min
5.2. high mountain ion mustard
cbFAD3gene cDNA sequence sequence measurement is with in the present embodiment 1.4.Order-checking obtains
cbFAD3the coding region of gene as shown in SEQ ID NO.1 in sequence table, from initiator codon to terminator codon overall length 1161 bases.
embodiment 2high mountain ion mustard
cbFAD3the eukaryotic expression of gene in yeast saccharomyces cerevisiae INVScl
1. build carrier for expression of eukaryon pYES2-
cbFAD3
1.1. as follows according to coding region sequence design primer:
Z3-UP：5’-GGATCCACCATGGTTGTTGCAATGGACCA -3’
Z3-DN：5’- CGAGCTCTAATTGATTTTAGATTTGTCAG -3’
1.2. high mountain ion mustard
cbFAD3gene amplification:
Reaction system (50 μ l): cDNA 2.5 μ l, TaKaRa LA Taq(5 U/ μ l) 0.5 μ l, 10 × LA Taq Buffer II(Mg2+ free) 5 μ l, MgCl2(25 mM) 5 μ l, dNTP Mix(2.5 mM) 8 μ l, CbFAD3s (10 μMs) 1 μ l, CbFAD3a (10 μMs) 1 μ l, ddH
2o 27 μ l.
Reaction conditions: 94 DEG C, 3min
(94 DEG C, 1min; 56 DEG C, 15s; 63 DEG C, 15s; 72 DEG C, 1min
)30 circulations
72℃，10min
1.3. high mountain ion mustard
cbFAD3the recovery method of gene is same
embodiment 1middle 1.4. (1).
1.4. high mountain ion mustard CbFAD3 gene is cut with the enzyme of expression vector pYES2 plasmid and is connected:
(1) will reclaim product and expression vector pYES2 plasmid (FunGenome company) carries out double digestion respectively with restriction enzyme BamHI and SacI of Takara company.Reaction system (20 μ l): DNA 7 μ l, BamHI (50 U/ μ l) 1 μ l, SacI1 (50 U/ μ l) 1 μ l, 10 × K Buffer 1 μ l, ddH
2o 10 μ l.37 DEG C, enzyme cuts 4hr.
(2) the recovery method of digestion products is same
embodiment 1middle 1.4. (1).
(3) the fragment that is inserted into after being cut back to close by enzyme is connected with the DNA Ligation test kit of carrier according to Takara company.
(4) get 5 μ l to connect products and add in the competent cell of 50 μ l bacillus coli DH 5 alphas and transform, adopt penbritin (Amp) resistance screening, the bacterium colony grown is directly with PCR qualification, and the positive colony identified is delivered to the order-checking of Shanghai Majorbio company, sequencing result obtains
cbFAD3the coding region of gene cDNA sequence, as shown in sequence table SEQ ID NO.1, confirms expression vector pYES-
cbFAD3successfully construct.
2. expression vector pYES-
cbFAD3import yeast saccharomyces cerevisiae INVScl
2.1. the plasmid extraction test kit of Axygen company is utilized to extract containing expression vector pYES-
cbFAD3the plasmid of positive colony.
2.2. will containing expression vector pYES-
cbFAD3plasmid import in yeast saccharomyces cerevisiae INVScl according to the efficient Yeast Transformation Kit of FunGenome company.
2.3. utilize the efficient yeast plasmid of FunGenome company to reclaim test kit and reclaim yeast plasmid, and deliver to the order-checking of Shanghai Majorbio company, sequencing result obtains
cbFAD3the coding region of gene, as shown in sequence table SEQ ID NO.1, confirms expression vector pYES-
cbFAD3successfully import in yeast saccharomyces cerevisiae INVScl.
3. the expression of albumen and qualification:
3.1. the extraction of expressing protein:
(1) will containing expression vector pYES-
cbFAD3yeast saccharomyces cerevisiae INVScl special culture solution (0.3%YSDMS+0.26%YNB+0.75% (NH
4)
2sO
4+ 1%NP-40+2% raffinose) at 28 DEG C, 180rpm shakes training 48hr.Add 2% semi-lactosi during induction and cultivate 3d.
(2), after inducing culture terminates, draw the bacterium liquid of the non-abduction delivering of 1ml and abduction delivering respectively in the centrifuge tube of 1.5ml, the centrifugal 3min of 5000rpm, abandons supernatant.Add 1ml ddH
2after O is resuspended, the centrifugal 3min of 5000rpm, abandons supernatant.Repetitive operation once.Add 100 μ l 2 × SDS-PAGE sample-loading buffers (100mmol/L Tris pH6.8,4%SDS, 0.2% tetrabromophenol sulfonphthalein, 20% glycerine, 2% β mercaptoethanol), 100 DEG C of water-bath 10min.Be cooled to room temperature, 3000rpm, centrifugal 10s.Get 5 μ l supernatant liquors and carry out SDS-PAGE electrophoresis (voltage stabilizing: concentrated glue 80V, separation gel 120V).The albumen size that abduction delivering goes out is about 44.18KD(as shown in Figure 1), predict with the aminoacid sequence shown in sequence table SEQ ID NO.2 and conform to.
3.2. the functional verification of expressing protein:
(1) containing expression vector pYES-
cbFAD3the nutrient solution of yeast saccharomyces cerevisiae INVScl and cultural method with 3.1. in the present embodiment (1).2% semi-lactosi is added and final concentration is that the C18:2(of 100 μMs is purchased from sigma company during induction) cultivate 3d.
(2), after inducing culture terminates, collect the bacterium liquid of the non-abduction delivering of 20ml and abduction delivering respectively in the centrifuge tube of 50ml, the centrifugal 3min of 5000rpm, abandons supernatant.Add 20ml ddH
2after O is resuspended, the centrifugal 3min of 5000rpm, abandons supernatant.Repetitive operation once.Add 5ml 1M NaOH (methyl alcohol), 70 DEG C of water-bath 30min.6M HCl adjust pH to 1 is added after cooling.Add 5ml 10%BF
3(methyl alcohol), 70 DEG C of water-bath 5min.The saturated NaCl solution of 10ml is added, with 5ml CH after cooling
2cl
2/ normal hexane (1:4, V:V) extracting twice, combining extraction liquid is dry obtains total fatty acids.
(3) total fatty acids composition analysis uses U.S. Agilent company 6890N type gas-chromatography and 5975C GC-MS.
Chromatographic condition: quartz capillary column (Agilent DB-FFAP, 30.0m × 250.0 μm × 0.5 μm), sample size is 0.2 μ l; Splitting ratio is 100:1; Injector temperature is 200 DEG C; Temperature programming, from 70 DEG C, rises to 190 DEG C with 10 DEG C/min, keeps 2min, then rises to 230 DEG C of maintenance 12 min with 8 DEG C/min; Column flow rate is 1.1 mL/min; Carrier gas is high-purity helium (99.999%).
Mass Spectrometry Conditions: ionizer is 70 eV; Ion source temperature 230 DEG C; Level Four bar temperature 150 DEG C; Interface temperature is 250 DEG C; Solvent delay is 1. 5 min.
Result display (as shown in Figure 2) is containing expression vector pYES-
cbFAD3yeast saccharomyces cerevisiae INVScl can catalysis produce linolenic acid C18:3.Illustrate that the gene coding region as shown in sequence table SEQ ID NO.1 can give expression to the protein as shown in the amino-acid residue of sequence table SEQ ID NO.2 that catalysis linolic acid C18:2 dehydrogenation produces linolenic acid C18:3 activity really.
embodiment 3turn high mountain ion mustard
cbFAD3the acquisition of genetic tobacco
1. build carrier for expression of eukaryon pBI121-
cbFAD3
1.1. as follows according to coding region sequence design primer:
ZF3： 5’-GCTCTAGAATGGTTGTTGCAATGGACCA- 3’
ZF3’： 5’ -CGAGCTCCTAATTGATTTTAGATTTGTCAG- 3’
1.2. high mountain ion mustard
cbFAD3gene amplification:
Reaction system is same
embodiment 2in 1.2
Reaction conditions: 94 DEG C, 3min
(94 DEG C, 1min; 60 DEG C, 30s; 72 DEG C, 1min
)30 circulations
72℃，10min
1.3. high mountain ion mustard
cbFAD3the recovery method of gene is same
embodiment 1middle 1.4. (1).
1.4. high mountain ion mustard CbFAD3 gene is cut with the enzyme of expression vector pBI121 plasmid and is connected:
(1) the recovery product of 1.2 and expression vector pBI121 plasmid (preservation of this laboratory) are carried out double digestion respectively with restriction enzyme XbaI and SacI of Takara company.Reaction system (20 μ l): DNA 7 μ l, XbaI (50 U/ μ l) 1 μ l, SacI1 (50 U/ μ l) 1 μ l, 10 × M Buffer 2 μ l, ddH
2o 10 μ l.37 DEG C, enzyme cuts 4hr.
(2) the recovery method of digestion products is same
embodiment 1middle 1.4. (1).
(3) the fragment that is inserted into after being cut back to close by enzyme is connected with the DNA Ligation test kit of carrier according to Takara company.
(4) get 5 μ l to connect products and add in the competent cell of 50 μ l bacillus coli DH 5 alphas and transform, adopt kantlex (Kan) resistance screening, the bacterium colony grown is directly with PCR qualification, and the positive colony identified is delivered to the order-checking of Shanghai Majorbio company, sequencing result obtains
cbFAD3the coding region of gene cDNA sequence, as shown in sequence table SEQ ID NO.1, confirms expression vector pBI121-
cbFAD3successfully construct.
2. expression vector pBI121-
cbFAD3import Agrobacterium GV3101
2.1. the plasmid pBI121-that triparental mating will build is utilized
cbFAD3agrobacterium GV3101 is transferred to from bacillus coli DH 5 alpha.
2.2. the plasmid extraction test kit of Axygen company is utilized to extract containing expression vector pYES-
cbFAD3the plasmid of positive colony, and deliver to the order-checking of Shanghai Majorbio company, sequencing result obtains
cbFAD3the coding region of gene, as shown in sequence table SEQ ID NO.1, confirms expression vector pBI121-
cbFAD3successfully import in Agrobacterium GV3101.
3. utilize leaf disk method transformation of tobacco:
Picking contains pBI121-
cbFAD3single bacterium colony, in 28 DEG C, it is 0.6 ~ 0.8 that 180rpm cultivates about 12hr to OD 600 to be inoculated into (Rif 40 μ g/ml, Kan 100 μ g/ml) in 1ml YEP nutrient solution.By bacterium liquid in 1% ratio, proceed to 50ml new containing in antibiotic YEP nutrient solution, in 28 DEG C, it is 0.4 ~ 0.6 that 180rpm cultivates 6hr to OD600.Get the young leaflet tablet of wild-type tobacco aseptic seedling, remove master pulse, be cut into 0.5cm
2fritter, put into bacterium liquid, soak 10min.After sucking unnecessary bacterium liquid with aseptic filter paper, by blade inoculation on MS+KT (2.0 μ g/ml)+NAA (0.4 μ g/ml) solid medium, 28 DEG C of light culture 2d.Blade after Dual culture is transferred to the enterprising row filter of MS+KT (2.0 μ g/ml)+NAA (0.4 μ g/ml)+Kan (80 μ g/ml)+Cef (300 μ g/ml) solid medium to cultivate, 12h/d illumination cultivation, the growth of induced bud.After 30d, when indefinite bud grows to about 1cm, cut indefinite bud and transfer on 1/2MS+NAA (0.1 μ g/ml)+Cef (200 μ g/ml) and carry out root culture, obtain whole plant.
4. transfer-gen plant checking:
Utilize the magnetic bead plant DNA extraction kit of Omega company to extract the STb gene of transformation of tobacco, PCR detects
cbFAD3whether gene proceeds to, and (extracting method is same to extract total serum IgE further to the plant amplifying appropriate band
in embodiment 1 1.1), obtaining cDNA, is that template carries out PCR detection further with cDNA, and qualification transforms successful transfer-gen plant.Found that the successful transfer-gen plant of 5 strain, respectively called after L1, L2, L3, L4 and L5.
embodiment 4high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene is improving the application in tobacco resistance.By detecting cold-resistant, the drought resisting that shows transgene tobacco to the total fatty acids analysis of transgene tobacco and resistance and saline-alkaline tolerance is all significantly higher than wild type control.
1. the total fatty acids analysis of transgene tobacco:
Choose the F1 generation (still called after L2) of the transfer-gen plant L2 crossed through MS+KT (2.0 μ g/ml) Screening of Media as total fatty acids analytic target.Get the root of 1g strain to be detected, stem, leaf respectively, in mortar, add quartzite sand grind.Total fatty acids extraction and analytical procedure are together
embodiment 2middle 3.2. (2) ~ (3).Result shows, and turns
cbFAD3the C18:3/C18:2 ratio of genetic tobacco root, stem, leaf, all higher than wild type control tobacco (as shown in Figure 9), shows the high mountain ion mustard proceeded to
cbFAD3gene significantly improves the trienic acid content of tobacco really.
2. the resistance of transgene tobacco detects:
The object that the F1 generation (still called after L2) choosing the transfer-gen plant L2 crossed through MS+KT (2.0 μ g/ml) Screening of Media detects as cold-resistant, drought resisting and salt resistance, by wild-type plant in contrast.Low temperature stress: transfer-gen plant and adjoining tree are placed in simultaneously-2 DEG C process 24hr after, then in 4 DEG C recover 4hr.Drought stress: by transfer-gen plant and adjoining tree natural drought 10day simultaneously, and then rehydration 4hr.Salt stress: apply 10%NaCl solution-treated 24hr simultaneously to transfer-gen plant and adjoining tree.After above-mentioned process completes, observe Reducing sugar immediately, and measure blade plasma membrane example rate of permeation.Found that, wild-type after treatment plant is seriously impaired, and here blade obviously withers, and transfer-gen plant still keeps good vitality (as Suo Shi Fig. 3 ~ 8), and the membrane leakage of transfer-gen plant is significantly less than wild-type (as shown in Figure 10).Show that cold-resistant, drought resisting and the saline-alkaline tolerance of transgene tobacco are all significantly higher than wild type control.
SEQ ID NO.1
1 ATGGTTGTTG CAATGGACCA ACGCAGCAGC AATGTGAAGG GAGATTCCGG CGCCGGAGAG CGGAAGGAGA GGGGTTTGA
81 TCCGAGCGCA CAGCCTCCGT TCAAGATCGG AGATATAAGG GCGGCGATTC CTAAGCACTG CTGGGTGAAG AGTCCTTTGA
161 GATCGATGAG TTACGTCGTC AGAGACATCA TCGCCGTCGC GTCTCTTGCC GTCGCCGCCG TGTATTTTGA CACCTGGTTC
241 CTCTGGCCTC TCTATTGGGC CGCCCAAGGA ACCCTTTTCT GGGCCATCTT CGTTCTCGGC CACGACTGTG GACATGGGAG
321 TTTCTCAGAC ATTCCTCTGC TCAATAGTGT GGTTGGTCAC ATTCTTCACT CCTTCATCCT CGTTCCTTAC CATGGTTGGA
401 GAATAAGCCA TCGGACACAC CACCAGAACC ATGGCCATGT TGAAAACGAC GAGTCCTGGG TTCCGCTACC AGAAAGGGTG
481 TACAAGAAAT TACCACACAG TACTCGAATG CTCAGATACA CTGTGCCTCT CCCCATGCTC GCTTATCCTC TCTATCTGTG
561 GTACAGAAGT CCAGGAAAAG AAGGGTCACA TTTTAACCCA AACAGTAGTT TATTTGCACC AAGCGAGAGA AAGCTTATCG
641 CAACATCAAC CACTTGTTGG TCCATTATGT TGTCCATTCT CATCTTTCTT TCTTTCACCG TTGGTCCACT CTCCGTTCTC
721 AAAGTCTACG GTGTCCCTTA CATCATCTTT GTGATGTGGT TGGACGCTGT CACGTATCTG CACCATCACG GTTACGACGA
801 GAAGTTGCCT TGGTACAGAG GCAAAGAATG GAGTTATCTA CGTGGAGGAT TAACGACAGT GGACAGAGAT TACGGGATCT
881 TCAACAACAT TCATCACGAC ATTGGAACTC ACGTCATACA CCATCTCTTC CCACAGATCC CTCACTATCA TCTTGTCGAT
961 GCCACGAAGG CAGCGAAACA CGTGTTGGGT AGATACTACA GAGAACCGAA GAGGTCAGGA GCGATACCGG TCCATTTGGT
1041 TGAGAGTTTG GTCGCTAGTA TTAAGAAAGA TCATTACGTT AGGGACACTG GTGATATCGT CTTCTACGAG ACTGATCCAG
1121 ATCTCTACGT TTATGCTTCT GACAAATCTA AAATCAATTA G
SEQ ID NO.2
1 MVVAMDQRSS NVKGDSGAGE RKEKGFDPSA QPPFKIGDIR AAIPKHCWVK SPLRSMSYVV RDIIAVASLA VAAVYFDTWF
81 LWPLYWAAQG TLFWAIFVLG HDCGHGSFSD IPLLNSVVGH ILHSFILVPY HGWRISHRTH HQNHGHVEND ESWVPLPERV
161 YKKLPHSTRM LRYTVPLPML AYPLYLWYRS PGKEGSHFNP NSSLFAPSER KLIATSTTCW SIMLSILIFL SFTVGPLSVL
241 KVYGVPYIIF VMWLDAVTYL HHHGYDEKLP WYRGKEWSYL RGGLTTVDRD YGIFNNIHHD IGTHVIHHLF PQIPHYHLVD
321 ATKAAKHVLG RYYREPKRSG AIPVHLVESL VASIKKDHYV RDTGDIVFYE TDPDLYVYAS DKSKIN
Claims (1)
1. high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene is improving the application in tobacco resistance, it is characterized in that: this high mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene source is in high mountain ion mustard, the aminoacid sequence of the endoplasm net type omega-3-aliphatic acid desaturase of described genes encoding is if SEQ ID NO.2 in sequence table the 1st is to shown in 386, and its nucleotide sequence is if SEQ ID NO.1 in sequence table the 1st is to shown in 1161.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410024462.7A CN103740739B (en) | 2014-01-20 | 2014-01-20 | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201410024462.7A CN103740739B (en) | 2014-01-20 | 2014-01-20 | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103740739A CN103740739A (en) | 2014-04-23 |
| CN103740739B true CN103740739B (en) | 2015-09-23 |
Family
ID=50497804
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410024462.7A Active CN103740739B (en) | 2014-01-20 | 2014-01-20 | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103740739B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116064436A (en) * | 2023-02-17 | 2023-05-05 | 西南大学 | Loquat EjFADC1 gene, protein coded by same and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2084348A1 (en) * | 1991-12-31 | 1993-07-01 | David F. Hildebrand | Fatty acid alteration by a d9 desaturase in transgenic plant tissue |
| CN100460506C (en) * | 2006-06-15 | 2009-02-11 | 中国人民解放军军事医学科学院生物工程研究所 | Omega-3-aliphatic acid desaturase, and its encoding gene and use thereof |
| CN102021188A (en) * | 2010-09-10 | 2011-04-20 | 兰州大学 | Artemisia sphaerocephala delta 12 fatty acid desaturase (As FAD2) gene and application |
-
2014
- 2014-01-20 CN CN201410024462.7A patent/CN103740739B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103740739A (en) | 2014-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ahmad et al. | Stress-induced expression of choline oxidase in potato plant chloroplasts confers enhanced tolerance to oxidative, salt, and drought stresses | |
| JP6103607B2 (en) | Plant suitable for high-density planting and use thereof | |
| CN107435047B (en) | Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof | |
| JP5876216B2 (en) | Polynucleotide encoding NF-YB derived from Jatropha and use thereof | |
| CN102002101B (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| Zárate et al. | Tailoring tropane alkaloid accumulation in transgenic hairy roots of Atropa baetica by over-expressing the gene encoding hyoscyamine 6β-hydroxylase | |
| CN102161996B (en) | Jujube tree ascorbate peroxidase gene and application thereof in improving stress resistance of plants | |
| JP5527654B2 (en) | Genes for increasing production of plant oils and methods of use thereof | |
| CN104004073B (en) | Derive from disease resistance associated protein TaCPK7-R of Semen Tritici aestivi and relevant biological material thereof and application | |
| CN103130885A (en) | Malus sieversii (Ledeb.) Roem-derived plant growth-related protein, and coding gene and application thereof | |
| CN105695482A (en) | Brassica napus nuclear transcription factor NF-YA gene BnNF-YA3 and application thereof | |
| US20050172361A1 (en) | Regulation of gene expression in plant cells | |
| CN105481958A (en) | Application of protein OsOSM1 to regulation and control over plant disease resistance | |
| CN103740739B (en) | High mountain ion mustard endoplasm net type omega-3-aliphatic acid desaturase gene and application thereof | |
| CN103923196A (en) | Disease-resistance gap-associated protein TaPK-R1 derived from wheat as well as related biological material and application thereof | |
| CN103436536A (en) | Peanut FUS3 transcription factor gene, and encoding protein and application of peanut FUS3 transcription factor gene | |
| CN110452917A (en) | The application of bryony VyGOLS gene and its coding albumen in drought stress | |
| CN102533804B (en) | Artemisia sphaerocephala krasch delta 12 fatty acid dehydrogenase (As flavin adenine dinucleotide 2 (FAD2)) gene and application | |
| CN113046375B (en) | SpCPK33 gene and application of encoding protein thereof in regulation and control of drought tolerance of tomatoes | |
| CN104372019A (en) | Method for culturing and identifying CmWRKY48 trans-genetic chrysanthemum morifolium and application of trans CmWRKY48 genetic chrysanthemum morifolium | |
| CN104877021A (en) | Rapeseed transcription factor BnFUS3 related to plant fatty acid and fat metabolism and coding gene and application thereof | |
| TW202102528A (en) | Isolated transcriptional enhancer sequence, a modified promoter sequence comprising the same and use thereof | |
| CN109810984A (en) | A kind of relevant Sesame SiGolS6 of drought resisting and its application | |
| CN106480089A (en) | A kind of method improving Semen sojae atricolor sulfur amino acid content and reducing allergen protein | |
| CN109295024A (en) | It reduces OsSAMS1 albumen and its encoding gene expression is improving plant to the application in fractilinea oryzae resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20200820 Address after: 730000 No.318, Donggang West Road, Chengguan District, Lanzhou City, Gansu Province Patentee after: NORTHWEST INSTITUTE OF ECO-ENVIRONMENT AND RESOURCES, CAS Address before: Chengguan District of Gansu city of Lanzhou province Donggang West Road 730000 No. 320 Patentee before: Institute of environment and Engineering in cold and dry areas, Chinese Academy of Sciences |