CN103710438B - The method in detection RUNX1 gene the 5th exons mutation site and primer - Google Patents
The method in detection RUNX1 gene the 5th exons mutation site and primer Download PDFInfo
- Publication number
- CN103710438B CN103710438B CN201310665776.0A CN201310665776A CN103710438B CN 103710438 B CN103710438 B CN 103710438B CN 201310665776 A CN201310665776 A CN 201310665776A CN 103710438 B CN103710438 B CN 103710438B
- Authority
- CN
- China
- Prior art keywords
- runx1
- exon5
- primer
- gene
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention discloses method and the primer in detection RUNX1 gene the 5th exons mutation site, and the forward and reverse primer and comprising amplification RUNX1 gene the 5th exons mutation site is to sequencing primer. By Touch-down? pcr amplification and Sanger order-checking combine, and can detect the catastrophe in RUNX1 gene the 5th exon site in patients with acute myeloid leukemia body fast.
Description
Technical field
The invention belongs to life science and biological technical field, in particular to method and the primer in detection RUNX1 gene the 5th exons mutation site.
Background technology
Acute myeloid leukaemia (AML) is due to the marrow system hematopoietic stem/progenitor acquired gene alteration of generation cumulative bad, causes a kind of malignant disease that cell proliferation, differentiation and apoptosis pathway change.
RUNX1 is also called AML1, is one of member in RUNX transcription factor protein family, is the most common target site of chromosomal translocations of human leukemias. RUNX1 is very important transcription factor, two-way (promote or suppress) can regulate hematopoiesis correlation factor, thus regulates the differentiation of hemopoietic stem cell, withers and die and self. RUNX1 point mutation often can occur in myelodysplastic syndrome (MDS), AML, chronic myelomonocytic leukemia (CMML), more rare in bone marrow proliferative tumour (MPN). Having research to point out, the mutation rate of RUNX1 is be 37% in 23%, CMML in 32%, MDS in AML. In leukemia of children cell, it has been found that multiple nonrandom chromosome translocation, wherein RUNX1 gets involved at most, accounts for leukemia of children case more than 30%, such as t (12; 21) (TEL-RUNX1), t (8; 21) (RUNX1-ETO/MTG8), t (16; 21) (RUNX1-MTG16) etc.RUNX1 sudden change indication patient's prognosis mala. Patient carries out RUNX1 Mutation Screening may contribute to carrying out clinical risk stratification and formulating Treatment decsion.
During document is reported, although people do not find that RUNX1 gene exists mutantional hotspot, but the catastrophe of its 1-8 exon generally all can be detected. Document report the 3rd, 4,5,8 exon is separately had to occur that the probability of sudden change is higher, mainly for the detection of the 5th exons mutation situation in the present invention.
Method restrictive fragment length polymorphism (SSCP) of current available detection in Gene Mutation, gene sequencing, Manganic pyrophosphate complex initiation, quantitative fluorescent PCR etc. SSCP technology is relatively simple, but restriction enzyme site is subject to genovariation impact, affects result and judges, due to the technical limitation of method itself, detection sensitivity is low. Although adopting fluorescence quantitative PCR method detection sensitivity higher, the used time is shorter, but and is not suitable for the detection of RUNX1 gene the 5th exons mutation. It is longer and relate generally to 5 mutational sites that reason is to detect the exon sequence of this gene, and the 198th amino acids site sudden change and the sudden change in the 202nd amino acids site, two continuous print bases can be occurred in, namely 592G > the A sudden change in the 198th amino acids site, 593A > T suddenly change, and the 601C > T in the 202nd amino acids site suddenlys change, 602G > A suddenlys change. Quantitative fluorescent PCR (probe method) mainly is applicable to detect the sudden change of single base, to detect multiple mutational site, then need the design multipair primer of design and many probes, and carry out multitube PCR reaction, also need to use the real-time fluorescence PCR instrument matched simultaneously, this can increase testing cost and sample DNA consumption, and the detection transgenation of the dye method of quantitative fluorescent PCR exists the problem of primer specificity difference, detected result false positive rate height. Manganic pyrophosphate complex initiation technology is due to effective fragment only about 50bp of detection, if being separated by more than 50bp between the multiple sites undergone mutation, so need to design multipair sequencing primer, and carry out multitube PCR reaction, this also can be multiplied testing cost and sample DNA consumption. In addition, prior art is only the unit point sudden change that detection sudden change probability of occurrence is higher, and does not detect the overall catastrophe of the 5th exon.
The present invention adopts Touch-downPCR amplification and the sudden change of Sanger sequencing detection RUNX1 gene the 5th exon, and the primer designed can expand whole 5th exon, comprises all mutational sites to be detected. Touch-downPCR amplification can guarantee that the combination of forward and reverse amplimer and sample DNA template occurs between the most complementary sequence, when annealing temperature is reduced to the level that non-specific amplification occurs, specific amplification products has had the initial advantage of a geometry number at this moment, abundance is higher, in remaining amplified reaction, specific amplification products and non-specific amplification product are competed, but because non-specific amplification product abundance is lower, specific amplification products is preferential amplification all the time, thus produces the single specific amplification products occupied an leading position. And Sanger sequencing is the gold standard of detection transgenation, detected result accuracy height, and save testing cost to a great extent.
Summary of the invention
It is an object of the invention to provide the primer in detection RUNX1 gene the 5th exons mutation site, it is characterised in that, comprising: the forward and reverse primer in amplification RUNX1 gene the 5th exons mutation site; Its base sequence is:
RUNX1-exon5-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R:AATCTGAGACATGGTCCCTG.
Further, described primer also comprises one pair of sequencing primer, and its base sequence is
RUNX1-exon5-S-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R:AATCTGAGACATGGTCCCTG.
Further, the working concentration ratio of described forward and reverse primer is: RUNX1-exon5-F:RUNX1-exon5-R=1:1.
Further, the working concentration ratio of sequencing primer is by described one: RUNX1-exon5-S-F:RUNX1-exon5-S-R=1:1.
Further, the amplification reaction condition of described forward and reverse amplimer is: the first stage, 95 DEG C of denaturation 10min; Subordinate phase, denaturation temperature 94 DEG C of 30sec, annealing temperature 64 DEG C of 90sec, elongating temperature 72 DEG C of 30sec, circulate 16 times, every circulation primary, and described annealing temperature reduces by 0.5 DEG C; Phase III, denaturation temperature 94 DEG C of 30sec, annealing temperature 58 DEG C of 30sec, elongating temperature 72 DEG C of 30sec, circulate 24 times; Fourth stage, 72 DEG C of 10min; Five-stage, amplified reaction terminates, and amplified production preserves at 4 DEG C.
The present invention also aims to provide a kind of method detecting RUNX1 gene the 5th exons mutation site, it comprises the steps:
(1) sample DNA is extracted;
(2) utilize pair for amplification primer RUNX1-exon5-F and RUNX1-exon5-R to be increased by the DNA in (1), obtain amplified production;
(3) utilize one couple of sequencing primer RUNX1-exon5-S-F and RUNX1-exon5-S-R to be checked order by the amplified production in (2), obtain the gene order of described amplified production;
(4) gene order in (3) and RUNX1 gene wild-type reference sequence RUNX1-ref are compared, it is determined that whether mutational site exists, it is characterised in that,
RUNX1-exon5-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R:AATCTGAGACATGGTCCCTG
RUNX1-exon5-S-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R:AATCTGAGACATGGTCCCTG.
Further, the amplification reaction condition of step (2) is: the first stage, 95 DEG C of denaturation 10min; Subordinate phase, denaturation temperature 94 DEG C of 30sec, annealing temperature 64 DEG C of 90sec, elongating temperature 72 DEG C of 30sec, circulate 16 times, every circulation primary, and described annealing temperature reduces by 0.5 DEG C; Phase III, denaturation temperature 94 DEG C of 30sec, annealing temperature 58 DEG C of 30sec, elongating temperature 72 DEG C of 30sec, circulate 24 times; Fourth stage, 72 DEG C of 10min; Five-stage, amplified reaction terminates, and amplified production preserves at 4 DEG C.
The present invention also aims to provide a kind of test kit detecting RUNX1 gene the 5th exons mutation site, it is characterised in that, described test kit comprises sample DNA extraction agent; Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative controls and blank product, wherein detection system PCR reaction solution comprises pair for amplification product RUNX1-exon5-F and RUNX1-exon5-R, order-checking system reaction solution comprises one couple of sequencing primer RUNX1-exon5-S-F and RUNX1-exon5-S-R, it is characterised in that:
RUNX1-exon5-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R:AATCTGAGACATGGTCCCTG
RUNX1-exon5-S-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R:AATCTGAGACATGGTCCCTG.
