CN103667306B - The application in Arabidopsis plant of one Sorghum vulgare Pers. waxiness synthesis regulation gene - Google Patents

Abstract

Invention broadly provides the application in Arabidopsis plant of the Sorghum vulgare Pers. waxiness synthesis regulation gene.Converting the arabidopsis of described gene, its blade waxiness is thicker, and blade is glossy, has the advantage such as drought resisting, disease and insect resistance.

Description

The application in Arabidopsis plant of one Sorghum vulgare Pers. waxiness synthesis regulation gene

Technical field

The invention belongs to genetic engineering field, relate to the application in model plant arabidopsis of the Sorghum vulgare Pers. waxiness synthesis regulation gene.

Background technology

There are a Rotating fields, referred to as horny layer in the outside of plant epidermis cell.Horny layer is network structure, has waxiness to fill therebetween, and these wax layers being filled in horny layer network structure are referred to as interior wax coat；Forming the structure of only wax component outside horny layer, for outer wax coat, outer wax coat typically can form the waxiness crystal of self assembly.Research shows: the horny layer filled by waxiness can reduce the moisture loss by plant surface, improves the drought resistance of plant.Horny layer also plays an important role, additionally, cuticular wax content is relevant with pollen fertility and some Agronomics in terms of preventing the intrusion of ultraviolet radiation injury, opposing pest and disease damage.

For obtaining the gene that can significantly improve crops wax content, we have selected the Sorghum vulgare Pers. that wax content is higher to be material, have carried out the clone of waxiness synthesis related gene.Sorghum vulgare Pers. belongs to grass family, sorghum, 1 year SHENGCAO this, plant surface is often coated with obvious wax component so that it is have adaptability and stronger anti-adversity ability widely, is to be correlated with the ideal material that excellent genes identifies for waxiness.We regulate and control the sequence of the gene WIN1 that waxiness synthesizes as reference sequences in arabidopsis, clone the corresponding homologous genes in Sorghum vulgare Pers., named SbWIN1, and operated by genetic engineering, forwarded in arabidopsis, and be under the control of composing type overexpression promoter 35S.The result of phenotypic evaluation shows, the wax content of the blade of transgenic arabidopsis substantially increases, and blade is glossy.Use scanning electron microscope that it is carried out degree of depth morphology scanning, result shows, the waxiness crystalline component showed increased of blade surface, Sorghum vulgare Pers. SbWIN1 gene has the ability significantly improving plant surface wax component, is by an important candidate gene of crops waxiness character improvement.

Summary of the invention

It is an object of the invention to provide the application in arabidopsis wax component character changes of the Sorghum vulgare Pers. waxiness synthesis regulation gene.

Technical scheme is as follows: a Sorghum vulgare Pers. waxiness synthesis regulation gene, and its nucleotide sequence is as shown in SEQ ID NO:1:

AUGGUACAGCCAAAGAAGUUUCGUGGAGUCCGGCAGCGCCACUGGGGUUCCUGGGUCUCCGAGAUCAGGCAUCCCCUCCUUAAGAGGAGGGUCUGGCUGGGCACCUUCGAGACCGCUGAGGAGGCAGCGAGAGCAUAUGACGAGGCUGCCGU GCUGAUGAGCGGCCGCAACGCCAAGACCAACUUCCCGGUCCAAAGGAGCAGCACAGGGGAGCCAACCCCAGCUGCGGGAAGGGACGCUCACAGCAACGCCGGCAGCGGCUCCUCUACCGCCAACCUGUCCCAGAUUCUCAGUGCGAAGCUCCGCAAAUGCUGCAAGGCGCCAUCGCCCUCCCUGACCUGUCUCCGCCUUGACCCUGAGAAGUCCCACAUUGGUGUUUGGCAGAAGCGUGCAGGAGCCCGUGCUGACUCCAACUGGGUCAUGACCGUGGAGCUCAACAAAGGUGCAGCAUCCACUGAUGCUGCAUCACAGUCCACAUCAGCAACAACUGCUCCACCAGCCACCCCGAUGGAUGACGAGGAGAGGAUCGCCCUGCAAAUGAUCGAAGAGUUGCUGAGCAGCAGCAGCCCAGCUUCACCCUCGCACGGAGAUGACCAAGGUCGCUUCAUCAUCUGA

SEQ ID NO:1

Described gene, according to the sequence of arabidopsis AtWIN1 gene, obtains the SbWIN1 gene order of Sorghum vulgare Pers. by homologous sequence comparison, is obtained by amplification, connection, Plant Transformation equimolecular biologic operation.Specific as follows:

The method using bioinformatics, it is thus achieved that SbWIN1 gene order.Utilize PRIMER5 design primer for expanding open reading frame sequence.Extract the RNA of Sorghum vulgare Pers. BTX623 stem stalk, be that cDNA is standby as the template of amplification using the RNA reverse transcription of 1 μ g.Expand with the special primer of design.The product of amplification is connected on cloning vehicle.Proceeding to escherichia coli, the carrying out of the screening positive is checked order, it is thus achieved that the gene order shown in SEQ ID NO:1.

The above-mentioned gene being cloned into is connected to overexpression vector, uses agrobacterium mediation converted method, it is thus achieved that transgenic Arabidopsis plants.Result shows that transgenic arabidopsis blade waxiness is thicker than common, and blade is glossy.

Accompanying drawing explanation

Fig. 1 wildtype Arabidopsis thaliana；

Fig. 2 is containing the arabidopsis of sequence 1 gene in sequence table of the present invention；

The scanning electron microscope (SEM) photograph of Fig. 3 wildtype Arabidopsis thaliana；

Fig. 4 is to sweep containing the arabidopsis Electronic Speculum of sequence 1 gene in sequence table of the present invention to catch figure.

Detailed description of the invention

Stem stalk using Sorghum vulgare Pers. describes preparation method in detail as test material below.

1. the extraction of total serum IgE uses TIANGEN test kit, and operating procedure such as test kit illustrates shown.After obtaining RNA solution, agarose gel electrophoresis identifies the quality of RNA ,-80 DEG C of preservations.

The synthesis of the synthesis of 2.cDNA: cDNA uses the SuperScript of Invitrogen^TMIII First-Strand Synthesis System for RT-PCR, step is as follows:

1) take 0.5ml sterilizing microcentrifugal tube, be separately added into following component: total serum IgE；Oligl dT；10mM dNTP.Mixing, gently gets rid of centrifuge tube, makes solution to bottom；

2) in centrifuge tube is placed in water-bath, 65 DEG C of insulation 5min；

3) taking-up is placed in more than cooled on ice 1min, by centrifuge tube gentle centrifugation rapidly；

4) in above-mentioned centrifuge tube, following inverse transcription reaction liquid is added: 5 × First-strand Buffer；0.1M DTT；Recombinant RNase Inhibitor；SuperScript^TMIII RT；

5) of short duration centrifugal after slight concussion mixing；

6) 50 DEG C of insulation 50min；

7) 70 DEG C of insulation 15min ,-20 DEG C of preservations.

Sorghum vulgare Pers. β-Actin F (GenBank accession No.X79378) detects reverse transcription product.PCR amplification program: 94 DEG C of 4min, the program of 35 circulations is 95 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 30s, last 72 DEG C of 5min.2% agarose gel electrophoresis detection.

The separation of 3.SbWIN1

Pcr amplification primer thing uses " Primer 5.0 " primer-design software to be designed, and is analyzed the primer sequence Vector NTI obtained, and finds out melting temperature, self-complementarity, the two suitable primers pair of Primers complementary.CDNA is template, SbAGL6-F, SbAGL6-R are that primer carries out PCR amplification, PCR amplification system is: react total system 50 μ l, including reverse transcription product, 10 × phushion HF buffer, 10mmol/L dNTPs, 10mM gene specific primer, phusion archaeal dna polymerase, DMSO, residue uses water polishing.PCR amplification program: 98 DEG C of 1min, the program of 35 circulations is 98 DEG C of 10s, 47 DEG C of 20s, 72 DEG C of 30s, last 72 DEG C of 10min.What this test PCR amplification was selected is the Phusion archaeal dna polymerase of NEB company.

The A that adds of 4.PCR product connects

The cloned sequence utilizing Phusion archaeal dna polymerase to produce is flat end, and before carrying out TA clone, available another kind of polymerase Taq enzyme carries out adding A at flat end PCR primer end.Adding PCR and reclaim product, 5 × Taq buffer, 10mM dATP, Taq enzyme, 72 DEG C keep 15 minutes, take out the PCR after 2 μ l add A and reclaim product addition 2 × T₄Ligase buffer, pGEM-T easy carrier (50ng/ μ l), T₄DNA ligase (3U/ μ l) is connected on pGEM-T easy carrier, and pGEM-T easy carrier is purchased from Promega company.

5. connect the conversion of product

1) from-80 DEG C of refrigerators, take out 1 pipe (50 μ l) competent cell, put on ice.

2) in pipe, add 2 μ l ligation reactions with the sterile pipette tip of pre-cooling, shake up gently, put 30 minutes on ice.

3) 42 DEG C of water-bath heat shocks 60 seconds, put rapidly 5 minutes on ice.

4) in centrifuge tube, add SOC fluid medium, mix rear 37 DEG C of shaken cultivation 1h.

5) under room temperature, 8000rpm is centrifuged 5 minutes, discards supernatant, will remain supernatant Eddy diffusion thalline, and it will uniformly be coated onto on the flat board of X-gal+IPTG+Amp with spreader, place 30 minutes.

6) be inverted flat board in 37 DEG C of constant incubators overnight, take out during obvious single bacterium colony to appear.

7) put into 4 DEG C of refrigerator a few hours, make blue white macula color clearly demarcated.

6. the PCR of recombiant plasmid identifies

There is T the Insert Fragment upstream of the pGEM-T carrier used by this experiment₇Primer, there is SP in downstream₆Primer and M₁₃Primer, it is possible to doing primer with these three promoter sequence and Insert Fragment is carried out specific amplification, identify recombiant plasmid, evaluation program is as follows: PCR amplification system includes that 10 × buffer is (containing MgCl₂), dNTP 10mmol/L, T₇And SP₆Primer (20ng/ μ l), Taq enzyme, template is the white bacterial plaque after converting.Reaction condition is: 94 DEG C, 10min；35 circulations: 94 DEG C, 30s；56 DEG C, 30s；72 DEG C, 2min；72 DEG C extend 5min.Finally, pcr amplification product detects by 1% sepharose electrophoresis, selects the positive colony of suitable size to check order.Order-checking completes in Hua Da gene sequencing portion.

The structure of expression vector: according to the ORF sequence of SbWIN1 gene, the AttB site in Gateway technology is added original primers sequence, amplifies ORF fragment from the plasmid of positive colony, for construction of expression vector.

7. with the amplification of gene order in attB site

With the plasmid identified by order-checking for template SbWIN1F, SbWIN1R, carry out PCR amplification for primer.

PCR amplification system is: reacts total system and includes reverse transcription product, 10 × phushion HF buffer, 10mmol/L dNTPs, 10mM gene specific primer, phusion archaeal dna polymerase, DMSO, and residue uses water polishing.PCR amplification program: 98 DEG C of 30s, the program of 35 circulations is 98 DEG C of 10s, 60 DEG C of 30s, 72 DEG C of 1min, last 72 DEG C of 5min.The 50 whole point samples of μ l, reclaim PCR primer after sepharose electrophoresis.

8. the structure of entry vector

Utilizing the Sb-WIN1 product obtained and pDONR (amp) to carry out BP reaction, the ccdB site on pDONR (amp) carrier is replaced by Sb-WIN1 gene coded sequence, is built into the entry vector of amicillin resistance.After inverted for BP product coli strain DH5 α, screen with ampicillin.The bacterial plaque converting gained being shaken bacterium upgrading grain, preserves and carry out bacterium colony PCR qualification, there is T pDONR (amp) carrier upstream₇Primer and SbAGL6 R primer, carry out PCR qualification for template converting gained plasmid.Positive colony is checked order.BP reaction system includes PCR primer, pDONR (amp) vector, BP clone II enzyme, dd H₂O。

9. the structure of expression vector

To identify that correct plasmid is connected on pGWB14 expression vector, and carry out converting and enzyme action detection, will identify that correct bacterium solution delivers to the order-checking of Hua Da genome company.LR reaction system includes BP plasmid, pGWB14 vector, LR clone II enzyme, dd H₂O。

10. recombiant plasmid pKIGW-SbWIN1 Agrobacterium is electroporated

1. take the Agrobacterium competent cell of 50 μ l in thawed on ice, add the plasmid DNA that 2 μ l have built, softly mix, place half an hour on ice.

2. proceeding to shock by electricity in cup by the mixture in 1., electric shock cup shifts to an earlier date pre-cooling.

3. shock by electricity with cell fusion apparatus.

4. adding immediately in the SOC culture medium without antibiotic after electric shock terminates, move in 2ml centrifuge tube after mixing, at 28 DEG C, 2h is cultivated in concussion.

5. 8000rpm, centrifugal 5min, abandon supernatant, residue bacterium solution be coated in containing kanamycin, spectinomycin, gentamycin solid LB flat board on, be inverted at 28 DEG C, cultivate 2 days.

11.PCR checking and fungi preservation

Single bacterium colony in picking culture medium, makees bacterium colony PCR and screens monoclonal.To identify correct monoclonal, liquid nitrogen flash freezer ,-80 DEG C preserve with standby.

12. will activation after bacterium solution take 1ml in 200ml be inoculated in containing kanamycin, spectinomycin, gentamycin LB liquid medium in, 28 DEG C, 250rpm shaken cultivation to OD₆₀₀=0.8～0.9.

Above-mentioned bacterium solution 5000rpm is centrifuged 8min, with 5% (w/v) sucrose solution suspension thalline, makes OD₆₀₀=0.8～0.9.The sucrose solution of the thalline that suspended will add final concentration of 0.02%Silwet L-77, arabidopsis inflorescence is immersed in the sucrose solution having added Silwet L-77 and soak 1min.

Arabidopsis plastic bag is packaged, seals to cultivate and cultivate plant after 16-24 hour according to a conventional method to solid, results T₀For seed.

13. arabidopsis T₀Screen for seed

(1) T after being dried 2 weeks₀For seed first with 75% alcohol disinfecting 1 minute, then with aseptic water washing three times.Finally with aseptic rifle head, the seed program request after sterilization is selected on culture plate (75mg/L kanamycin) at 1/2MS.

(2) 4 DEG C of vernalization is placed in 22 DEG C two days later, under 16h illumination condition, observes the development condition of its cotyledon and root, select transformant after 10d, and it is dark green that transformant shows as true leaf health, in root length to culture medium.In growing on the resistance culture base containing kanamycin with the plant proceeding to exogenous gene, nontransgenic plants then can not normal growth.After 10d, it is transplanted in soil growing normal Arabidopsis thaliana Seedlings.When plant grows to 8～10 leaf, extract young leaflet tablet genomic DNA, carry out PCR qualification；Individual plant is divided to gather in the crops seed by the plant identified.

The PCR of 14. transgenic arabidopsis identifies

Extract-N-Amp with SIGMA company^TMTransgenic arabidopsis is identified by Plant PCR Kits test kit, and step is as follows:

(1) DNA extraction: taking 0.5-0.7cm leaf tissue in 2ml centrifuge tube, add Extraction Solution, 95 DEG C keep 10min, add Dilution Solution, and 2 DEG C-8 DEG C store with standby.

(2) PCR amplification: pcr amplification reaction system includes ddH₂O、Extract-N-Amp PCR Readymix、10mM Primer F、10mM Primer R、Leafdisk extract；Pcr amplification reaction program is: 94 DEG C of 3min, and 30 circulations include 94 DEG C of 1min, 60 DEG C of 1min, 72 DEG C of 1min30sec, then 72 DEG C of 10min.

The phenotypic evaluation of 15. transgenic plants

Observed result directly perceived is it is obvious that the arabidopsis of transgenic has gloss blade.

The result of 16. scanning electron microscopic observation blades: the waxiness that be we have found that on the blade of transgenic by the observation of scanning electron microscope is substantial amounts of to be added.

Above one embodiment of the present of invention is described in detail, but described content has been only presently preferred embodiments of the present invention, it is impossible to be considered the practical range for limiting the present invention.All impartial changes made according to the present patent application scope and improvement etc., within all should still belonging to the patent covering scope of the present invention.

Claims (2)

1. a Sorghum vulgare Pers. waxiness synthesis regulation gene is preparing the Arabidopsis plant with waxiness synthesis regulation ability In application, it is characterised in that: the nucleotide sequence such as SEQ ID NO of described Sorghum vulgare Pers. waxiness synthesis regulation gene: Shown in 1.

2. a kind of Sorghum vulgare Pers. waxiness synthesis regulation gene as claimed in claim 1 has waxiness synthesis tune in preparation Application in the Arabidopsis plant of control ability, it is characterised in that: described Sorghum vulgare Pers. waxiness synthesis regulation gene is connected On overexpression vector, use agrobacterium mediation converted method, it is thus achieved that transgenic Arabidopsis plants.