CN103710437B - Detect method and the primer in RUNX1 gene the 3rd exons mutation site - Google Patents
Detect method and the primer in RUNX1 gene the 3rd exons mutation site Download PDFInfo
- Publication number
- CN103710437B CN103710437B CN201310665303.0A CN201310665303A CN103710437B CN 103710437 B CN103710437 B CN 103710437B CN 201310665303 A CN201310665303 A CN 201310665303A CN 103710437 B CN103710437 B CN 103710437B
- Authority
- CN
- China
- Prior art keywords
- runx1
- primer
- exon3
- gene
- mutation site
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/118—Prognosis of disease development
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses the method and primer that detect RUNX1 gene the 3rd exons mutation site, described primer and method include forward and reverse primer and a pair sequencing primer that amplification covers RUNX1 gene the 3rd exons mutation site.Based on employing Sanger sequencing, described a pair sequencing primer is utilized to can be used for the catastrophe in RUNX1 gene the 3rd exons mutation site in rapid detection patients with acute myeloid leukemia body.
Description
Technical field
The invention belongs to life science and biological technical field, particularly detect primer and the method in RUNX1 gene the 3rd exons mutation site.
Background technology
Acute myeloid leukaemia (AML) is due to the acquired gene alteration of medullary system hematopoietic stem/progenitor generation cumulative bad, causes a kind of malignant disease that cell proliferation, differentiation and apoptosis pathway change.
RUNX1 is also called AML1, is one of member in RUNX transcription factor protein family, is the modal target site of chromosomal translocations of human leukemias.RUNX1 is very important transcription factor, two-way (promote or suppress) can regulate hematopoiesis correlation factor, thus the differentiation of adjustment hemopoietic stem cell, apoptosis and self.RUNX1 point mutation often can occur in myelodysplastic syndrome (MDS), AML, chronic myelomonocytic leukemia (CMML), more rare in bone marrow proliferative tumour (MPN).Have research to point out, the mutation rate of RUNX1 is be 37% in 23%, CMML in 32%, MDS in AML.In childhood leukemia cells, found multiple nonrandom chromosome translocation, wherein RUNX1 gets involved at most, accounts for leukemia of children case more than 30%, as t (12; 21) (TEL-RUNX1), t (8; 21) (RUNX1-ETO/MTG8), t (16; 21) (RUNX1-MTG16) etc.RUNX1 sudden change indication patient prognosis mala.Carry out RUNX1 Mutation Screening to patient may contribute to carrying out clinical risk layering and formulating Treatment decsion.
In bibliographical information, although people do not find that RUNX1 gene exists mutantional hotspot, the catastrophe of its 1-8 exon generally all can be detected.The probability of sudden change is higher, mainly for the detection of the 3rd exons mutation situation in the present invention separately to have bibliographical information the 3rd, 4,5,8 exon to occur.
Method restricted property fragment length polymorphism (ssCp) of current available detection in Gene Mutation, gene sequencing and quantitative fluorescent PCR etc.SsCp technology is relatively simple, but restriction enzyme site is subject to genovariation impact, and affect result and judge, due to the technical limitation of method itself, detection sensitivity is low.Fluorescence quantitative PCR method is adopted to detect RUNX1 gene the 3rd exons mutation, because the exon sequence detected is longer and relate to multiple mutational site, so need to design multipair primer and probe, both 3 mutational sites specific bindings respectively that 3 articles of saltant type probes and RUNX1 gene the 3rd exon cover had been designed, design the DNA that 3 corresponding wild-type probe do not suddenly change with 3 sites to be respectively combined, both detected a DNA sample to carry out 3 pipe PCR simultaneously and react, every tube reaction system comprises 1 pair of amplimer, article 1, wild-type probe, article 1, corresponding saltant type probe, to the large usage quantity of sample DNA, testing cost is also very high, inconvenience is brought to clinical application.In addition, prior art is only detect the higher single-site mutant of sudden change probability of occurrence, and does not detect the overall catastrophe of the 3rd exon.
The present invention adopts Sanger sequencing to detect the sudden change of RUNX1 gene the 3rd exon, and the primer of design can expand whole 3rd exon, cover all mutational sites to be detected, both detected a DNA sample only to need to carry out 1 pipe PCR and react, the DNA sample consumption of 2/3 can be saved with fluorescent quantitation Measures compare, and save testing cost significantly.
Summary of the invention
The invention provides the primer detecting RUNX1 gene the 3rd exons mutation site, adopt Sanger sequencing, can be used for the catastrophe in RUNX1 gene the 3rd exons mutation site in rapid detection AML patient body.
The object of the present invention is to provide the primer detecting RUNX1 gene the 3rd exons mutation site, it is characterized in that, comprising: amplification covers the forward and reverse primer in RUNX1 gene the 3rd exons mutation site; Its base sequence is:
RUNX1-exon3-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-R：GGCCAGTACCTTGAAAGCGAT。
Further, described primer also comprises a pair sequencing primer, and its base sequence is
RUNX1-exon3-S-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-S-R：GGCCAGTACCTTGAAAGCGAT。
Further, the working concentration ratio of described forward and reverse primer is: RUNX1-exon3-F:RUNX1-exon3-R=1:1.
Further, the working concentration ratio of described a pair sequencing primer is: RUNX1-exon3-S-F:RUNX1-exon3-S-R=1:1.
The present invention also aims to provide a kind of method detecting RUNX1 gene the 3rd exons mutation site, it comprises the steps:
(1) sample DNA is extracted;
(2) utilize pair for amplification primer RUNX1-exon3-F and RUNX1-exon3-R to increase to the DNA in (1), obtain the amplified production covering RUNX1 gene the 3rd exons mutation site;
(3) utilize a pair sequencing primer RUNX1-exon3-S-F and RUNX1-exon3-S-R to carry out forward and backward sequencing to the amplified production in (2), obtain the gene order of described amplified production;
(4) gene order in (3) and wild-type RUNX1 gene order are compared, determine whether mutational site exists, and it is characterized in that,
RUNX1-exon3-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-R：GGCCAGTACCTTGAAAGCGAT
RUNX1-exon3-S-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-S-R：GGCCAGTACCTTGAAAGCGAT
The present invention also aims to provide a kind of test kit detecting RUNX1 gene the 3rd exons mutation site, it is characterized in that, described test kit comprises sample DNA extraction agent; Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative controls and blank product, wherein detection system PCR reaction solution comprises pair for amplification primer RUNX1-exon3-F and RUNX1-exon3-R, order-checking system comprises a pair sequencing primer RUNX1-exon3-S-F and RUNX1-exon3-S-R, it is characterized in that:
RUNX1-exon3-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-R：GGCCAGTACCTTGAAAGCGAT
RUNX1-exon3-S-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-S-R：GGCCAGTACCTTGAAAGCGAT
Further, described detection system PCR reaction solution also comprises 2 × PCRBuffer; DNTPs; KODFXDNAPolymerase.
Further, described order-checking system also comprises order-checking refined solution, EDTA, dehydrated alcohol, 75% ethanol, HIDI and BigdyeTerminatorV3.1.
Further, described order-checking refined solution comprises shrimp alkaline phosphotase and exonuclease I.
The present invention devises amplification and is just covering RUNX1 gene the 3rd exons mutation site, reverse primer, and a pair sequencing primer obtained amplified production being carried out to forward and reverse order-checking.Carry out pcr amplification to censorship sample, adopt Sanger sequencing, sex change after carrying out forward and reverse sequencing reaction amplification, purifying to PCR primer, direct Sequencing accurately can detect the catastrophe in each mutational site in RUNX1 gene the 3rd exon.By adjusting the reaction conditions such as concentration, annealing temperature of forward and reverse primer, amplification efficiency can be made to reach best.
Beneficial effect: adopt Sanger sequencing to detect the sudden change of RUNX1 gene the 3rd exon, whole 3rd exon can be expanded, cover all mutational sites to be detected; There is very high specificity and accuracy; Adopt PCR method amplifying target genes and its gene pleiomorphism of order-checking detection, have highly sensitive, simple to operate, low cost and other advantages.
Accompanying drawing explanation
The detected result figure of Fig. 1 sample 1.
The detected result figure of Fig. 2 sample 2.
The detected result figure of Fig. 3 sample 3.
The detected result figure of Fig. 4 sample 4.
The detected result figure of Fig. 5 sample 5.
The detected result figure of Fig. 6 sample 6.
Embodiment
Below in conjunction with specific embodiments and the drawings, set forth the present invention further.Should be noted that, unaccounted normal condition and method in embodiment, usually according to the conventional employing method of affiliated field experimenter: such as, " the fine works molecular biology experiment guide " the 4th edition of Ao Sibai and James Kingston chief editor, or the step of advising according to manufacturer and condition.
Embodiment 1
Detect the primer in RUNX1 gene the 3rd exons mutation site, comprising: amplification covers the forward and reverse primer in RUNX1 gene the 3rd exons mutation site; Its base sequence is:
RUNX1-exon3-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-R：GGCCAGTACCTTGAAAGCGAT。
Preferably, described primer also comprises a pair sequencing primer, and its base sequence is
RUNX1-exon3-S-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-S-R：GGCCAGTACCTTGAAAGCGAT。
In the detection, the DNA fragmentation first utilizing above-mentioned forward and reverse primer pair to cover RUNX1 gene the 3rd exons mutation site increases, obtain amplified production, then utilize above-mentioned a pair sequencing primer to check order to amplified production, obtain the gene order of amplified production.
Detect the test kit in RUNX1 gene the 3rd exons mutation site, comprising: tissue DNA extraction agent box (such as using the extraction test kit of sky root biology); Dehydrated alcohol; Detection system PCR reaction solution, order-checking system reaction solution, positive reference substance, negative controls and blank product, wherein
Detection system PCR reaction solution comprises: 2 × PCRBuffer; 2mMdNTPs; KODFXDNAPolymerase (1U/ μ l); Testing goal gene is used, downstream primer RUNX1-exon3-F (10 μm), RUNX1-exon3-R (10 μm).
Order-checking system comprises: order-checking refined solution, EDTA (125mmol), dehydrated alcohol, 75% ethanol, HIDI(height deionized formamide), sequencing primer: RUNX1-exon3-S-F (3.2 μm), RUNX1-exon3-S-R (3.2 μm), and BigdyeTerminatorV3.1(buys from AppliedBiosystems company of the U.S.), the refined solution that wherein checks order comprises shrimp alkaline phosphotase (SAP) 0.6U and exonuclease I (EXONI) 1.2U.
Detection system PCR reaction solution is formulated as follows:
Wherein, the base sequence of RUNX1-exon3-F and RUNX1-exon3-R is:
| Primer | Primer sequence |
| RUNX1-exon3-F | CCTAACTCAATCGGCTTGTTGT |
| RUNX1-exon3-R | GGCCAGTACCTTGAAAGCGAT |
Positive reference substance: the solution containing RUNX1 sequence.
Negative controls: without the solution of RUNX1 sequence.
Blank product: 2 μ l physiological saline or do not add any material.
Embodiment 2
The operating process of blood DNA extraction agent box (sky root is biological):
(1) genomic dna in extracting blood:
1) extract 500uL blood and add 1000uL erythrocyte cracked liquid, put upside down mixing, room temperature places 5 minutes, and period puts upside down mixing several times again.The centrifugal 5min of 3000rpm, sucks supernatant, leaves leukocyte cell pellet, adds 200uL damping fluid GA, and vibration is to thoroughly mixing.
2) 20 μ l Proteinase K Solution are added, mixing.
3) add 200 μ l damping fluid GB, fully put upside down mixing, place 10 minutes for 70 DEG C, solution strain is limpid, and brief centrifugation is to remove the globule of cap wall.
4) add 200 μ l dehydrated alcohols, fully vibration mixing 15 seconds, now may occur flocks, brief centrifugation is to remove the globule of cap wall.
5) all add in an adsorption column CB3 (adsorption column puts into collection tube) by previous step gained solution and flocks, centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid, is put back in collection tube by adsorption column CB3.
6) please first check whether add 500 μ l damping fluid GD(uses in adsorption column CB3 before and added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid, adsorption column CB3 is put into collection tube.
7) please first check whether add 700 μ l rinsing liquid PW(uses in adsorption column CB3 before and added dehydrated alcohol), centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid, adsorption column CB3 is put into collection tube.
8) in adsorption column CB3, add 500 μ l rinsing liquid PW, centrifugal 30 seconds of 12,000rpm (13,400 × g), outwells waste liquid.
9) put back in collection tube by adsorption column CB3, centrifugal 2 minutes of 12,000rpm (13,400 × g), outwells waste liquid.Adsorption column CB3 is placed in room temperature and places several minutes, thoroughly to dry rinsing liquid remaining in sorbing material.
10) adsorption column CB3 is proceeded in a clean centrifuge tube, the unsettled dropping 100 in middle part to adsorption film μ l elution buffer TE, room temperature places 2-5 minute, 12,000rpm (13,400 × g) centrifugal 2 minutes, by solution collection in centrifuge tube, obtain poba gene group DNA solution.
(2) reagent configuration: by detecting people's number configuration detection system PCR reaction solution each X μ l, every person-portion 18 μ l packing:
X=18 μ l reaction solution × (n part sample+1 part of positive control+1 part of negative control+1 part of blank)
N is for detecting number of samples.
(3) application of sample: the poba gene group DNA solution obtained in 2ul step (1) is joined in detection system PCR reaction solution; For positive control experiment, directly add 2ul positive reference substance; For negative control experiment, directly add 2ul negative controls; For blank experiment, add 2ul physiological saline or do not add any material.
(4) Touch-downPCR amplification: detect and carry out on Standard PCR instrument, available instrumentation comprises AppliedBiosystems company of the ABIveriti(U.S.) etc.Reaction conditions is as follows:
(5) Sanger order-checking:
Get 9 μ lPCR products and 2 μ l to check order refined solution.Carry out purifying according to following program, obtain purified product:
1 μ l purified product is mixed according to following system with sequencing primer RUNX1-exon3-S-F (3.2 μm) and RUNX1-exon3-S-R (3.2 μm) respectively:
Sequencing reaction program:
Precipitation link:
In the product completing sequencing reaction, add the EDTA of 2 μ l125mmol, leave standstill 5min; Add 15ml dehydrated alcohol, whirlpool mixes; The centrifugal 30min of 3700rpm; Be inverted centrifugal 15sec, add 50ml70% ethanol, whirlpool mixes; The centrifugal 15min of 3700rpm; Be inverted centrifugal 15sec, be placed on 95 DEG C of metal baths; Denatured test is carried out after adding 10 μ lHIDI.Denaturation program:
After denaturation program terminates, upper sequenator (ABI3730) checks order.
(7) result judges: sequencing result and wild-type reference sequence (GeneBankNo.:NG_011402.2) are compared, report according to actual catastrophe to result.
Embodiment 3
Kit for detecting nucleic acid of the present invention is adopted to detect clinical samples.
Fetch and deliver inspection acute myeloid leukaemia (AML) patient anticoagulation sample 20 example, the control group experiment of this 20 routine sample, completed by the method for quantitative fluorescent PCR by outsourcing company, detected result sees the following form 1.
Experimental group extracts sample genomic dna by method described in embodiment 2, and reagent preparation also detects.Every part of sample adds 2 μ l in detection system PCR reaction solution.Do the positive, negative, blank, each sample repeats for 2 times, a positive control, a negative control and a blank simultaneously.Detection time is 160 minutes.
Each sample is after 2 order-checkings, and the situation of comparison sudden change, will carry out third time order-checking for the skimble-scamble sample of result.Finally, according to sequencing result, prognosis is judged.
Detected result is as following table 1:
| Sample number | Fluorescent quantitation result | Sequencing result | Prognosis situation |
| 1 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 2 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 3 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 4 | 167T>C | 167T>C | Prognosis mala |
| 5 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 6 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 7 | 319C>T | 319C>T | Prognosis mala |
| 8 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 9 | 329A>G | 329A>G | Prognosis mala |
| 10 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 11 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 12 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 13 | 319C>T | 319C>T | Prognosis mala |
| 14 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 15 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 16 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 17 | 329A>G | 329A>G | Prognosis mala |
| 18 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 19 | Do not suddenly change | Do not suddenly change | Prognosis bona |
| 20 | Do not suddenly change | Do not suddenly change | Prognosis bona |
As can be seen from the above table, the fluorescent quantitation detected result of 20 routine sample DNAs is consistent with sequencing result, illustrates that detected result accuracy of the present invention is high, has saved testing cost, decreased the usage quantity of sample DNA.
Embodiment 4
Get clinical sample 6 parts, extract genome, reagent preparation detecting by method described in embodiment 2.Every increment product add 2 μ l in detection system PCR reaction solution.Do the positive simultaneously, negative, each portion of blank.Detect with regular-PCR instrument, the time is 160 minutes.
The forward sequencing result of sample 1 as shown in Figure 1, is wild-type, prognosis bona, and suggestion maintains Current treatment protocols.
The forward sequencing result of sample 2 as shown in Figure 2, is 167T>C sudden change, causes Leu56Ser, this sudden change prognosis mala, advise row allotransplantation as early as possible.
The forward sequencing result of sample 3 as shown in Figure 1, is wild-type, prognosis bona, and suggestion maintains Current treatment protocols.
The forward sequencing result of sample 4 as shown in Figure 4, is 319C>T sudden change, causes Arg107Cys, this sudden change prognosis mala, advise row allotransplantation as early as possible.
The forward sequencing result of sample 5 as shown in Figure 5, is wild-type, prognosis bona, and suggestion maintains Current treatment protocols.The forward sequencing result of sample 6 as shown in Figure 6, is 329A>G sudden change, causes Lys110Arg, this sudden change prognosis mala, advise row allotransplantation as early as possible.
SEQUENCELISTING
<110> Shenyang company limited of Ai Dikang medical test institute
<120> detects method and the primer in RUNX1 gene the 3rd exons mutation site
<130>
<160>4
<170>PatentInversion3.3
<210>1
<211>22
<212>DNA
<213> artificial sequence
<400>1
cctaactcaatcggcttgttgt22
<210>2
<211>21
<212>DNA
<213> artificial sequence
<400>2
ggccagtaccttgaaagcgat21
<210>3
<211>22
<212>DNA
<213> artificial sequence
<400>3
cctaactcaatcggcttgttgt22
<210>4
<211>21
<212>DNA
<213> artificial sequence
<400>4
ggccagtaccttgaaagcgat21
Claims (3)
1. adopt Sanger sequencing to detect the primer in RUNX1 gene the 3rd exons mutation site, it is characterized in that, comprising: amplification covers the forward and reverse primer in RUNX1 gene the 3rd exons mutation site; Its base sequence is:
RUNX1-exon3-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-R：GGCCAGTACCTTGAAAGCGAT；
Also comprise a pair sequencing primer, its base sequence is:
RUNX1-exon3-S-F：CCTAACTCAATCGGCTTGTTGT
RUNX1-exon3-S-R：GGCCAGTACCTTGAAAGCGAT。
2. primer as claimed in claim 1, is characterized in that, the forward and reverse primer that described amplification covers RUNX1 gene the 3rd exons mutation site uses under following amplified reaction step condition:
Step 1:95 DEG C, 10min, cycle number: 1;
Step 2:94 DEG C, 30sec, 64 DEG C, 90sec, 72 DEG C, 30sec, cycle number: 16, every circulation primary reduces by 0.5 DEG C;
Step 3:94 DEG C, 30sec, 58 DEG C, 30sec, 72 DEG C, 30sec, cycle number: 24;
Step 4:72 DEG C, 10min, cycle number: 1;
Step 5:4 DEG C, preserves, cycle number: 1.
3. primer as claimed in claim 1, is characterized in that, the working concentration ratio that described amplification covers the forward and reverse primer in RUNX1 gene the 3rd exons mutation site is: RUNX1-exon3-F:RUNX1-exon3-R=1:1; The working concentration ratio of described a pair sequencing primer is: RUNX1-exon3-S-F:RUNX1-exon3-S-R=1:1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310665303.0A CN103710437B (en) | 2013-12-06 | 2013-12-06 | Detect method and the primer in RUNX1 gene the 3rd exons mutation site |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310665303.0A CN103710437B (en) | 2013-12-06 | 2013-12-06 | Detect method and the primer in RUNX1 gene the 3rd exons mutation site |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103710437A CN103710437A (en) | 2014-04-09 |
| CN103710437B true CN103710437B (en) | 2016-01-20 |
Family
ID=50403788
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310665303.0A Active CN103710437B (en) | 2013-12-06 | 2013-12-06 | Detect method and the primer in RUNX1 gene the 3rd exons mutation site |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103710437B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102630250A (en) * | 2009-09-25 | 2012-08-08 | 基因诊断测试公司 | Multiplex (+/-) stranded arrays and assays for detecting chromosomal abnormalities associated with cancer and other diseases |
-
2013
- 2013-12-06 CN CN201310665303.0A patent/CN103710437B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102630250A (en) * | 2009-09-25 | 2012-08-08 | 基因诊断测试公司 | Multiplex (+/-) stranded arrays and assays for detecting chromosomal abnormalities associated with cancer and other diseases |
Non-Patent Citations (2)
| Title |
|---|
| Mutations of AML1 are common in therapy-related myelodysplasia following therapy with alkylating agents and are significantly associated with deletion or loss of chromosome arm 7q and with subsequent leukemic transformation;Debes H. Christiansen et al;《BLOOD》;20040901;第104卷(第5期);第1474－1481页 * |
| RUNX1 Mutations in Acute Myeloid Leukemia: Results From a Comprehensive Genetic and Clinical Analysis From the AML Study Group;Verena I. Gaidzik等;《JOURNAL OF CLINICAL ONCOLOGY》;20110401;第29卷(第10期);第1364－1372页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103710437A (en) | 2014-04-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104531862B (en) | Detect the method and primer in the full exon sequence mutational site of mankind's BRCA1 and BRCA2 gene | |
| CN105506107A (en) | Primers and method for detecting polymorphic hotspot mutation condition of DOCK2 gene | |
| CN104745697B (en) | Detect the method and primer of NF1 the 31st No. 34 full extron of gene | |
| CN105506106A (en) | Method and primer for detecting whole exons of FIX gene | |
| CN105349654A (en) | Probes, primers, detection system and kit for detecting mutations of EGFR gene | |
| CN104862407A (en) | Primer and method for detecting EZH2 genes | |
| CN102816839A (en) | Kit for detecting hot spot mutation sites in colorectal cancer PIK3CA gene | |
| CN103710438B (en) | The method in detection RUNX1 gene the 5th exons mutation site and primer | |
| CN111187828A (en) | Composition, kit and method for detecting polymorphism of human folate metabolism gene | |
| CN103540659B (en) | Detect the method in DNMT3A mutational site, primer and test kit | |
| CN108004309A (en) | Detect primer, method and the kit of MTHFR677, MTHFR1298 and MTRR66 | |
| CN105695596A (en) | Method and primer as well as kit for detecting mutation sites of promoters C250T and C228T of TERT (Telomerase Reverse Transcriptase) gene | |
| CN106086215A (en) | The method in detection No. 4 full exon sequence mutational site of dyskeratosis congenita disease NHP2 gene and primer | |
| CN103131776A (en) | A719G single nucleotide polymorphism detection kit of thiopurine methyltransferase (TPMT) * 3C | |
| CN103710437B (en) | Detect method and the primer in RUNX1 gene the 3rd exons mutation site | |
| CN107164531A (en) | A kind of related serum LncRNA marks of screening lung cancer and its application | |
| CN106222287A (en) | The method of detection ELA2 gene and primer | |
| CN107841554A (en) | Detect the primer, kit and method of Hageman factor (F12) gene mutation | |
| CN110358821A (en) | Detect primer, kit and the method for glucose 6 phosphate dehydrogenase deficiency G6PD gene mutation | |
| CN105177152A (en) | Method and primers for detecting HLA-B*51 allelomorphic gene | |
| CN103710436B (en) | The method of detection WT1 gene the 7th exon pleomorphism site and primer | |
| CN105506110A (en) | Method and primer for detecting 8th and 25th whole exons of TEX11 gene | |
| CN106282343A (en) | Detection NOP10 gene the 2nd exon mutational site R34W(C100T) method of series jump and primer | |
| CN104232757A (en) | Method and oligonucleotide for detecting mutation site of CYP2C19*2 | |
| CN103757103A (en) | Method and primers for detecting ASXL1 gene c. 1934dupG mutation site |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |