CN106086215A - The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer - Google Patents
The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer Download PDFInfo
- Publication number
- CN106086215A CN106086215A CN201610663606.2A CN201610663606A CN106086215A CN 106086215 A CN106086215 A CN 106086215A CN 201610663606 A CN201610663606 A CN 201610663606A CN 106086215 A CN106086215 A CN 106086215A
- Authority
- CN
- China
- Prior art keywords
- nhp2
- primer
- gene
- 30sec
- unmutated
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses detection No. 4 method of full exon sequence of NHP2 gene, primer and test kit, including forward and reverse primer and a pair sequencing primer of amplification No. 4 full exon of NHP2 gene.Touch down PCR amplification and Sanger order-checking are combined, can quickly detect the catastrophe of dyskeratosis congenita disease No. 4 full exon sequence of NHP2 gene in the patient, wherein contain Primary mutations site V126M, Y139H, the X154R being positioned on No. 4 full exons.
Description
Technical field
The invention belongs to life sciences and biological technical field, particularly to detection No. 4 full exon sequence of NHP2 gene
Primer, method and the test kit of sudden change.
Background technology
Dyskeratosis congenita disease (dskeratosis eongenita, DC) is a kind of bone marrow with genetic heterogeneity
Exhaustion syndrome, sickness rate is about 1/1,000,000.Typical DC patient about 80%～90% has skin mucosa abnormal three and levies,
Show as the netted pigmentation of skin, refer to (toe) onychoatrophy, oral cavity mucous membrane white spot.Document report can cause the sudden change base of DC at present
Because mainly having CTC1, DKC1, TERC, TERT, TINF2, NOP10, NHP2 and WRAP53.Document is reported, these genes have 3 kinds of something lost
Biography mode, respectively X-sex-linked recessive inheritance, autosomal recessive inheritance, AR, autosomal dominant inheritance, AD.But current the most about 50%
Patient's inherited characteristic is indefinite.X-sex-linked recessive inheritance includes that DKC1, autosomal dominant inheritance, AD include TERC and TINF2, often
Autosomal recessive heredity includes CTC1, WRAP53, NOP10, NHP2, not only can be as autosomal dominant inheritance, AD but also can conduct
Recessive inheritance has TERT.NHP2 is positioned at 5q35.3 site and is responsible for the base of encoding telomerase related protein complex component protein
Cause.NHP2 albumen is one of core protein of telomerase associated proteins complex, common with dyskerin, NOP10, GAR1 albumen
Take part in the ribosomal synthesis of eukaryote, Pre-mRNA montage and the maintenance of telomere.Vulliamy etc. are in congenital keratinization not
Finding in good disease patient that NHP2 exists sudden change, this sudden change shortens the length of telomerase, and reduces the expression level of TERC.
In recent years, by genome sequencing, find NHP2 gene mutation in congenital dyskeratosis patient very
Common.There are 3 mutantional hotspots in document report NHP2 gene mutation, concentrates in the 4th exon.Mutantional hotspot V126M
(G376A) this gene the 126th codon valine, can be caused to the change of methionine；Mutantional hotspot Y139H (T415C), can draw
Play the change to histidine of this gene the 139th codon tyrosine；Mutantional hotspot X154R (T460A), this site mutation makes termination
Codon becomes arginine, and makes the C end of amino acid chain increase by 55 aminoacid.The variation in these sites can cause telomerase
Rna level lowers and telomere length substantially shortens, and reduces the expression level of TERC.The DC of domestic literature report is sick at present
The example overwhelming majority is the clinical case of about 30 years old skin involvement, and case load is less, and less carries out gene test.Therefore having must
The abrupt climatic change of related gene to be carried out, it is necessary to first patient is carried out V126M, Y139H, X154R sudden change and screens, help
In the early diagnosis to dyskeratosis congenita disease, reduce mistaken diagnosis, fail to pinpoint a disease in diagnosis, and treat.
The present invention uses Touch-down PCR amplification and Sanger sequencing to detect No. 4 full exon sequence of NHP2 gene
The sudden change of row, and the primer designed can extend whole No. 4 full exon sequence, including all sudden change positions to be detected
Point.Touch-down PCR amplification can ensure that forward and reverse amplimer occurs in the most complementary sequence with the combination of sample DNA template
Between row, when annealing temperature is reduced to the level that non-specific amplification occurs, specific amplification products has had one
The initial advantage of individual geometry number, abundance is higher, in remaining amplified reaction, specific amplification products and non-specific amplification product
Produce competition, but because non-specific amplification product abundance is relatively low, specific amplification products preferential amplification all the time, thus produce list
The prevailing specific amplification products of one.And Sanger sequencing is the goldstandard of detection gene mutation, testing result
Accuracy is high, and largely Shangdi saves testing cost.
Summary of the invention
It is an object of the invention to provide the primer of detection No. 4 full exon sequence of NHP2 gene, it is characterised in that bag
Include: the forward and reverse primer of amplification No. 4 full exon sequence of NHP2 gene；Its base sequence is:
NHP2-F:TGTAAAACGACGGCCAGTATTAGGCTGGTGGGTCATCAGTTG
NHP2-R:AACAGCTATGACCATGAGGAGGACAGCCAGTCGTCCTG.
Further, described primer also includes a pair sequencing primer, and for universal primer M13, its base sequence is
M13-F:TGTAAAACGACGGCCAGT
M13-R:AACAGCTATGACCATG.
Further, the concentration ratio of described forward and reverse primer is: NHP2-F:NHP2-R=1:1.
Further, the concentration ratio of the pair of sequencing primer is: M13-F:M13-R=1:1.
Further, the amplification reaction condition of described forward and reverse amplimer is: the first stage, 95 DEG C of denaturations
10min；Second stage, 94 DEG C of 30sec of denaturation temperature, 64 DEG C of 90sec of annealing temperature, 72 DEG C of 30sec of elongating temperature, circulate 16
Secondary, every circulation primary, described annealing temperature reduces by 0.5 DEG C；Phase III, 94 DEG C of 30sec of denaturation temperature, annealing temperature 58 DEG C
30sec, 72 DEG C of 30sec of elongating temperature, circulate 24 times；Fourth stage, 72 DEG C of 10min；In 5th stage, amplified reaction terminates, and expands
Volume increase thing preserves at 4 DEG C.
The present invention also aims to provide a kind of method detecting No. 4 full exon sequence of NHP2 gene, it includes
Following steps:
(1) sample DNA is extracted；
(2) utilize pair for amplification primer NHP2-F and NHP2-R that the DNA in (1) is expanded, it is thus achieved that amplified production；
(3) utilize a pair sequencing primer M13-F and M13-R that the amplified production in (2) is checked order, it is thus achieved that described amplification
The gene order of product；
(4) gene order in (3) is compared with NHP2 gene wild-type reference sequence NHP2-ref, determine sudden change
Whether site exists, it is characterised in that
NHP2-F:TGTAAAACGACGGCCAGTATTAGGCTGGTGGGTCATCAGTTG
NHP2-R:AACAGCTATGACCATGAGGAGGACAGCCAGTCGTCCTG
M13-F:TGTAAAACGACGGCCAGT
M13-R:AACAGCTATGACCATG.
Further, the amplification reaction condition in step (2) is: the first stage, 95 DEG C of denaturations 10min；Second stage,
94 DEG C of 30sec of denaturation temperature, 64 DEG C of 90sec of annealing temperature, 72 DEG C of 30sec of elongating temperature, circulate 16 times, every circulation primary, institute
State annealing temperature and reduce by 0.5 DEG C；Phase III, 94 DEG C of 30sec of denaturation temperature, 58 DEG C of 30sec of annealing temperature, elongating temperature 72 DEG C
30sec, circulates 24 times；Fourth stage, 72 DEG C of 10min；In 5th stage, amplified reaction terminates, and amplified production preserves at 4 DEG C.
The present invention also aims to provide a kind of reagent detecting No. 4 full exon sequence mutational site of NHP2 gene
Box, it is characterised in that described test kit includes sample DNA extraction agent；Dehydrated alcohol；Detection system PCR reactant liquor, order-checking body
Being reactant liquor, positive reference substance, negative controls and blank product, wherein detection system PCR reactant liquor includes pair for amplification
Product NHP2-F and NHP2-R, order-checking system reactant liquor includes a pair sequencing primer M13-F and M13-R, it is characterised in that:
NHP2-F:TGTAAAACGACGGCCAGTATTAGGCTGGTGGGTCATCAGTTG
NHP2-R:AACAGCTATGACCATGAGGAGGACAGCCAGTCGTCCTG
M13-F:TGTAAAACGACGGCCAGT
M13-R:AACAGCTATGACCATG.
Further, described test kit includes NHP2 gene wild-type reference sequence NHP2-ref.
Further, described order-checking refined solution includes the order-checking purification being made up of shrimp alkaline phosphotase and exonuclease I
Liquid.
Beneficial effects of the present invention: the present invention is just devising amplification No. 4 full exon sequence of NHP2 gene, reversely draws
Thing, constructs stable Touch-down PCR amplification system, expands whole No. 4 full exon sequence, comprises and treat
All mutational sites of detection, simultaneously when amplification, are enriched with the specific amplification product that forward and reverse primer correctly matches with template
Thing, improves specific amplification.Additionally, by adjusting the reaction conditions such as the concentration of forward and reverse amplimer, annealing temperature, can make
Amplification efficiency reaches optimal, and uses Sanger sequencing, pcr amplification product is carried out sequencing reaction amplification, after purification degeneration,
In direct Sequencing detection No. 4 full exon sequence of NHP2 gene, the catastrophe in each mutational site, has highly sensitive, operation
Simple and low cost and other advantages.
Accompanying drawing explanation
Fig. 1 NHP2 gene PCR amplification electrophoresis result figure.M is TAKARA DL2000.
Fig. 2 sample 1 NHP2 gene V126M testing result figure.
Fig. 3 sample 2 NHP2 gene V126M testing result figure.
Fig. 4 sample 3 NHP2 gene V126M testing result figure.
Fig. 5 sample 1 NHP2 gene Y139H testing result figure.
Fig. 6 sample 2 NHP2 gene Y139H testing result figure.
Fig. 7 sample 3 NHP2 gene Y139H testing result figure.
Fig. 8 sample 1 NHP2 gene X154R testing result figure.
Fig. 9 sample 2 NHP2 gene X154R testing result figure.
Figure 10 sample 3 NHP2 gene X154R testing result figure.
Detailed description of the invention
Below in conjunction with specific embodiments and the drawings, the present invention is expanded on further.It should be noted that, it is undeclared in embodiment
Normal condition and method, generally according to art experimenter's routine use method: such as, Ao Sibai and James Kingston chief editor
" fine works molecular biology experiment guide " fourth edition, or according to the step proposed by manufacturer and condition.
Embodiment 1
The primer of detection No. 4 full exon sequence of NHP2 gene, including: amplification No. 4 full exon sequence of NHP2 gene
The forward and reverse primer of row；Its base sequence is:
NHP2-F:TGTAAAACGACGGCCAGTATTAGGCTGGTGGGTCATCAGTTG
NHP2-R:AACAGCTATGACCATGAGGAGGACAGCCAGTCGTCCTG.
Preferably, described primer also includes a pair sequencing primer, and for universal primer M13, its base sequence is
M13-F:TGTAAAACGACGGCCAGT
M13-R:AACAGCTATGACCATG.
In the detection, first with above-mentioned forward and reverse primer, No. 4 full exon sequence of NHP2 gene is expanded, obtain
Obtain amplified production, then utilize above-mentioned a pair sequencing primer that amplified production is checked order, it is thus achieved that the gene order of amplified production.
The test kit of detection No. 4 full exon sequence of NHP2 gene, including: sample DNA extraction agent (such as uses sky
The test kit of root biology extracts sample DNA)；Dehydrated alcohol；Detection system PCR reactant liquor, order-checking system reactant liquor, the positive are right
According to product, negative controls and blank product, wherein
Detection system PCR reactant liquor includes: 2 × PCR Buffer；2mM dNTPs；KOD FX DNA Polymerase
(1U/μl)；Forward and reverse primer NHP2-F (10 μm), the NHP2-R in amplification No. 4 full exon sequence mutational site of NHP2 gene
(10μm)。
Order-checking system reactant liquor includes: order-checking refined solution, EDTA (125mmol), dehydrated alcohol, 75% ethanol, HIDI are (high
Degree deionized formamide), sequencing primer: NHP2-F (3.2 μm), NHP2-R (3.2 μm), and Bigdye Terminator
V3.1 (buys from Applied Biosystems company of the U.S.), and wherein order-checking refined solution includes shrimp alkaline phosphotase (SAP)
0.6U and exonuclease I (EXONI) 1.2U.
Detection system PCR reactant liquor preparation of reagents is as follows:
Wherein, the base sequence of NHP2-F and NHP2-R is:
Positive reference substance: containing the solution of NHP2 sequence.
Negative controls: without the solution of NHP2 sequence.
Blank product: 2 μ l normal saline or be not added with any material.
Preferably, this test kit also includes NHP2 gene wild-type reference sequence NHP2-ref, the following institute of its base sequence
Show:
ATTAGGCTGGTGGGTCATCAGTTGGTGACTTCCTGGCATACAGGTTGTACAGCTTTTTTCCAAACAGCACTTCTTTC
CCCTCTGTAGGACCTGGGTGCAGCCGCAGGCTCCAAGCGCCCCACCTGTGTGATAATGGTCAAGCCCCATGAGGAGT
ACCAGGAGGCTTACGATGAGTGCCTGGAGGAGGTGCAGTCCCTGCCCCTACCCCTATGAGGGGCTCCGGTAGCACCT
GGGCACCTGCCGCTGGAAGCTATTGGGCTGGCAGCAGGACGACTGGCTGTCCTCCT。
Embodiment 2
Testing process:
(1) blood DNA extraction agent box (sky root biological) is utilized to extract the genomic DNA in blood sample:
1) extraction 500uL blood adds 1000uL erythrocyte cracked liquid, reverse mixing, and room temperature is placed 5 minutes, and period runs again
Fall mixing several times.3000rpm is centrifuged 5min, sucks supernatant, leaves leukocyte cell pellet, adds 200uL buffer GA, and vibration is to thoroughly
Mixing.
2) 20 μ l Proteinase K Solution are added, mixing.
3) 200 μ l buffer GB are added, the most reverse mixing, to place 10 minutes for 70 DEG C, solution strain is limpid, brief centrifugation
To remove the globule of cap wall.
4) 200 μ l dehydrated alcohol are added, fully vibration mixing 15 seconds, now it is possible that flocculent deposit, brief centrifugation
To remove the globule of cap wall.
5) previous step gained solution and flocculent deposit are all added in an adsorption column CB3 that (adsorption column puts into collecting pipe
In), centrifugal 30 seconds of 12,000rpm (13,400 × g), outwell waste liquid, are put back in collecting pipe by adsorption column CB3.
6) in adsorption column CB3, add 500 μ l buffer GD (the most first check whether before use and added dehydrated alcohol),
Centrifugal 30 seconds of 12,000rpm (13,400 × g), outwell waste liquid, are put in collecting pipe by adsorption column CB3.
7) in adsorption column CB3, add 700 μ l rinsing liquid PW (the most first check whether before use and added dehydrated alcohol),
Centrifugal 30 seconds of 12,000rpm (13,400 × g), outwell waste liquid, are put in collecting pipe by adsorption column CB3.
8) in adsorption column CB3, add 500 μ l rinsing liquid PW, centrifugal 30 seconds of 12,000rpm (13,400 × g), outwell useless
Liquid.
9) adsorption column CB3 is put back in collecting pipe, centrifugal 2 minutes of 12,000rpm (13,400 × g), outwell waste liquid.To inhale
Attached column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in adsorbing material.
10) adsorption column CB3 is proceeded in a clean centrifuge tube, to the middle part of adsorbed film unsettled dropping 100 μ l
Elution buffer TE, room temperature placement 2-5 minute, centrifugal 2 minutes of 12,000rpm (13,400 × g), collect centrifuge tube by solution
In, it is thus achieved that poba gene group DNA solution.
(2) reagent configuration: by detection people's number configuration detection system PCR reactant liquor each X μ l, every person-portion 18 μ l subpackage: X=
18 μ l reactant liquors × (+1 part of positive control of n part sample+1 part of blank of+1 part of negative control) n is detection sample number.
(3) sample-adding: the poba gene group DNA solution obtained in 2ul step (1) is joined detection system PCR reactant liquor
In；For positive control experiment, directly add 2ul positive reference substance；For negative control experiment, directly add 2ul feminine gender right
According to product；For blank is tested, add 2ul normal saline or be not added with any material.
(4) Touch-down PCR amplification: detection is carried out on Standard PCR instrument, it is thus achieved that pcr amplification product, available instrument
Including ABI veriti (Applied Biosystems company of the U.S.) etc..Reaction condition is as follows:
(5) Sanger order-checking:
Take 9 μ l pcr amplification products and 2 μ l order-checking refined solution.It is purified according to following procedure, thus obtains purification and produce
Thing:
1 μ l purified product is carried out according to following system with sequencing primer M13-F (3.2 μm) and M13-R (3.2 μm) respectively
Mixing:
Sequencing reaction program:
Precipitation link:
In the product complete sequencing reaction, add the EDTA of 2 μ l 125mmol, stand 5min；Add the anhydrous second of 15ml
Alcohol, whirlpool mixes；3700rpm is centrifuged 30min；Being inverted centrifugal 15sec, add 50ml 70% ethanol, whirlpool mixes；3700rpm
Centrifugal 15min；It is inverted centrifugal 15sec, is placed on 95 DEG C of metal baths；Denatured test is carried out after adding 10 μ l HIDI.Degeneration journey
Sequence:
After denaturation program terminates, upper sequenator (ABI3730) checks order, it is thus achieved that the gene order of pcr amplification product.
(6) result judges: the gene order obtained in (5) carried out with NHP2 gene wild-type reference sequence NHP2-ref
Comparison, reports result according to actual catastrophe.
Embodiment 3
Kit for detecting nucleic acid of the present invention is used to detect clinical sample.
Fetching and delivering inspection dyskeratosis congenita disease patient's anticoagulation sample 20 example, as described in embodiment 2, testing process extracts sample
Genomic DNA in Ben, reagent preparation also detects.
Every part of sample genomic dna solution that 2ul extracts according to testing process described in embodiment 2 is added detection bodies
It is in PCR reactant liquor.Do the positive, feminine gender and blank simultaneously.Detecting with regular-PCR instrument, the time is 160 minutes.
Electrophoresis result is as it is shown in figure 1, show that blood sample can effectively be expanded by primer NHP2-F, NHP2-R of the present invention
Increase, and band is single.
The NHP2 gene V126M forward sequencing result of sample 1, as in figure 2 it is shown, be wild type, does not detects that V126M suddenlys change.
The NHP2 gene V126M forward sequencing result of sample 2, as it is shown on figure 3, be wild type, does not detects that V126M suddenlys change.
The NHP2 gene V126M forward sequencing result of sample 3 as shown in Figure 4, for wild type, does not detects that V126M suddenlys change.
The NHP2 gene Y139H forward sequencing result of sample 1, as it is shown in figure 5, be wild type, does not detects that Y139H suddenlys change.
The NHP2 gene Y139H forward sequencing result of sample 2 as shown in Figure 6, for wild type, does not detects that Y139H suddenlys change.
The NHP2 gene Y139H forward sequencing result of sample 3, as it is shown in fig. 7, be wild type, does not detects that Y139H suddenlys change.
The NHP2 gene X154R forward sequencing result of sample 1, as it is shown in figure 5, be wild type, does not detects that X154R suddenlys change.
The NHP2 gene X154R forward sequencing result of sample 2 as shown in Figure 6, for wild type, does not detects that X154R suddenlys change.
The NHP2 gene X154R forward sequencing result of sample 3, as it is shown in fig. 7, be wild type, does not detects that X154R suddenlys change.
Testing result such as following table:
| Sample number | The present invention detects V126M result | The present invention detects Y139H result | The present invention detects X154R result |
| 1 | Unmutated | Unmutated | Unmutated |
| 2 | Unmutated | Unmutated | Unmutated |
| 3 | Unmutated | Unmutated | Unmutated |
| 4 | Unmutated | Unmutated | Unmutated |
| 5 | Unmutated | Unmutated | Unmutated |
| 6 | Unmutated | Unmutated | Unmutated |
| 7 | Unmutated | Unmutated | Unmutated |
| 8 | Unmutated | Unmutated | Unmutated |
| 9 | Unmutated | Unmutated | Unmutated |
| 10 | Unmutated | Unmutated | Unmutated |
| 11 | Unmutated | Unmutated | Unmutated |
| 12 | Unmutated | Unmutated | Unmutated |
| 13 | Unmutated | Unmutated | Unmutated |
| 14 | Unmutated | Unmutated | Unmutated |
| 15 | Unmutated | Unmutated | Unmutated |
| 16 | Unmutated | Unmutated | Unmutated |
| 17 | Unmutated | Unmutated | Unmutated |
| 18 | Unmutated | Unmutated | Unmutated |
| 19 | Unmutated | Unmutated | Unmutated |
| 20 | Unmutated | Unmutated | Unmutated |
From testing result it can be seen that primer of the present invention includes NHP2 gene the 4th exon complete sequence
Interior, and sequencing result entirely accurate.Detection to positive sample shows primer of the present invention and method and test kit
It is capable of detecting when NHP2 gene mutation.
Claims (7)
1. detect the primer of No. 4 full exon sequence of NHP2 gene, it is characterised in that including: amplification NHP2 gene the 4th is complete
The forward and reverse primer of exon；Its base sequence is:
NHP2-F:TGTAAAACGACGGCCAGTATTAGGCTGGTGGGTCATCAGTTG
NHP2-R:AACAGCTATGACCATGAGGAGGACAGCCAGTCGTCCTG.
2. primer as claimed in claim 1, it is characterised in that described primer also includes a pair sequencing primer, for universal primer
M13, its base sequence is:
NHP2-F:TGTAAAACGACGGCCAGT
NHP2-R:AACAGCTATGACCATG.
3. the primer as described in one of claim 1 to 2, it is characterised in that the concentration ratio of described forward and reverse primer is:
NHP2-F:NHP2-R=1:1.
4. the primer as described in one of claim 1 to 2, it is characterised in that the concentration ratio of the pair of sequencing primer is:
M13-F:M13-R=1:1.
5. primer as claimed in claim 1, it is characterised in that the amplification reaction condition of described forward and reverse amplimer is: the
One stage, 95 DEG C of denaturations 10min；Second stage, 94 DEG C of 30sec of denaturation temperature, 64 DEG C of 90sec of annealing temperature, elongating temperature
72 DEG C of 30sec, circulate 16 times, every circulation primary, and described annealing temperature reduces by 0.5 DEG C；Phase III, denaturation temperature 94 DEG C
30sec, 58 DEG C of 30sec of annealing temperature, 72 DEG C of 30sec of elongating temperature, circulate 24 times；Fourth stage, 72 DEG C of 10min；5th rank
Section, amplified reaction terminates, and amplified production preserves at 4 DEG C.
6. the method detecting No. 4 full exon sequence of NHP2 gene, it comprises the steps:
(1) sample DNA is extracted；
(2) utilize pair for amplification primer NHP2-F and NHP2-R that the DNA in (1) is expanded, it is thus achieved that amplified production；
(3) utilize a pair sequencing primer M13-F and M13-R that the amplified production in (2) is checked order, it is thus achieved that described amplified production
Gene order；
(4) gene order in (3) is compared with NHP2 gene wild-type reference sequence NHP2-ref, determine mutational site
Whether exist, it is characterised in that
NHP2-F:TGTAAAACGACGGCCAGTATTAGGCTGGTGGGTCATCAGTTG
NHP2-R:AACAGCTATGACCATGAGGAGGACAGCCAGTCGTCCTG
NHP2-F:TGTAAAACGACGGCCAGT
NHP2-R:AACAGCTATGACCATG.
7. method as claimed in claim 6, it is characterised in that the amplification reaction condition of step (2) is: the first stage, 95 DEG C
Denaturation 10min；Second stage, 94 DEG C of 30sec of denaturation temperature, 64 DEG C of 90sec of annealing temperature, 72 DEG C of 30sec of elongating temperature, follow
Ring 16 times, every circulation primary, described annealing temperature reduces by 0.5 DEG C；Phase III, 94 DEG C of 30sec of denaturation temperature, annealing temperature 58
DEG C 30sec, 72 DEG C of 30sec of elongating temperature, circulate 24 times；Fourth stage, 72 DEG C of 10min；In 5th stage, amplified reaction terminates,
Amplified production preserves at 4 DEG C.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610663606.2A CN106086215A (en) | 2016-08-13 | 2016-08-13 | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610663606.2A CN106086215A (en) | 2016-08-13 | 2016-08-13 | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN106086215A true CN106086215A (en) | 2016-11-09 |
Family
ID=57456623
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610663606.2A Pending CN106086215A (en) | 2016-08-13 | 2016-08-13 | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106086215A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486229A (en) * | 2018-04-11 | 2018-09-04 | 南昌艾迪康临床检验所有限公司 | Detect primer, kit and the method for the 6th exon series jump of TINF2 genes |
| CN108531575A (en) * | 2018-04-11 | 2018-09-14 | 杭州艾迪康医学检验中心有限公司 | Detect primer, kit and the method for the full exon sequence mutation of TERC genes |
| CN114427003A (en) * | 2022-01-27 | 2022-05-03 | 中山大学附属第一医院 | Application of NHP2 in prediction of cancer radiotherapy sensitivity and prognosis |
-
2016
- 2016-08-13 CN CN201610663606.2A patent/CN106086215A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| CHRISTIAN TRAHAN等: "Effects of dyskeratosis congenita mutations in dyskerin, NHP2 and NOP10 on assembly of H/ACA pre-RNPs", 《HUMAN MOLECULAR GENETICS》 * |
| TOM VULLIAMY等: "Mutations in the telomerase component NHP2 cause the premature ageing syndrome dyskeratosis congenita", 《PNAS》 * |
| 杨敏等: "先天性角化不良1家系基因突变检测", 《中国皮肤性病学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108486229A (en) * | 2018-04-11 | 2018-09-04 | 南昌艾迪康临床检验所有限公司 | Detect primer, kit and the method for the 6th exon series jump of TINF2 genes |
| CN108531575A (en) * | 2018-04-11 | 2018-09-14 | 杭州艾迪康医学检验中心有限公司 | Detect primer, kit and the method for the full exon sequence mutation of TERC genes |
| CN114427003A (en) * | 2022-01-27 | 2022-05-03 | 中山大学附属第一医院 | Application of NHP2 in prediction of cancer radiotherapy sensitivity and prognosis |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104745697B (en) | Detect the method and primer of NF1 the 31st No. 34 full extron of gene | |
| CN105506107A (en) | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene | |
| CN105506106A (en) | Method and primer for detecting whole exons of FIX gene | |
| CN108531575A (en) | Detect primer, kit and the method for the full exon sequence mutation of TERC genes | |
| CN109486938A (en) | Detect method, primer and the application of SMN1 and SMN2 gene mutation | |
| CN106086215A (en) | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer | |
| CN108048553A (en) | Detect method, primer and the kit of SLC25A13 gene mutations | |
| CN106520967A (en) | Method and primer for detecting hereditary blood coagulation factor XI(F11) genes | |
| CN108998525A (en) | Detect primer, method and the kit of ATRX gene point mutation | |
| CN106987642A (en) | Detect the kit and method of the full extron of MPL genes | |
| CN106399567A (en) | Primer for detecting WRAP53 gene mutation and application of primer | |
| CN109402234A (en) | Detect the primer and method of DMD A827T, 6436 insC site mutation of DMD A5741T and DMD | |
| CN105755132A (en) | Method, oligonucleotide and kit for detecting polymorphic mutation site of WAS gene | |
| CN110358820A (en) | Detect method, primer and the kit of LDLR gene mutation | |
| CN106282343A (en) | Detection NOP10 gene the 2nd exon mutational site R34W(C100T) method of series jump and primer | |
| CN108004309A (en) | Detect primer, method and the kit of MTHFR677, MTHFR1298 and MTRR66 | |
| CN106222287A (en) | The method of detection ELA2 gene and primer | |
| CN106868174A (en) | Detect the kit and method of the full extron of ADAMTS13 genes | |
| CN110358821A (en) | Detect primer, kit and the method for glucose 6 phosphate dehydrogenase deficiency G6PD gene mutation | |
| CN103710438A (en) | Method and primers for detecting fifth exon mutation site of RUNX1 gene | |
| CN103540659B (en) | Detect the method in DNMT3A mutational site, primer and test kit | |
| CN115074443A (en) | Human gene CHD1 site mutation and kit for detecting multiple site mutations of CDH1 gene | |
| CN110951862A (en) | Method, primer and kit for detecting CYP21A2 gene mutation | |
| CN110564826A (en) | Primer, method and kit for detecting AVPR 2gene mutation of congenital renal diabetes insipidus | |
| CN107841554A (en) | Detect the primer, kit and method of Hageman factor (F12) gene mutation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20161109 |