Further, described test kit also comprises RUNX1 gene wild-type reference sequence RUNX1-ref.
Further, described order-checking refined solution also comprises the order-checking refined solution being made up of alkaline phosphatase and exonuclease I.
The useful effect of the present invention: inventive design amplification RUNX1 gene the 5th exons mutation site is just, reverse primer, construct stable Touch-downPCR amplification system, whole 5th exon is increased, comprise all mutational sites to be detected, simultaneously when increasing, the specific amplification products that the forward and reverse primer of enrichment and template are correctly matched, it is to increase specific amplification. In addition, by adjusting the reaction conditionss such as the concentration of forward and reverse amplimer, annealing temperature, amplification efficiency can be made to reach best, and adopt Sanger sequencing, sex change after pcr amplification product carries out sequencing reaction amplification, purifying, directly order-checking detect the catastrophe in each mutational site in RUNX1 gene the 5th exon, have highly sensitive, simple to operate and low cost and other advantages.
Accompanying drawing explanation
The detected result figure of Fig. 1 sample 1.
The detected result figure of Fig. 2 sample 2.
The detected result figure of Fig. 3 sample 3.
The detected result figure of Fig. 4 sample 4.
The detected result figure of Fig. 5 sample 5.
The detected result figure of Fig. 6 sample 6.
The detected result figure of Fig. 7 sample 7.
The detected result figure of Fig. 8 sample 8.
Embodiment
Below in conjunction with specific embodiments and the drawings, set forth the present invention further. Should be noted that, normal condition undeclared in embodiment and method, usually according to the conventional employing method of art experimenter: such as, " the fine works molecular biology experiment guide " the 4th edition of Ao Sibai and Jin Sidun chief editor, or the step advised according to manufacturer and condition.
Embodiment 1
The primer in detection RUNX1 gene the 5th exons mutation site, comprising: the forward and reverse primer in amplification RUNX1 gene the 5th exons mutation site; Its base sequence is:
RUNX1-exon5-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R:AATCTGAGACATGGTCCCTG.
Preferably, described primer also comprises one pair of sequencing primer, and its base sequence is
RUNX1-exon5-S-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R:AATCTGAGACATGGTCCCTG.
In the detection, first utilize above-mentioned forward and reverse primer pair RUNX1 gene the 5th exons mutation site to increase, obtain amplified production, then utilize above-mentioned one to be checked order by amplified production by sequencing primer, obtain the gene order of amplified production.
The test kit in detection RUNX1 gene the 5th exons mutation site, comprising: sample DNA extraction agent (such as uses the test kit of sky root biology to carry out extracting sample DNA); Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative controls and blank product, wherein
Detection system PCR reaction solution comprises: 2 �� PCRBuffer; 2mMdNTPs; KODFXDNAPolymerase (1U/ �� l); Forward and reverse primer RUNX1-exon5-F (10 ��m), the RUNX1-exon5-R (10 ��m) in amplification RUNX1 gene the 5th exons mutation site.
Order-checking system reaction solution comprises: order-checking refined solution, EDTA (125mmol), dehydrated alcohol, 75% ethanol, HIDI(height deionized formamide), sequencing primer: RUNX1-exon5-S-F (3.2 ��m), RUNX1-exon5-S-R (3.2 ��m), and BigdyeTerminatorV3.1(buys from AppliedBiosystems company of the U.S.), the refined solution that wherein checks order comprises shrimp alkaline phosphotase (SAP) 0.6U and exonuclease I (EXONI) 1.2U.
Detection system PCR reaction solution preparation of reagents is as follows:
Wherein, the base sequence of RUNX1-exon5-F and RUNX1-exon5-R is:
| Primer | Base sequence |
| RUNX1-exon5-F | ATTAATGATTGGTTATTCAACAG |
| RUNX1-exon5-R | AATCTGAGACATGGTCCCTG |
Positive reference substance: the solution containing RUNX1 sequence.
Negative controls: without the solution of RUNX1 sequence.
Blank product: 2 �� l physiological saline or do not add any material.
Preferably, this test kit also comprises RUNX1 gene wild-type reference sequence RUNX1-ref, and its base sequence is as follows: ATTAATGATTGGTTATTCAACAGATATGTTCAGGCCACCAACCTCATTCTGTTTTG TTCTCTATCGTGTCCCCACAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACA AACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCC CCGAGAACCTCGAAGTAAGTGCATCCACTTGGGGCTGGTACACCCTCCAGGCTGGT ACACCCTCCAGGCTGGTATACTCAGGGACCATGTCTCAGATT.
Embodiment 2
Testing process:
(1) blood DNA extraction agent box (sky root is biological) is utilized to extract the genomic dna in blood sample:
1) extracting 500uL blood and add 1000uL erythrocyte cracked liquid, put upside down mixed even, room temperature places 5 minutes, and period puts upside down mixed even several times again. The centrifugal 5min of 3000rpm, sucks supernatant, leaves white corpuscle precipitation, adds 200uL damping fluid GA, and vibration is to thoroughly mixed even.
2) 20 �� l Proteinase K solution are added, mixed even.
3) adding 200 �� l damping fluid GB, fully put upside down mixed even, place 10 minutes for 70 DEG C, solution strain is limpid, the briefly centrifugal globule to remove cap wall.
4) adding 200 �� l dehydrated alcohols, fully, now may there is flocks, briefly the centrifugal globule to remove cap wall in mixed even 15 seconds of vibration.
5) all adding in an adsorption column CB3 (adsorption column puts into collection tube) by previous step gained solution and flocks, centrifugal 30 seconds of 12,000rpm (13,400 �� g), outwells waste liquid, is put back in collection tube by adsorption column CB3.
6) please first check whether before adding 500 �� l damping fluid GD(uses in adsorption column CB3 and added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 �� g), outwells waste liquid, adsorption column CB3 is put into collection tube.
7) please first check whether before adding 700 �� l rinsing liquid PW(uses in adsorption column CB3 and added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 �� g), outwells waste liquid, adsorption column CB3 is put into collection tube.
8) adding 500 �� l rinsing liquid PW in adsorption column CB3, centrifugal 30 seconds of 12,000rpm (13,400 �� g), outwells waste liquid.
9) putting back in collection tube by adsorption column CB3, centrifugal 2 minutes of 12,000rpm (13,400 �� g), outwells waste liquid. Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.
10) adsorption column CB3 is proceeded in a clean centrifuge tube, the �� l elution buffer TE that adds 100 to unsettled of the middle position of adsorption film, room temperature is placed 2-5 minute, 12,000rpm (13,400 �� g) centrifugal 2 minutes, by solution collection to, in centrifuge tube, obtaining poba gene group DNA solution.
(2) reagent configuration: by the detection person-portion each X �� l of number configuration detection system PCR reaction solution, every person-portion 18 �� l packing:
X=18 �� l reaction solution �� (n part sample+1 part of positive control+1 part of negative control+1 part of blank)
N is detection sample number.
(3) sample is added: join in detection system PCR reaction solution by the poba gene group DNA solution obtained in 2ul step (1);For positive control experiment, directly add 2ul positive reference substance; For negative control experiment, directly add 2ul negative controls; For blank experiment, add 2ul physiological saline or do not add any material.
(4) Touch-downPCR amplification: detection carries out on Standard PCR instrument, obtains pcr amplification product, and available instrument comprises AppliedBiosystems company of the ABIveriti(U.S.) etc. Reaction conditions is as follows:
(5) Sanger order-checking:
Get 9 �� lPCR amplified productions and 2 �� l order-checking refined solution. Carry out purifying according to following program, thus obtain purified product:
1 �� l purified product is mixed according to following system with sequencing primer RUNX1-exon5-S-F (3.2 ��m) and RUNX1-exon5-S-R (3.2 ��m) respectively:
Sequencing reaction program:
Precipitation link:
To completing the EDTA adding 2 �� l125mmol in the product of sequencing reaction, leave standstill 5min; Adding 15ml dehydrated alcohol, whirlpool mixes even; The centrifugal 30min of 3700rpm; Being inverted centrifugal 15sec, add 50ml70% ethanol, whirlpool mixes even; The centrifugal 15min of 3700rpm; It is inverted centrifugal 15sec, it is placed on 95 DEG C of metal baths; Sex change test is carried out after adding 10 �� lHIDI. Sex change program:
After sex change EP (end of program), upper sequenator (ABI3730) checks order, and obtains the gene order of pcr amplification product.
(6) result judges: the gene order obtained in (5) and RUNX1 gene wild-type reference sequence RUNX1-ref is compared, result is reported according to actual catastrophe.
Embodiment 3
Adopt kit for detecting nucleic acid of the present invention detection clinical sample.
Fetching and delivering inspection acute myeloid leukaemia (AML) patient anticoagulation sample 20 example, extract the genomic dna in sample by testing process described in embodiment 2, reagent preparation also detects.
Every part of sample genomic dna solution that 2ul extracts according to testing process described in embodiment 2 is added in detection system PCR reaction solution. Doing the positive, feminine gender and blank, the regular-PCR instrument in 96 holes can detect 46 parts of samples simultaneously simultaneously, and each sample repeats for 2 times, one part of positive control, one part of negative control and one part of blank. Detection time is 160 minutes.
The amplified production of every part of sample genomic dna, after twice Sanger checks order, compares the sequencing sequence that RUNX1 gene the 5th this twice order-checking of exon pcr amplification product obtains, and will carry out third time order-checking for the sample that result is ununified. Utilize multipair primer and many probes to carry out quantitative fluorescent PCR (probe method) detection, to compare with Sanger sequencing simultaneously. Finally, according to sequencing result, prognosis is judged.
Detected result is such as following table:
| Sample number | Detected result of the present invention | Fluorescence detection by quantitative result | Prognosis situation |
| 1 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 2 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 3 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 4 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 5 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 6 | 593A>T | 593A>T | Prognosis mala |
| 7 | 592G>A | 592G>A | Prognosis mala |
| 8 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 9 | 601C>T | 601C>T | Prognosis mala |
| 10 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 11 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 12 | 602G>A | 602G>A | Prognosis mala |
| 13 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 14 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 15 | 524T>C | 524T>C | Prognosis mala 7--> |
| 16 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 17 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 18 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 19 | Do not suddenly change | Do not suddenly change | Prognosis is good |
| 20 | Do not suddenly change | Do not suddenly change | Prognosis is good |
As can be seen from the above table, in 20 example samples, RUNX1 gene the 5th exon that the present invention detects out in 5 example samples is undergone mutation, i.e. 524T > C, 592G > A, 593A > T, 601C > T and 602G > A, and gives prognosis according to variation result and instruct.According to this table, still further it can be seen that the detected result of the present invention in 20 example sample RUNX1 gene the 5th exons mutation sites is consistent with quantitative fluorescent PCR (probe method) detected result, and detection method accuracy height is described. The multipair primer simultaneously used in quantitative fluorescent PCR (probe method) owing to not using, many saltant type probes and many wild-type probe, also just without the need to carrying out multitube PCR reaction, the real-time fluorescence quantitative PCR instrument of the high cost simultaneously also matched with it without the need to using, thus reduce testing cost, decrease sample consumption. In addition, before carrying out Sanger order-checking, sample gene group DNA is carried out Touch-downPCR amplification, allow annealing temperature be reduced to 58 DEG C gradually by 64 DEG C time the highest, the specificity of detected result can be improved.
Embodiment 4
Get clinical sample 8 parts, by testing process described in embodiment 2, extract sample genomic dna, reagent preparation and detect.
Every part of sample genomic dna solution that 2ul extracts according to testing process described in embodiment 2 is added in detection system PCR reaction solution. Doing the positive, feminine gender and blank, the regular-PCR instrument in 96 holes can detect 46 parts of samples simultaneously simultaneously, and each sample repeats for 2 times, one part of positive control, one part of negative control and one part of blank. Detection time is 160 minutes.
Sample 1 just to sequencing result as shown in Figure 1, be wild-type, prognosis is good, it is proposed that maintain current treatment plan.
Sample 2 just to sequencing result as shown in Figure 2, be that 524T > C suddenlys change, cause Leu175Pro, this sudden change prognosis mala, it is proposed that row allotransplantation as early as possible.
Sample 3 just to sequencing result as shown in Figure 3, be wild-type, prognosis is good, it is proposed that maintain current treatment plan.
Sample 4 just to sequencing result as shown in Figure 4, be that 592G > A suddenlys change, cause Asp198Asn, this sudden change prognosis mala, it is proposed that row allotransplantation as early as possible.
Sample 5 just to sequencing result as shown in Figure 5, be that 593A > T suddenlys change, cause Asp198Val, this sudden change prognosis mala, it is proposed that row allotransplantation as early as possible.
Sample 6 just to sequencing result as shown in Figure 6, be wild-type, prognosis is good, it is proposed that maintain current treatment plan.
Sample 7 just to sequencing result as shown in Figure 7, be that 601C > T suddenlys change, cause Arg201 terminator codon, this sudden change prognosis mala, it is proposed that row allotransplantation as early as possible.
Sample 8 just to sequencing result as shown in Figure 8, be that 602G > A suddenlys change, cause Arg201Gln, this sudden change prognosis mala, it is proposed that row allotransplantation as early as possible.
SEQUENCELISTING
<110>company limited of Shenyang Ai Dikang medical test institute
<120>method and the primer in RUNX1 gene the 5th exons mutation site is detected
<130>
<160>5
<170>PatentInversion3.3
<210>1
<211>23
<212>DNA
<213>artificial sequence
<400>1
attaatgattggttattcaacag23
<210>2
<211>20
<212>DNA
<213>artificial sequence
<400>2
aatctgagacatggtccctg20
<210>3
<211>23
<212>DNA
<213>artificial sequence
<400>3
attaatgattggttattcaacag23
<210>4
<211>20
<212>DNA
<213>artificial sequence
<400>4
aatctgagacatggtccctg20
<210>5
<211>266
<212>DNA
<213>RUNX1 gene wild-type reference sequence RUNX1-ref
<400>5
attaatgattggttattcaacagatatgttcaggccaccaacctcattctgttttgttct60
ctatcgtgtccccacagggaaaagcttcactctgaccatcactgtcttcacaaacccacc120
gcaagtcgccacctaccacagagccatcaaaatcacagtggatgggccccgagaacctcg180
aagtaagtgcatccacttggggctggtacaccctccaggctggtacaccctccaggctgg240
tatactcagggaccatgtctcagatt266
Claims (5)
1. detect the primer in RUNX1 gene the 5th exons mutation site, it is characterised in that, comprising: the forward and reverse primer in amplification RUNX1 gene the 5th exons mutation site; Its base sequence is:
RUNX1-exon5-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R:AATCTGAGACATGGTCCCTG
Described primer also comprises one pair of sequencing primer, and its base sequence is:
RUNX1-exon5-S-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R:AATCTGAGACATGGTCCCTG.
2. primer as claimed in claim 1, it is characterised in that, the working concentration ratio of described forward and reverse primer is: RUNX1-exon5-F:RUNX1-exon5-R=1:1.
3. primer as claimed in claim 1, it is characterised in that, the working concentration ratio of sequencing primer is by described one: RUNX1-exon5-S-F:RUNX1-exon5-S-R=1:1.
4. primer as claimed in claim 1, it is characterised in that, the amplification reaction condition of described forward and reverse primer is: the first stage, 95 DEG C of denaturation 10min; Subordinate phase, denaturation temperature 94 DEG C of 30sec, annealing temperature 64 DEG C of 90sec, elongating temperature 72 DEG C of 30sec, circulate 16 times, every circulation primary, and described annealing temperature reduces by 0.5 DEG C; Phase III, denaturation temperature 94 DEG C of 30sec, annealing temperature 58 DEG C of 30sec, elongating temperature 72 DEG C of 30sec, circulate 24 times; Fourth stage, 72 DEG C of 10min; Five-stage, amplified reaction terminates, and amplified production preserves at 4 DEG C.
5. the primer detecting RUNX1 gene the 5th exons mutation site is in the application prepared in detection kit, it is characterised in that, described test kit comprises sample DNA extraction agent; Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative controls and blank product, wherein detection system PCR reaction solution comprises pair for amplification primer RUNX1-exon5-F and RUNX1-exon5-R, order-checking system reaction solution comprises one couple of sequencing primer RUNX1-exon5-S-F and RUNX1-exon5-S-R, it is characterised in that:
RUNX1-exon5-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R:AATCTGAGACATGGTCCCTG
RUNX1-exon5-S-F:ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R:AATCTGAGACATGGTCCCTG.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310665776.0A CN103710438B (en) | 2013-12-06 | 2013-12-06 | The method in detection RUNX1 gene the 5th exons mutation site and primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310665776.0A CN103710438B (en) | 2013-12-06 | 2013-12-06 | The method in detection RUNX1 gene the 5th exons mutation site and primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103710438A CN103710438A (en) | 2014-04-09 |
| CN103710438B true CN103710438B (en) | 2016-06-08 |
Family
ID=50403789
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310665776.0A Active CN103710438B (en) | 2013-12-06 | 2013-12-06 | The method in detection RUNX1 gene the 5th exons mutation site and primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710438B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695596A (en) * | 2016-03-22 | 2016-06-22 | 南京艾迪康医学检验所有限公司 | Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene |
| CN106399567A (en) * | 2016-11-25 | 2017-02-15 | 杭州华硕医学检验所有限公司 | Primer for detecting WRAP53 gene mutation and application of primer |
| CN107245529A (en) * | 2017-08-08 | 2017-10-13 | 杭州千麦医学检验所有限公司 | Blood disease fusion screening method |
-
2013
- 2013-12-06 CN CN201310665776.0A patent/CN103710438B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia;Hironori Harada et al;《BLOOD 》;20040315;第103卷(第6期);第2316-2319页，摘要及第2317页左栏最后一段，右栏第1-2段 * |
| RUNX1 gene mutation in primary myelodysplastic syndrome – the mutation can be detected early at diagnosis or acquired during disease progression and is associated with poor outcome;C Y Chen et al;《biritish journal of haematology》;20071231;第405-414页 * |
| RUNX1 Mutations in Acute Myeloid Leukemia: Results From a Comprehensive Genetic and Clinical Analysis From the AML Study Group;Verena I. Gaidzik et al;《JOURNAL OF CLINICAL ONCOLOGY》;20110401;第29卷(第10期);第1364-1370页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103710438A (en) | 2014-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104531862B (en) | Detect the method and primer in the full exon sequence mutational site of mankind's BRCA1 and BRCA2 gene | |
| CN105506107A (en) | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene | |
| CN103710438B (en) | The method in detection RUNX1 gene the 5th exons mutation site and primer | |
| CN105506106A (en) | Method and primer for detecting whole exons of FIX gene | |
| CN104745697B (en) | Detect the method and primer of NF1 the 31st No. 34 full extron of gene | |
| CN101323877B (en) | Reagent box for detecting No 21 chromosome and idiochromosome number abnormality | |
| CN108531575A (en) | Detect primer, kit and the method for the full exon sequence mutation of TERC genes | |
| CN104862407A (en) | Primer and method for detecting EZH2 genes | |
| CN102719536A (en) | Kit for detecting gene mutation of hepatolenticular degeneration ATP7B | |
| CN105755132A (en) | Method, oligonucleotide and kit for detecting polymorphic mutation site of WAS gene | |
| CN106399567A (en) | Primer for detecting WRAP53 gene mutation and application of primer | |
| CN108004309A (en) | Detect primer, method and the kit of MTHFR677, MTHFR1298 and MTRR66 | |
| CN106086215A (en) | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer | |
| CN105695596A (en) | Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene | |
| CN106222287A (en) | The method of detection ELA2 gene and primer | |
| CN103540659B (en) | Detect the method in DNMT3A mutational site, primer and test kit | |
| CN103131776A (en) | A719G single nucleotide polymorphism detection kit of thiopurine methyltransferase (TPMT) * 3C | |
| CN103710437B (en) | Detect method and the primer in RUNX1 gene the 3rd exons mutation site | |
| CN107841554A (en) | Detect the primer, kit and method of Hageman factor (F12) gene mutation | |
| CN106755335A (en) | A kind of detection primer of Leber hereditary optic neuropathies mitochondrial DNA gene mutation, kit and detection method | |
| CN108929903B (en) | Marker and kit for screening, diagnosing and evaluating curative effect of chronic periodontitis | |
| CN105506110A (en) | Method and primer for detecting 8th and 25th whole exons of TEX11 gene | |
| CN103710436B (en) | The method of detection WT1 gene the 7th exon pleomorphism site and primer | |
| CN109504754A (en) | A method of detection folic acid metabolism ability | |
| CN102796819A (en) | Kit for detecting microdeletion of Y chromosome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |