CN103710438A - Method and primers for detecting fifth exon mutation site of RUNX1 gene - Google Patents
Method and primers for detecting fifth exon mutation site of RUNX1 gene Download PDFInfo
- Publication number
- CN103710438A CN103710438A CN201310665776.0A CN201310665776A CN103710438A CN 103710438 A CN103710438 A CN 103710438A CN 201310665776 A CN201310665776 A CN 201310665776A CN 103710438 A CN103710438 A CN 103710438A
- Authority
- CN
- China
- Prior art keywords
- runx1
- exon5
- primer
- 30sec
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method and primers for detecting a fifth exon mutation site of a RUNX1 gene. The method and the primers comprise a forward primer, a reverse primer and a pair of sequencing primers for amplifying the fifth exon mutation site of the RUNX1 gene. The method combines a Touch-down PCR amplification and a Sanger sequencing method, can rapidly detect mutation conditions of the fifth exon mutation site of the RUNX1 gene in an acute myeloid leukemia patient body.
Description
Technical field
The invention belongs to life science and biological technical field, particularly detect method and the primer in RUNX1 gene the 5th exons mutation site.
Background technology
Acute myeloid leukaemia (AML) is due to the acquired gene alteration of medullary system hematopoietic stem/progenitor generation cumulative bad, a kind of malignant disease that causes cell proliferation, differentiation and apoptosis pathway to change.
RUNX1 is called again AML1, is one of member in RUNX transcription factor protein family, is the modal target site of chromosomal translocations of human leukemias.RUNX1 is very important transcription factor, can two-way (promote or suppress) regulate hematopoiesis correlation factor, thereby regulate differentiation, apoptosis and the self of hemopoietic stem cell.RUNX1 point mutation often can occur in myelodysplastic syndrome (MDS), AML, chronic myelomonocytic leukemia (CMML), more rare in bone marrow proliferative tumour (MPN).Have research to point out, the mutation rate of RUNX1 is in 32%, MDS, to be in 23%, CMML, to be 37% in AML.In leukemia of children cell, found multiple nonrandom chromosome translocation, wherein RUNX1 gets involved at most, accounts for leukemia of children case more than 30%, as t (12; 21) (TEL-RUNX1), t (8; 21) (RUNX1-ETO/MTG8), t (16; 21) (RUNX 1-MTG16) etc.RUNX1 sudden change indication patient prognosis mala.Patient is carried out to RUNX1 Mutation Screening may contribute to carry out clinical risk stratification and formulate treatment decision-making.
In bibliographical information, although people find RUNX1 gene, there is not mutantional hotspot, generally all the sudden change situation of its 1-8 exon can be detected.Separately having bibliographical information the 3rd, 4,5,8 exons to occur that the probability of sudden change is higher, is mainly the detection for the 5th exons mutation situation in the present invention.
The restricted property of the method fragment length polymorphism (SSCP) of current available detection in Gene Mutation, gene sequencing, tetra-sodium order-checking, quantitative fluorescent PCR etc.SSCP technology is relatively simple, but restriction enzyme site is subject to genovariation impact, affects result judgement, and due to the technical limitation of method itself, detection sensitivity is low.Although it is higher to adopt fluorescence quantitative PCR method to detect sensitivity, the used time is shorter, and is not suitable for the detection of RUNX1 gene the 5th exons mutation.It is long and relate generally to 5 mutational sites that reason is to detect the exon sequence of this gene, and the sudden change in the sudden change in the 198th amino acids site and the 202nd amino acids site, can occur in two continuous bases, the i.e. 592G>A in the 198th amino acids site sudden change, 593A>T sudden change, the 601C>T sudden change in the 202nd amino acids site, 602G>A sudden change.Quantitative fluorescent PCR (probe method) is mainly applicable to detect the sudden change of single base, if detect a plurality of mutational sites, need the design multipair primer of design and many probes, and carry out multitube PCR reaction, also need to use the real-time fluorescence PCR instrument matching simultaneously, this can increase testing cost and sample DNA consumption, and the dye method of quantitative fluorescent PCR detection transgenation exists the poor problem of primer specificity, and detected result false positive rate is high.Tetra-sodium sequencing technologies is because the effective fragment detecting is only about 50bp, if be separated by over 50bp between a plurality of sites of undergoing mutation, need so to design multipair sequencing primer, and carry out multitube PCR reaction, this also can be multiplied testing cost and sample DNA consumption.In addition, prior art is only to detect the unit point sudden change that sudden change probability of occurrence is higher, and does not detect the integral body sudden change situation of the 5th exon.
The present invention adopts Touch-down pcr amplification and Sanger sequencing to detect the sudden change of RUNX1 gene the 5th exon, and the primer of design can expand whole the 5th exon, comprises all mutational sites to be detected.Touch-down pcr amplification can guarantee that the combination of forward and reverse amplimer and sample DNA template occurs between the most complementary sequence, when annealing temperature is reduced to the level of non-specific amplification generation, specific amplification products has had the initial advantage of how much numbers at this moment, abundance is higher, in remaining amplified reaction, specific amplification products and non-specific amplification product are competed, but because of non-specific amplification product abundance lower, specific amplification products is preferentially amplification all the time, thereby produces single prevailing specific amplification products.And Sanger sequencing is to detect the gold standard of transgenation, detected result accuracy is high, and largely testing cost has been saved in Shangdi.
Summary of the invention
The object of the present invention is to provide the primer that detects RUNX1 gene the 5th exons mutation site, it is characterized in that, comprising: the forward and reverse primer in amplification RUNX1 gene the 5th exons mutation site; Its base sequence is:
RUNX1-exon5-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R：AATCTGAGACATGGTCCCTG。
Further, described primer also comprises a pair of sequencing primer, and its base sequence is
RUNX1-exon5-S-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R：AATCTGAGACATGGTCCCTG。
Further, the working concentration of described forward and reverse primer ratio is: RUNX1-exon5-F:RUNX1-exon5-R=1:1.
Further, the working concentration of described a pair of sequencing primer ratio is: RUNX1-exon5-S-F:RUNX1-exon5-S-R=1:1.
Further, the amplification reaction condition of described forward and reverse amplimer is: first stage, 95 ℃ of denaturation 10min; Subordinate phase, 94 ℃ of 30sec of denaturation temperature, 64 ℃ of 90sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 16 times, every circulation primary, described annealing temperature reduces by 0.5 ℃; Phase III, 94 ℃ of 30sec of denaturation temperature, 58 ℃ of 30sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 24 times; Fourth stage, 72 ℃ of 10min; Five-stage, amplified reaction finishes, and amplified production is preserved at 4 ℃.
The method that the present invention also aims to provide a kind of RUNX1 of detection gene the 5th exons mutation site, it comprises the steps:
(1) extract sample DNA;
(2) utilize pair for amplification primer RUNX1-exon5-F and RUNX1-exon5-R to increase to the DNA in (1), obtain amplified production;
(3) utilize a pair of sequencing primer RUNX1-exon5-S-F and RUNX1-exon5-S-R to check order to the amplified production in (2), obtain the gene order of described amplified production;
(4) gene order in (3) and RUNX1 gene wild-type reference sequences RUNX1-ref are compared, determine whether mutational site exists, and it is characterized in that,
RUNX1-exon5-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R：AATCTGAGACATGGTCCCTG
RUNX1-exon5-S-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R：AATCTGAGACATGGTCCCTG。
Further, the amplification reaction condition of step (2) is: first stage, 95 ℃ of denaturation 10min; Subordinate phase, 94 ℃ of 30sec of denaturation temperature, 64 ℃ of 90sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 16 times, every circulation primary, described annealing temperature reduces by 0.5 ℃; Phase III, 94 ℃ of 30sec of denaturation temperature, 58 ℃ of 30sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 24 times; Fourth stage, 72 ℃ of 10min; Five-stage, amplified reaction finishes, and amplified production is preserved at 4 ℃.
The test kit that the present invention also aims to provide a kind of RUNX1 of detection gene the 5th exons mutation site, is characterized in that, described test kit comprises sample DNA extraction agent; Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative control product and blank product, wherein detection system PCR reaction solution comprises pair for amplification product RUNX1-exon5-F and RUNX1-exon5-R, order-checking system reaction solution comprises a pair of sequencing primer RUNX1-exon5-S-F and RUNX1-exon5-S-R, it is characterized in that:
RUNX1-exon5-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R：AATCTGAGACATGGTCCCTG
RUNX1-exon5-S-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R：AATCTGAGACATGGTCCCTG。
Further, described test kit also comprises RUNX1 gene wild-type reference sequences RUNX1-ref.
Further, described order-checking refined solution also comprises the order-checking refined solution being comprised of alkaline phosphatase and exonuclease I.
Beneficial effect of the present invention: the present invention is just designing amplification RUNX1 gene the 5th exons mutation site, reverse primer, built stable Touch-down pcr amplification system, whole the 5th exon is increased, comprise all mutational sites to be detected, when amplification, the specific amplification products of the correct pairing of the forward and reverse primer of enrichment and template, improves specific amplification simultaneously.In addition, by adjusting the reaction conditions such as concentration, annealing temperature of forward and reverse amplimer, can make amplification efficiency reach best, and adopt Sanger sequencing, pcr amplification product is carried out to the sudden change situation that sex change after sequencing reaction amplification, purifying, direct Sequencing detect each mutational site in RUNX1 gene the 5th exon, there is highly sensitive, simple to operate and low cost and other advantages.
Accompanying drawing explanation
The detected result figure of Fig. 1 sample 1.
The detected result figure of Fig. 2 sample 2.
The detected result figure of Fig. 3 sample 3.
The detected result figure of Fig. 4 sample 4.
The detected result figure of Fig. 5 sample 5.
The detected result figure of Fig. 6 sample 6.
The detected result figure of Fig. 7 sample 7.
The detected result figure of Fig. 8 sample 8.
Embodiment
Below in conjunction with specific embodiments and the drawings, further set forth the present invention.Should be noted that, unaccounted normal condition and method in embodiment, conventionally according to the conventional employing method of affiliated field experimenter: for example, Ao Sibai and James Kingston chief editor's < < fine works molecular biology experiment guide > > the 4th edition, or the step of advising according to manufacturer and condition.
Embodiment 1
The primer that detects RUNX1 gene the 5th exons mutation site, comprising: the forward and reverse primer in amplification RUNX1 gene the 5th exons mutation site; Its base sequence is:
RUNX1-exon5-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R：AATCTGAGACATGGTCCCTG。
Preferably, described primer also comprises a pair of sequencing primer, and its base sequence is
RUNX1-exon5-S-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R：AATCTGAGACATGGTCCCTG。
In detection, first utilize above-mentioned forward and reverse primer pair RUNX1 gene the 5th exons mutation site to increase, obtain amplified production, then utilize above-mentioned a pair of sequencing primer to check order to amplified production, obtain the gene order of amplified production.
The test kit that detects RUNX1 gene the 5th exons mutation site, comprising: sample DNA extraction agent (for example carrying out extracting sample DNA with a day test kit for root biology); Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative control product and blank product, wherein
Detection system PCR reaction solution comprises: 2 * PCR Buffer; 2mM dNTPs; KOD FX DNA Polymerase (1U/ μ l); Forward and reverse primer RUNX1-exon5-F (10 μ m), the RUNX1-exon5-R (10 μ m) in amplification RUNX1 gene the 5th exons mutation site.
Order-checking system reaction solution comprises: order-checking refined solution, EDTA (125mmol), dehydrated alcohol, 75% ethanol, HIDI(height deionized formamide), sequencing primer: RUNX1-exon5-S-F (3.2 μ m), RUNX1-exon5-S-R (3.2 μ m), and Bigdye Terminator V3.1(buys from U.S. Applied Biosystems company), the refined solution that wherein checks order comprises shrimp alkaline phosphotase (SAP) 0.6U and exonuclease I (EXONI) 1.2U.
Detection system PCR reaction solution reagent is formulated as follows:
Wherein, the base sequence of RUNX1-exon5-F and RUNX1-exon5-R is:
| Primer title | Base sequence |
| RUNX1-exon5-F | ATTAATGATTGGTTATTCAACAG |
| RUNX1-exon5-R | AATCTGAGACATGGTCCCTG |
Positive reference substance: the solution that contains RUNX1 sequence.
Negative control product: without the solution of RUNX1 sequence.
Blank product: 2 μ l physiological saline or do not add any material.
Preferably, this test kit also comprises RUNX1 gene wild-type reference sequences RUNX1-ref, and its base sequence is as follows: ATTAATGATTGGTTATTCAACAGATATGTTCAGGCCACCAACCTCATTCTGTTTTG TTCTCTATCGTGTCCCCACAGGGAAAAGCTTCACTCTGACCATCACTGTCTTCACA AACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCC CCGAGAACCTCGAAGTAAGTGCATCCACTTGGGGCTGGTACACCCTCCAGGCTGGT ACACCCTCCAGGCTGGTATACTCAGGGACCATGTCTCAGATT.
Embodiment 2
Testing process:
(1) utilize blood DNA extraction agent box (it root is biological) to extract the genomic dna in blood sample:
1) extract 500uL blood and add 1000uL erythrocyte cracked liquid, put upside down and mix, room temperature is placed 5 minutes, during put upside down and mix several times again.The centrifugal 5min of 3000rpm, sucks supernatant, leaves white corpuscle precipitation, adds 200uL damping fluid GA, and vibration is to thoroughly mixing.
2) add 20 μ l Proteinase K solution, mix.
3) add 200 μ l damping fluid GB, fully put upside down and mix, place 10 minutes for 70 ℃, solution strain is limpid, brief centrifugal to remove the globule of cap wall.
4) add 200 μ l dehydrated alcohols, fully vibration mixes 15 seconds, now may occur flocks, brief centrifugal to remove the globule of cap wall.
5) previous step gained solution and flocks are all added in an adsorption column CB3 (adsorption column is put into collection tube), centrifugal 30 seconds of 12,000rpm (13,400 * g), outwells waste liquid, and adsorption column CB3 is put back in collection tube.
6) before adding in adsorption column CB3 500 μ l damping fluid GD(to use, please first check whether added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 * g), outwells waste liquid, and adsorption column CB3 is put into collection tube.
7) before adding in adsorption column CB3 700 μ l rinsing liquid PW(to use, please first check whether added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 * g), outwells waste liquid, and adsorption column CB3 is put into collection tube.
8) in adsorption column CB3, add 500 μ l rinsing liquid PW, centrifugal 30 seconds of 12,000rpm (13,400 * g), outwells waste liquid.
9) adsorption column CB3 is put back in collection tube, centrifugal 2 minutes of 12,000rpm (13,400 * g), outwells waste liquid.Adsorption column CB3 is placed in to room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.
10) adsorption column CB3 is proceeded in a clean centrifuge tube, to the unsettled dropping 100 μ l elution buffer TE in middle part of adsorption film, room temperature is placed 2-5 minute, centrifugal 2 minutes of 12,000rpm (13,400 * g), solution is collected in centrifuge tube, obtained poba gene group DNA solution.
(2) reagent configuration: by detecting each X μ l of people's umber configuration detection system PCR reaction solution, every person-portion 18 μ l packing:
X=18 μ l reaction solution * (part negative control+1, n increment basis+1 part of positive control+1 part blank)
N is for detecting sample number.
(3) application of sample: the poba gene group DNA solution obtaining in 2ul step (1) is joined in detection system PCR reaction solution; For positive control experiment, directly add 2ul positive reference substance; For negative control experiment, directly add 2ul negative control product; For blank experiment, add 2ul physiological saline or do not add any material.
(4) Touch-down pcr amplification: detect and carry out on conventional PCR instrument, obtain pcr amplification product, available instrument comprises ABI veriti(U.S. Applied Biosystems company) etc.Reaction conditions is as follows:
(5) Sanger order-checking:
Get 9 μ l pcr amplification products and 2 μ l order-checking refined solution.According to following program, carry out purifying, thereby obtain purified product:
1 μ l purified product is mixed according to following system with sequencing primer RUNX1-exon5-S-F (3.2 μ m) and RUNX1-exon5-S-R (3.2 μ m) respectively:
Sequencing reaction program:
Precipitation link:
To completing the EDTA that adds 2 μ l 125mmol in the product of sequencing reaction, standing 5min; Add 15ml dehydrated alcohol, whirlpool mixes; The centrifugal 30min of 3700rpm; Be inverted centrifugal 15sec, add 50ml 70% ethanol, whirlpool mixes; The centrifugal 15min of 3700rpm; Be inverted centrifugal 15sec, be placed on 95 ℃ of metal baths; After adding 10 μ l HIDI, carry out denatured test.Sex change program:
After sex change EP (end of program), upper sequenator (ABI3730) order-checking, the gene order of acquisition pcr amplification product.
(6) result judgement: the gene order and the RUNX1 gene wild-type reference sequences RUNX1-ref that obtain in (5) are compared, according to reality sudden change situation, result is reported.
Embodiment 3
Adopt kit for detecting nucleic acid of the present invention to detect clinical sample.
Fetch and deliver inspection acute myeloid leukaemia (AML) patient anticoagulation sample 20 examples, by testing process described in embodiment 2, extract the genomic dna in sample, reagent preparation also detects.
Every part of sample genomic dna solution that 2ul is extracted according to testing process described in embodiment 2 adds in detection system PCR reaction solution.Do the positive, feminine gender and blank, the regular-PCR instrument in 96 holes can detect 46 increments originally simultaneously simultaneously, and each sample repeats for 2 times, a positive control, a negative control and a blank.Be 160 minutes detection time.
The amplified production of every part of sample genomic dna is after twice Sanger order-checking, and the sequencing sequence that relatively this twice order-checking of RUNX1 gene the 5th exon pcr amplification product obtains, will check order for the third time for the skimble-scamble sample of result.Utilize multipair primer and many probes to carry out quantitative fluorescent PCR (probe method) simultaneously and detect, to compare with Sanger sequencing.Finally, according to sequencing result, prognosis is judged.
Detected result is as following table:
| Sample number | Detected result of the present invention | Fluorescent quantitation detected result | Prognosis situation |
| 1 | Not sudden change | Not sudden change | Prognosis bona |
| 2 | Not sudden change | Not sudden change | Prognosis bona |
| 3 | Not sudden change | Not sudden change | Prognosis bona |
| 4 | Not sudden change | Not sudden change | Prognosis bona |
| 5 | Not sudden change | Not sudden change | Prognosis bona |
| 6 | 593A>T | 593A>T | Prognosis mala |
| 7 | 592G>A | 592G>A | Prognosis mala |
| 8 | Not sudden change | Not sudden change | Prognosis bona |
| 9 | 601C>T | 601C>T | Prognosis mala |
| 10 | Not sudden change | Not sudden change | Prognosis bona |
| 11 | Not sudden change | Not sudden change | Prognosis bona |
| 12 | 602G>A | 602G>A | Prognosis mala |
| 13 | Not sudden change | Not sudden change | Prognosis bona |
| 14 | Not sudden change | Not sudden change | Prognosis bona |
| 15 | 524T>C | 524T>C | Prognosis mala |
| 16 | Not sudden change | Not sudden change | Prognosis bona |
| 17 | Not sudden change | Not sudden change | Prognosis bona |
| 18 | Not sudden change | Not sudden change | Prognosis bona |
| 19 | Not sudden change | Not sudden change | Prognosis bona |
| 20 | Not sudden change | Not sudden change | Prognosis bona |
As can be seen from the above table, in 20 routine samples, RUNX1 gene the 5th exon that the present invention detects in 5 routine samples is undergone mutation, be 524T>C, 592G>A, 593A>T, 601C>T and 602G>A, and provided prognosis guidance according to variation result.According to this table, it can also be seen that the detected result of the present invention in 20 routine sample RUNX1 gene the 5th exons mutation sites is consistent with quantitative fluorescent PCR (probe method) detected result, illustrate that detection method accuracy of the present invention is high.Simultaneously owing to not using multipair primer, many saltant type probes and many wild-type probe of using in quantitative fluorescent PCR (probe method), also just without carrying out multitube PCR reaction, simultaneously also without using the expensive real-time fluorescence quantitative PCR instrument matching with it, thereby reduced testing cost, reduced sample consumption.In addition, before carrying out Sanger order-checking, to sample gene group, DNA carries out Touch-down pcr amplification, allows when the highest 64 ℃ of annealing temperature be reduced to gradually 58 ℃, can improve the specificity of detected result.
Embodiment 4
Get 8 parts of clinical samples, by testing process described in embodiment 2, extract sample genomic dna, reagent preparation and detect.
Every part of sample genomic dna solution that 2ul is extracted according to testing process described in embodiment 2 adds in detection system PCR reaction solution.Do the positive, feminine gender and blank, the regular-PCR instrument in 96 holes can detect 46 increments originally simultaneously simultaneously, and each sample repeats for 2 times, a positive control, a negative control and a blank.Be 160 minutes detection time.
The forward sequencing result of sample 1 as shown in Figure 1, is wild-type, prognosis bona, and suggestion maintains current treatment plan.
The forward sequencing result of sample 2 as shown in Figure 2, for 524T>C sudden change, causes Leu175Pro, and this prognosis mala that suddenlys change, advises row allotransplantation as early as possible.
The forward sequencing result of sample 3 as shown in Figure 3, is wild-type, prognosis bona, and suggestion maintains current treatment plan.
The forward sequencing result of sample 4 as shown in Figure 4, for 592G>A sudden change, causes Asp198Asn, and this prognosis mala that suddenlys change, advises row allotransplantation as early as possible.
The forward sequencing result of sample 5 as shown in Figure 5, for 593A>T sudden change, causes Asp198Val, and this prognosis mala that suddenlys change, advises row allotransplantation as early as possible.
The forward sequencing result of sample 6 as shown in Figure 6, is wild-type, prognosis bona, and suggestion maintains current treatment plan.
The forward sequencing result of sample 7 as shown in Figure 7, for 601C>T sudden change, causes Arg201 terminator codon, and this prognosis mala that suddenlys change, advises row allotransplantation as early as possible.
The forward sequencing result of sample 8 as shown in Figure 8, for 602G>A sudden change, causes Arg201Gln, and this prognosis mala that suddenlys change, advises row allotransplantation as early as possible.
SEQUENCE LISTING
<110> Shenyang company limited of Ai Dikang medical test institute
<120> detects method and the primer in RUNX1 gene the 5th exons mutation site
<130>
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 23
<212> DNA
<213> artificial sequence
<400> 1
attaatgatt ggttattcaa cag 23
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
<400> 2
aatctgagac atggtccctg 20
<210> 3
<211> 23
<212> DNA
<213> artificial sequence
<400> 3
attaatgatt ggttattcaa cag 23
<210> 4
<211> 20
<212> DNA
<213> artificial sequence
<400> 4
aatctgagac atggtccctg 20
<210> 5
<211> 266
<212> DNA
<213> RUNX1 gene wild-type reference sequences RUNX1-ref
<400> 5
attaatgatt ggttattcaa cagatatgtt caggccacca acctcattct gttttgttct 60
ctatcgtgtc cccacaggga aaagcttcac tctgaccatc actgtcttca caaacccacc 120
gcaagtcgcc acctaccaca gagccatcaa aatcacagtg gatgggcccc gagaacctcg 180
aagtaagtgc atccacttgg ggctggtaca ccctccaggc tggtacaccc tccaggctgg 240
tatactcagg gaccatgtct cagatt 266
Claims (7)
1. detect the primer in RUNX1 gene the 5th exons mutation site, it is characterized in that, comprising: the forward and reverse primer in amplification RUNX1 gene the 5th exons mutation site; Its base sequence is:
RUNX1-exon5-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R：AATCTGAGACATGGTCCCTG。
2. primer as claimed in claim 1, is characterized in that, described primer also comprises a pair of sequencing primer, and its base sequence is:
RUNX1-exon5-S-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R：AATCTGAGACATGGTCCCTG。
3. the primer as described in one of claim 1 to 2, is characterized in that, the working concentration ratio of described forward and reverse primer is: RUNX1-exon5-F: RUNX1-exon5-R=1:1.
4. the primer as described in one of claim 1 to 2, is characterized in that, the working concentration ratio of described a pair of sequencing primer is: RUNX1-exon5-S-F: RUNX1-exon5-S-R=1:1.
5. primer as claimed in claim 1, is characterized in that, the amplification reaction condition of described forward and reverse amplimer is: first stage, 95 ℃ of denaturation 10min; Subordinate phase, 94 ℃ of 30sec of denaturation temperature, 64 ℃ of 90sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 16 times, every circulation primary, described annealing temperature reduces by 0.5 ℃; Phase III, 94 ℃ of 30sec of denaturation temperature, 58 ℃ of 30sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 24 times; Fourth stage, 72 ℃ of 10min; Five-stage, amplified reaction finishes, and amplified production is preserved at 4 ℃.
6. a method that detects RUNX1 gene the 5th exons mutation site, it comprises the steps:
(1) extract sample DNA;
(2) utilize pair for amplification primer RUNX1-exon5-F and RUNX1-exon5-R to increase to the DNA in (1), obtain amplified production;
(3) utilize a pair of sequencing primer RUNX1-exon5-S-F and RUNX1-exon5-S-R to check order to the amplified production in (2), obtain the gene order of described amplified production;
(4) gene order in (3) and RUNX1 gene wild-type reference sequences RUNX1-ref are compared, determine whether mutational site exists, and it is characterized in that,
RUNX1-exon5-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-R：AATCTGAGACATGGTCCCTG
RUNX1-exon5-S-F：ATTAATGATTGGTTATTCAACAG
RUNX1-exon5-S-R：AATCTGAGACATGGTCCCTG。
7. method as claimed in claim 6, is characterized in that, the amplification reaction condition of step (2) is: first stage, 95 ℃ of denaturation 10min; Subordinate phase, 94 ℃ of 30sec of denaturation temperature, 64 ℃ of 90sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 16 times, every circulation primary, described annealing temperature reduces by 0.5 ℃; Phase III, 94 ℃ of 30sec of denaturation temperature, 58 ℃ of 30sec of annealing temperature, 72 ℃ of 30sec of elongating temperature, circulate 24 times; Fourth stage, 72 ℃ of 10min; Five-stage, amplified reaction finishes, and amplified production is preserved at 4 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310665776.0A CN103710438B (en) | 2013-12-06 | 2013-12-06 | The method in detection RUNX1 gene the 5th exons mutation site and primer |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310665776.0A CN103710438B (en) | 2013-12-06 | 2013-12-06 | The method in detection RUNX1 gene the 5th exons mutation site and primer |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103710438A true CN103710438A (en) | 2014-04-09 |
| CN103710438B CN103710438B (en) | 2016-06-08 |
Family
ID=50403789
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310665776.0A Active CN103710438B (en) | 2013-12-06 | 2013-12-06 | The method in detection RUNX1 gene the 5th exons mutation site and primer |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710438B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695596A (en) * | 2016-03-22 | 2016-06-22 | 南京艾迪康医学检验所有限公司 | Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene |
| CN106399567A (en) * | 2016-11-25 | 2017-02-15 | 杭州华硕医学检验所有限公司 | Primer for detecting WRAP53 gene mutation and application of primer |
| CN107245529A (en) * | 2017-08-08 | 2017-10-13 | 杭州千麦医学检验所有限公司 | Blood disease fusion screening method |
-
2013
- 2013-12-06 CN CN201310665776.0A patent/CN103710438B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| C Y CHEN ET AL: "RUNX1 gene mutation in primary myelodysplastic syndrome – the mutation can be detected early at diagnosis or acquired during disease progression and is associated with poor outcome", 《BIRITISH JOURNAL OF HAEMATOLOGY》, 31 December 2007 (2007-12-31), pages 405 - 414 * |
| HIRONORI HARADA ET AL: "High incidence of somatic mutations in the AML1/RUNX1 gene in myelodysplastic syndrome and low blast percentage myeloid leukemia with myelodysplasia", 《BLOOD 》, vol. 103, no. 6, 15 March 2004 (2004-03-15), pages 2316 - 2319 * |
| VERENA I. GAIDZIK ET AL: "RUNX1 Mutations in Acute Myeloid Leukemia: Results From a Comprehensive Genetic and Clinical Analysis From the AML Study Group", 《JOURNAL OF CLINICAL ONCOLOGY》, vol. 29, no. 10, 1 April 2011 (2011-04-01), pages 1364 - 1370, XP009152359 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105695596A (en) * | 2016-03-22 | 2016-06-22 | 南京艾迪康医学检验所有限公司 | Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene |
| CN106399567A (en) * | 2016-11-25 | 2017-02-15 | 杭州华硕医学检验所有限公司 | Primer for detecting WRAP53 gene mutation and application of primer |
| CN107245529A (en) * | 2017-08-08 | 2017-10-13 | 杭州千麦医学检验所有限公司 | Blood disease fusion screening method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103710438B (en) | 2016-06-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104531862B (en) | Detect the method and primer in the full exon sequence mutational site of mankind's BRCA1 and BRCA2 gene | |
| CN105506107A (en) | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene | |
| CN104745697B (en) | Detect the method and primer of NF1 the 31st No. 34 full extron of gene | |
| CN105506106A (en) | Method and primer for detecting whole exons of FIX gene | |
| CN104017887A (en) | Primer pair as well as probe and kit for detecting human BRAF gene mutation | |
| CN108531575A (en) | Detect primer, kit and the method for the full exon sequence mutation of TERC genes | |
| CN103710438A (en) | Method and primers for detecting fifth exon mutation site of RUNX1 gene | |
| CN104862407A (en) | Primer and method for detecting EZH2 genes | |
| CN108998525A (en) | Detect primer, method and the kit of ATRX gene point mutation | |
| CN111187828A (en) | Composition, kit and method for detecting polymorphism of human folate metabolism gene | |
| CN115094130A (en) | Detection primer and evaluation model for risk genes of recurrent abortion caused by thrombosis | |
| CN106399567A (en) | Primer for detecting WRAP53 gene mutation and application of primer | |
| CN106086215A (en) | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer | |
| CN103540659B (en) | Detect the method in DNMT3A mutational site, primer and test kit | |
| CN105695596A (en) | Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene | |
| CN108004309A (en) | Detect primer, method and the kit of MTHFR677, MTHFR1298 and MTRR66 | |
| CN106222287A (en) | The method of detection ELA2 gene and primer | |
| CN106868174A (en) | Detect the kit and method of the full extron of ADAMTS13 genes | |
| CN103131776A (en) | A719G single nucleotide polymorphism detection kit of thiopurine methyltransferase (TPMT) * 3C | |
| CN108929903B (en) | Marker and kit for screening, diagnosing and evaluating curative effect of chronic periodontitis | |
| CN107841554A (en) | Detect the primer, kit and method of Hageman factor (F12) gene mutation | |
| CN105316349A (en) | Mycobacterium tuberculosis KatG mutant gene and application thereof | |
| CN103710437B (en) | Detect method and the primer in RUNX1 gene the 3rd exons mutation site | |
| CN106282343A (en) | Detection NOP10 gene the 2nd exon mutational site R34W(C100T) method of series jump and primer | |
| CN103451314A (en) | Primer for detecting IDH1 and IDH2 gene polymorphism mutation sites, method and kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |