CN103656678B - Application of miR-493 gene in preparation of medicament for inhibiting cancer cell proliferation - Google Patents
Application of miR-493 gene in preparation of medicament for inhibiting cancer cell proliferation Download PDFInfo
- Publication number
- CN103656678B CN103656678B CN201310438244.3A CN201310438244A CN103656678B CN 103656678 B CN103656678 B CN 103656678B CN 201310438244 A CN201310438244 A CN 201310438244A CN 103656678 B CN103656678 B CN 103656678B
- Authority
- CN
- China
- Prior art keywords
- mir
- cell
- gene
- target gene
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the technical field of biology, and in relates to an application of miR-493 gene in preparation of a medicament for inhibiting cancer cell proliferation. A target gene miR-493 in 95D cell line inhibits the target gene mRNA from translating or directly degrading mRNA of the target gene through complementation with 3'-UTR of the target gene mRNA. Through combination with physiologic and biochemical experiment, the interaction between miR-493 and E2F1 is determined. The interaction influences the vital movement such as proliferation of 95D cells. According to the experiment, the fact that E2F1 is the target gene of miR-493 is analyzed and verified in HEK293T cells by using a luciferase reporter gene through software prediction, sequencing analysis and carrier establishment, and moreover the discovery is further verified by using overexpression and a Western-blot technique in the 95D cells and further by using interfering E2F1 gene expression as contrast. The application is the first report that E2F1 is the target gene of miR-493 in the 95D cell line, and the invention provides the application value for the clinical diagnosis and treatment of non-small-cell lung cancer by using miRNA in and supply of medicine target points.
Description
Technical field
The invention belongs to biological technical field, specifically, relate to miR-493 gene at suppression non-small cell lung cancer cell
Application in propagation.
Background technology
MicroRNAs (miRNAs) is the non-coding microRNA guarding, being about 19-25 nucleotide on a class is evolved.
Lee and Reinhart etc. find to have the non-coding single strand RNA molecule of gene regulation effect in succession in nematicide, lin-4 and
let-7.The most substantial amounts of research finds all to there is this microRNA in various organisms, and they have tissue specificity
With spatiotemporal.This non-coding small RNA molecular with gene regulation effect is referred to as microRNAs (miRNAs).miRNAs
In the way of complete or not fully complementary pairing, 3 ' ends untranslated region (3 ' UTR) with the mRNA of target gene combine, and cause target
The degraded of mRNA or suppress it to translate, and then the expression to functional gene plays finely regulating function.MiRNAs participates in various
Cellular processes, such as differentiation, propagation, apoptosis and stress.Additionally, they or the crucial point of adjustment of some tumor.From
After Calin in 2002 etc. find that miRNAs is relevant with B cell chronic lymphatic leukemia first, miRNAs is standby with the relation of tumor
Concerned.Hereafter numerous studies all show that miRNAs sends out with kinds of tumors (pulmonary carcinoma, hepatocarcinoma, gastric cancer, breast carcinoma etc.)
Open up closely related, at propagation, blood vessel generation, EMT, the invasion and attack of tumor cell and transfer, drug resistance and the Tumor Stem of tumor cell
The biological functions such as cell play important regulation effect.On this basis, miRNA target base aerial when specific is found
Cause, discloses the emphasis that its mechanism of action is at present research, be also be expanded on further tumor development mechanism, identify and identify new
The important research means of tumor markers.
Pulmonary carcinoma is one of modal malignant tumor, and its M & M of last decade rises the most rapidly, high in China
Occupy the first place of mortality of malignant tumors, it has also become the major disease of serious threat people's life and health.Biology according to pulmonary carcinoma
Characteristic, is divided into nonsmall-cell lung cancer (NSCLC) and small cell lung cancer (SCLC), and wherein NSCLC accounts for 80-85%, in recent years, with
The improvement of therapeutic modality, the adjustment of therapeutic scheme, the treatment of pulmonary carcinoma achieves significant progress, but most NSCLC
Patient's prognosis is the most poor, and within 5 years, survival rate is still below 15%.Lacking the effective early diagnosis and therapy means for pulmonary carcinoma is
Cause one of main reason of patients with lung cancer death.MiRNA is translated by the mRNA of regulation and control target gene, sends out in pulmonary carcinoma
Exhibition and transfer play a significant role.MiRNA is likely to become new pulmonary carcinoma early diagnosis and progress mark of correlation thing, contributes to lung
The Accurate Diagnosis of cancer and personalized treatment.
Summary of the invention
It is an object of the invention to provide a kind of can effectively anticancer propagation medicine.
Invention is achieved through the following technical solutions above-mentioned purpose.
Invention provides miR-493 gene or the use in preparing anticancer medicine of the expression vector containing this gene
On the way.Described medicine is the medicine of anticancer propagation.
Further, the mechanism of proliferation of described cancerous cell is relevant to E2F1.
As preferred scheme, described cancer is pulmonary carcinoma, ovarian cancer, tumor of head and neck etc..It is highly preferred that cancerous cell is non-
Small cell lung cancer.It is further preferred that described cancerous cell is 95D.
Described miR-493 gene order is as shown in SEQ ID NO:1 or SEQ ID NO:2.
The dosage form of described medicine can be conventional preparation, such as liquid preparation, granule, tablet or soft gelatin capsule.Its
Also include learning acceptable carrier.
Invention provides miR-493 gene or the use in preparing E2F1 inhibitor of the expression vector containing this gene simultaneously
On the way.
The present invention provides miR-493 gene first as suppressing the new application of tumor proliferation in cancer, for antineoplastic agent
The design of thing and screening provide new target spot.The Research Thinking of the present invention is summarized as follows further:
Inventor detects 2 strain normal cells and the expression of 6 strain lung carcinoma cell miRNA first with RT-PCR, finds to compare
In normal lung cell, miR-493 is common lower expression in lung carcinoma cell, with the nonsmall-cell lung cancer 95D cell of high metastatic potential
Strain is particularly evident.
Further, (this belt carrier is green to build miR-493 process LAN slow virus carrier pEZX-MR03/eGFP-miR-493
Fluorescin) and blank carrier, transfection 95D cell, sets up the stable cell lines 95D/miR-of process LAN miR-493 respectively
493, and matched group 95D/control.And verify transfection with real-time fluorescence quantitative PCR.Application plate clone forms reality
Test, cell growth curve detection each group of cell multiplication capacity, flow cytometer showed cell cycle, find lung carcinoma cell multiplication capacity
The most suppressed.
Further, utilizing bioinformatics on-line prediction software analysis and combine biological function, filtering out miR-493 can
The target gene of energy.Use real-time quantitative PCR, the expression of WesternBlot technology for detection target gene, and by the maturation of miR-493
Sequence minics and restructuring have the luciferase reporter gene cotransfection HEK293 cell of 3 ' UTR region sequences of target gene, 24h
The activity of rear detection luciferase reporter gene.The expression simultaneously utilizing RNAi technology interference lung carcinoma cell target gene is made
For comparison.
Bioinformatics on-line prediction software analysis filters out the target gene E2F1 of miR-493.Real-time quantitative PCR and
WesternBlot finds that transcribing of E2F1 all becomes negative correlation with miR-493 with protein expression.Luciferase reporter gene
Result confirms that miR-493 has direct repression to E2F1 expression.The expression silencing of E2F1 can make the 95D cell G0/G1 phase thin
Born of the same parents' ratio increases, and S phase cell proportion reduces, and after the display E2F1 interference of growth curve result, cell proliferation rate slows down.
This result supports that the molecular mechanism of miR-493 suppression 95D proliferation of lung cancer cells is relevant with E2F1.
Genomic medicine provided by the present invention can suppress the propagation of the cancerous cell relevant with E2F1 effectively.
Accompanying drawing explanation
Fig. 1 shows the structure of 95D/miR-493 Yu 95D/control stable cell lines:
A: observe intracellular green florescent signal under inverted fluorescence microscope after transfecting 72 hours;
The expression water of B: real-time fluorescence quantitative PCR detection 95D/miR-493 Yu 95D/control cell line miR-493
Flat, *: p < 0.05, * *: p < 0.01.
Fig. 2 is shown as the process LAN miR-493 impact on 95D ability of cell proliferation:
A:95D, 95D/control and 95D/miR-493 plate clone forms the typical figure of experiment;
B:95D, 95D/control and 95D/miR-493 respectively organize the statistical analysis of the cloning efficiency of cell, and experiment repeats
3 times, 95D/miR-493vs 95D, * * p < 0.01;
C:MTS method draws each group of cell growth curve.
Fig. 3 is shown as the cell cycle distribution of flow cytomery 95D, 95D/control and 95D/miR-493.Respectively
The proliferation index of group cell is respectively as follows: 48.49%, and 56.30%, 19.23%.This experiment is repeated 3 times, statistical analysis display 95D/
MiR-493 group has significant difference with the proliferation index of another two groups of cells.
Fig. 4 shows that miR-493 is directly targeted E2F1 and suppresses it to express:
The binding site that 3 ' the UTR district miR-493 of A: bioinformatic analysis E2F1 exist;
The difference of the protein level of B:95D/miR-493 and cellular control unit E2F1;
C:95D/miR-493 and the difference of cellular control unit E2F1mRNA level;
The D:miR-493 impact on the reporter gene activity of 3 ' the UTR district carrier constructions of E2F1.
Fig. 5 be shown as si-RNA disturb 95D cell E2F1 gene expression:
A: detect 3 siRNA interference effects in mRNA level in-site;
B: detect 3 siRNA interference effects at protein level.
Fig. 6 shows the comparison as miR-493 effect, after siRNA interference E2F1 expresses, and the shadow to proliferation of lung cancer cells
Ring:
Cell cycle distribution before and after the interference of A: flow cytometer detection;Wherein abscissa DNA content refers to DNA content;Vertical coordinate
Cell number phalangeal cell quantity;
B:MTS draws the growth curve of cell before and after disturbing.
In above-mentioned figure, involved 95D/control indication is 95D compared with control cells system, and it does not contains miR-493.
Detailed description of the invention
Below in conjunction with specific embodiment, the present invention is conducted further description;Embodiment is only used as technical solution of the present invention
Explanation, and unrestricted.
Embodiment 1: cell is cultivated
People low transfer lung carcinoma cell 95C and people's height transfer lung carcinoma cell 95D is purchased from Shanghai Chinese Academy of Sciences cell bank.All with containing
The RPMI-1640 of 10% hyclone cultivates, and is placed in 37 DEG C, and 5%CO2 incubator is cultivated.293T cell is preserved by this laboratory,
Cultivate with containing 10% hyclone and DMEM.
Embodiment 2: cell transfecting
PEZX-MR03/eGFP-miR-493 expression vector, the structure of negative control expression vector are had by Guangzhou reactivation gene
Limit company has assisted.Day before transfection is with 2-10 × 10495D cell is seeded to 24 well culture plates, every hole by the density in individual/hole
500 μ l culture medium.When guaranteeing transfection, cell confluency degree about reaches 60%.The virion stock solution of 10 μ l adds the complete of 500 μ l
Culture medium is prepared as the viral suspension diluted, and is simultaneously introduced appropriate polybrene and makes its final concentration of 5-8 μ g/ml.Discard
Old culture medium, adds culture plate by the culture medium containing virion prepared, and mixing is placed on 37 DEG C, and 5%CO2's is thin
Born of the same parents' incubator is cultivated, after 24 hours, is replaced with fresh complete medium.Transfect successful cell at fluorescence microscope
Visible green fluorescence, cultivates (2 μ g/ml puromycin) with selectivity and cultivates, about 2-3 week single resistance clone occur, through glimmering
After light microscope is observed, the single clone of picking is enlarged cultivating, and sets up stable cell line, through real-time fluorescence quantitative PCR
After checking, for subsequent experimental research.The precursor sequence of miR-493 is SEQ ID NO:2:
CUGGCCUCCAGGGCUUUGUACAUGGUAGGCUUUCAUUCAUUCGUUUGCACAUUCGGUGAAGGUCUACUGUGUGCCAG
GCCCUGUGCCAG。
The detection of embodiment 3:95D proliferation of lung cancer cells ability
(1) plate clone detection ability of cell proliferation
Take the logarithm trophophase cell, be inoculated in 6 well culture plates by the cell density in 300/hole, make cell uniformly divide
Cloth.In 37 DEG C, 5%CO2Cell culture incubator in cellar culture until macroscopic clone occurs, then discard culture fluid,
With PBS 2 times, the methanol of-20 DEG C of pre-coolings fixes 30min, violet staining 10min, after slowly rinse well with flowing water, dry in the air
Calculate clone's number after Gan, and pass through formula: cloning efficiency=(clone's number/inoculating cell number) × 100% calculates each group thin
The cloning efficiency of born of the same parents, experiment is repeated 3 times.
(2) MTS method drafting growth curve:
The cell dissociation of cellar culture is collected and makes cell suspension, carry out cell counting, with 1000, every hole cell,
180 μ l are inoculated in 96 orifice plates, and every kind of cell sets 6 parallel holes, in 37 DEG C, 5%CO2 incubator is cultivated, respectively at 0h,
After 24h, 48h, 72h, 96h, 120h add and hatch 2 hours in 20 μ lMTS incubators, microplate reader detects and inhales at each hole 490nm
Light value, light absorption value is directly proportional to cell number, and with the time as abscissa, light absorption value is the growth song that vertical coordinate draws each group of cell
Line.
(3) cell cycle analysis
Carry out by the operating procedure in test kit description, use one-step method.Concrete steps are summarized as follows: conventional method is received
The cell that collection growth conditions is good, PBS rinses once, centrifugal, abandons supernatant.Add the DNA Staining of 500 μ l
The upper mixing of Solution, vortex 5~10 seconds.Room temperature lucifuge uses flow cytomery after hatching 30 minutes.Use proliferation index
Measure of cell proliferation ability, proliferation index=(G2+S)/(G1+G2+S) × 100%
Conclusion: form experiment by plate clone and MTS draws cell growth curve detection miR-493 to 95D cell
The impact of in-vitro multiplication ability.Plate clone experiment each group of Cell clonality of detection, result shows (see accompanying drawing 2),
The cloning efficiency of 95D, 95D/control, 95D/miR-493 group is respectively as follows: 65 ± 4.8%, 63 ± 3.3%, 9.3 ±
0.9%, compared with 95D, 95D/control group, the cloning efficiency of 95D/miR-493 cell significantly reduces (p < 0.01).Logical
Crossing MTS method and measuring the A490 of each group of cell respectively at 0,1,2,3,4,5 days, and draw growth curve, result shows (see accompanying drawing
2), the multiplication capacity of 95D/miR-493 cell weakens.Illustrate that process LAN miR-493 can suppress the multiplication capacity of 95D cell.Adopt
With flow cytometry 95D, the cell cycle of 95D/control, 95D/miR-493.Result shows the propagation of each group of cell
Index is respectively as follows: 47.49%, 56.30%, 19.23%.This prompting miR-493 can suppress 95D cell to enter the S phase from the G1 phase.
The instantaneous interference of embodiment 3:E2F1
Day before transfection, is seeded to cell in good condition in 6 porocyte culture plates with suitable density, when making transfection
The degree of converging of cell can reach about 40%.Dilution siRNA: dilute 20 μm ol of 5 μ l with 250 μ l without blood serum medium
SiRNA stores liquid, mixes gently, incubated at room 5min.Dilution lipo2000: dilute 5 μ without blood serum medium with 250 μ l
Llipo2000, gently mixing incubated at room 5min.SiRNA after dilution and the lipo2000 after dilution is mixed gently, room
Temperature hatches 20min.The siRNA-lipo2000 mixed liquor of 500 μ l is added containing in 6 orifice plates, is simultaneously introduced the depletion of blood of 1.5ml
Clear culture medium, mixes gently.Carry out changing liquid with fresh complete medium after cultivating 4-6h to process.Culture plate is placed in 37 DEG C
After CO2 incubator cultivates 24-96h (incubation time is relevant to experiment purpose), for subsequent experimental.Design is for E2F1 gene
Instantaneous interference oligonucleotide fragment as follows:
SiRNA1:5'-CCUGAUGAAUAUCUGUACU-3'(SEQ ID NO:3)
SiRNA2:5'-UGGACCACCUGAUGAAUAU-3'(SEQ ID NO:4)
SiRNA3:5'-GAGAAGUCACGCUAUGAGA-3'(SEQ ID NO:5)
SiRNA negative control: 5'-UUGAGGUCGCGAUGGAACG-3'(SEQ ID NO:6)
Conclusion: in order to determine that whether miR-493 suppresses 95D cell proliferation by lowering E2F1, experimental design interference
E2F1 gene expression, as comparison, designs 3 siRNA interference fragments for E2F1mRNA, is each separately transfected into 95D cell
Behind 24 hours and 48 hours, extract cell total rna and total protein of cell respectively, on mRNA and protein level (Fig. 5)
Checking siRNA interference effect.Show after 3 interference fragment empirical tests of design: the interference effect of si-E2F 3# is apparently higher than it
Yu 2 groups.Will this interference fragment as the object of follow-up study.Use the cell week before and after flow cytometry interference E2F1
Phase is distributed, and uses MTS method the detect 2 strain cell upgrowth situation of 5 days (every day detects 1 time) and draws growth curve, and result shows,
In 95D/si-con cell, S phase cell accounts for 40.35 ± 2.11% respectively.In 95D/si-E2F1 cell S phase cell account for 19.05 ±
1.02%.Compared with 95D/si-con, in 95D/si-E2F1 cell, S phase cell significantly reduces, and G0/G1 phase cell proportion is obvious
Increase (such as Fig. 6);Meanwhile, the growing multiplication speed of 95D/si-E2F1 cell is significantly lower than 95D/si-con cell (such as Fig. 6).
Prompting miR-493 suppression 95D growth and proliferation of cell acts through targeted inhibition E2F1 and realizes.
Embodiment 4: real-time quantitative PCR
MiRNA extracts
(1) take the logarithm trophophase cell 1 × 106~1 × 107, discards culture medium, washs 2 times with PBS, adds 1ml thin
Cellular lysate liquid (RNA-Solution Reagent), abundant cell lysis, be then transferred in 1.5mlEP pipe, incubated at room 2~
3 minutes.
(2) add the chloroform of 200 μ l by the lysate of every ml, after vortex mixing, hatch 10 minutes on ice.
(3) 12,000g, 4 DEG C, centrifugal 15 minutes, RNA was at upper strata aqueous phase, and transfer upper strata aqueous phase (≤80%) is to new
1.5mlEP manages, and adds the dehydrated alcohol of 0.5 times of volume, and Vortex mixes.
(4) take≤above-mentioned mixed liquor of 700 μ l to HiBind RNA mini column, 10,000g, room temperature be centrifuged 30~
60 seconds, it is transferred to new 1.5mlEP pipe by being centrifuged the filtrate got off.
(5) repeat (4), cross post until whole.(now, this pillar adsorbs Large RNA, can extract from this pillar
Macromole RNA).
(6) measure the volume of the filtrate of (4), the acquisition of (5) step, add the dehydrated alcohol of 0.9 times, mixing.
(7) take a MicroElute RNA Column, be placed on 2ml collecting pipe, by the mixed liquor in (6) step in batches
Whole posts of crossing, 10,000g, room temperature is centrifuged 30~60 seconds, discards the filtrate being centrifuged.
(8) the RWB Wash Buffer (noting: dehydrated alcohol to be added dilution before use) adding 500 μ l enters post, and 10,
000g, room temperature is centrifuged 30~60 seconds, abandons filtrate.It is repeated once.
(9) >=13,000g, sky gets rid of 2 minutes, with the liquid of residual in Ex-all pillar.
(10) eluting miRNA: be placed in by pillar on 1.5mlEP pipe, is added to the DEPC water of 15~30 μ l on film, and room temperature is put
After putting 2 minutes, centrifugal (>=13,000g, 1 minute).If wanting to improve yield, second time eluting can be carried out, it is possible to heat in advance
DEPC water is to 70 DEG C, and incubated at room is centrifuged for 5 minutes again after adding pillar.
(11), after detecting the concentration of miRNA on Nanodrop2000 instrument, reverse transcription is carried out immediately or in-80 DEG C of guarantors
Deposit.
Reverse transcription
Preparing reverse transcription reagents, centrifugal after thawing on ice, sample-adding amount and operating procedure are as follows:
MiRNA:0.5 μ g (calculates volume according to concentration)
MiR-493 reverse transcriptase primer: 1 μ l
U6 internal reference reverse transcriptase primer: 1 μ l
5 × Buffer:4 μ l
10 × dNTP MIX:2 μ l
Reverse transcriptase: 1 μ l
Reverse transcriptase inhibitors: 0.5 μ l
RNase-free water: complement to 20 μ l
PCR instrument is put into after reaction system being mixed, 42 DEG C of reverse transcription reaction 1h, 70 DEG C, 5min.After cooling by sample in-
20 DEG C of Refrigerator stores.
MiRNA real-time quantitative PCR
PCR reagent is thawed on ice, by following reaction system (cumulative volume 20 μ l) sample-adding to PCR eight connecting leg, each
Each gene of sample sets 3 multiple holes:
2x QuantiTect SYBR Green PCR Master Mix:10 μ l
Primer: 2 μ l
RNase-free water:7 μ l
Template cDNA:1 μ l
Through brief centrifugation, flick mixing, again brief centrifugation after carry out real-time fluorescence quantitative PCR in ABI7500 FAST instrument
Reaction.With U6 as internal reference, carrying out melting curve analysis by instrument default setting, after having tested, instrument will automatically analyze calculating
Relative fold.Experiment is repeated 3 times.
Conclusion: the relative expression quantity of miR-493 in real-time fluorescence quantitative PCR each group of cell of detection, with U6 as internal reference, compares
MiR-493 expression difference in each group cell.Result shows (Fig. 1), with the expression of 95D group miR-493 for 1,95D/
The relative expression quantity of the miR-493 of control and 95D/miR-493 cell be respectively (1.02 ± 0.34), (10.65 ±
0.59).Point out the stable cell line successfully building miR-493 process LAN.Real-time fluorescence quantitative PCR detection 95D/control and
The expression of E2F1 in 95D/miR-493 cell, finds that transcribing of E2F1 all becomes negative correlation with miR-493 with protein expression
(Fig. 4).
Embodiment 5:Western Blot detects
1) prepared by cell protein sample: 1. takes the cell to trophophase, discards cell culture medium, rinses with the PBS of pre-cooling
Cell surface 2 times, removes the serum in culture medium and dead cell;2. with after trypsinization, terminate digestion by culture medium, turn
Moving to centrifuge tube, 1000rpm abandons supernatant after being centrifuged 5 minutes, is transferred to EP pipe after adding 1mlPBS re-suspended cell, 3000rpm from
The heart abandons supernatant after 5 minutes, precipitation is cell (can be in-80 DEG C of preservations);3. the RAPI protein lysate of every 100ul pre-cooling adds
Enter the cocktail protease inhibitor of 1ul, standby.4. every solencyte adds appropriate above-mentioned cracking mixed liquor fully to mix
It is placed on cracking 30 minutes on ice, mixes several times every several minutes vortex.5. 4 DEG C, with the centrifugation 20 of >=12000rpm
More than minute, the most carefully draw supernatant, be transferred in new EP pipe, be total protein of cell.
(2) protein concentration and albuminous degeneration are measured: with NanoDrop 2000 Instrument measuring protein concentration.Operating procedure is such as
Under: 1. run NanoDrop 2000 program;2. clean optical fiber surface with 2 μ l deionized waters, be repeated 2 times;3. 2 μ l albumen are drawn
Lysate is added to optical fiber surface, clicks on BLANK, does blank;4. draw the sample protein after 2 μ l fully mix, click on
Measure measures, and shows measurement result on the right of software.5. according to the volume of sample protein, the 5 of addition respective volume ×
Loading buffer, drybath upper 100 DEG C, 10 minutes, make albuminous degeneration, be quenched on ice, takes out stand-by or-20 DEG C of preservations.
(3) SDS-PAGE electrophoresis: protein sample joins the 10%SDS-PAGE gel configured, each hole adds not
Being 50 μ g with total protein of cell amount, the applied sample amount of albumen Marker is 5 μ l.Starting electrophoresis, the voltage concentrating glue is 80V, works as sample
When product run to separation gel, 120V will be adjusted on voltage until protein sample leading portion soon runs out of whole blob of viscose.Take out SDS-PAGE
Gel is placed in transferring film buffer solution, is steeped in transferring film liquid by transferring film filter paper, methanol activation pvdf membrane, with albumen transfer instrument half
Do robin by the protein delivery in SDS-PAGE to pvdf membrane.Dyeing with Ponceaux, whether detection albumen is transferred to pvdf membrane.
(4) closing, antibody incubation and luminescence: the pvdf membrane with albumen is sealed with the TBST solution containing 5% defatted milk powder
Closing, 4 DEG C overnight.Within second day, taking out film, educate with various anti-taxes, different antibodies uses different diluted concentrations.Hatch respectively not
Same pvdf membrane, incubated at room 2h, TBST cleans 3 × 10min.Resist with the concentration dilution two of 1:5000, incubated at room 1h, TBST
Washing 3 × 10min.Darkroom is hatched with ECL, detects with X-ray sensitive film, nitrite ion develops the color, fixing in fixative solution.Obtain
Band can be with the expression of the various albumen of sxemiquantitative.
Conclusion: the miR-493 of process LAN can significantly inhibit the expression of the protein level of E2F1, and it is thin to significantly inhibit 95D
The competence for added value (Fig. 4) of born of the same parents.This conclusion (Fig. 6) is further demonstrate that using the experiment as comparison of expressing of interference E2F1.
Embodiment 6: luciferase reporter gene detects
(1) the pMir-Report Reporter gene vector of E2F1-3 ' UTR is cloned: design PCR primer according to E2F1-3 ' UTR
Upstream and downstream introduces Spe I Yu Hind III restriction enzyme site, using complete fragment as wild type in the DNA fragmentation synthesized, and will be with
MiR-493 binding site sequence GACCUUCA is mutated into ACAAGG as saltant type.Through 3 ' UTR sequence of PCR amplification gene, cut
Glue reclaims purpose fragment, is connected on double fluorescence report carrier pMir-Report, converts DH5 α competence Ecoli. after enzyme action,
Paving plate, picking monoclonal carries out bacterium colony PCR qualification, the plasmid vector that the checking of last DNA sequencing builds.
(2) luciferase reporter gene activity detection analysis: 293T cell is inoculated in 96 holes by the density in 5000/hole
Plate, will insert sudden change or wild type pMir-reporter carrier, the miR-of 3 ' UTR sequence after cell attachment accordingly
493minics, and pRL-TK (pRL-TK Renilla luciferase Vector, renilla luciferase) exists
Cotransfection 293T cell under the mediation of lipofectamine2000, after transfection 48h, uses luciferase assay detectable
Box detects the activity of luciferase in multi-functional microplate reader, often three repeating holes of group, the fluorescein expressed using pRL-TK as
The activity of internal reference standardization pMir-Report.In triplicate.
Conclusion: will insert sudden change or the wild type pMir-reporter carrier of 3 ' UTR sequence, miR-493minics,
And pRL-TK (pRL-TK Renilla luciferase Vector, renilla luciferase) is at lipofectamine 2000
The lower cotransfection 293T cell miR-493 of mediation can suppress the expression (Fig. 4) of reporter gene, E2F1 is expressed by prompting miR-493
There is direct repression.
SEQUENCE LISTING
<110>attached tumour hospital of Guangzhou medical university
<120>miR-493 gene purposes in preparing anticancer hyperproliferation agent
<130>
<160> 6
<170> PatentIn version 3.2
<210> 1
<211> 22
<212> RNA
<213>
<400> 1
ugaaggucua cugugugcca gg 22
<210> 2
<211> 89
<212> RNA
<213>
<400> 2
cuggccucca gggcuuugua caugguaggc uuucauucau ucguuugcac auucggugaa 60
ggucuacugu gugccaggcc cugugccag 89
<210> 3
<211> 19
<212> RNA
<213>
<400> 3
ccugaugaau aucuguacu 19
<210> 4
<211> 19
<212> RNA
<213>
<400> 4
uggaccaccu gaugaauau 19
<210> 5
<211> 19
<212> RNA
<213>
<400> 5
gagaagucac gcuaugaga 19
<210> 6
<211> 19
<212> RNA
<213>
<400> 6
uugaggucgc gauggaacg 19
Claims (3)
1.miR-493 or the purposes that the expression vector containing miR-493 is in preparation suppression non-small cell lung cancer drug.
2. purposes as claimed in claim 1, it is characterised in that described medicine is the medicine of anticancer propagation.
3. purposes as claimed in claim 1, it is characterised in that described non-small cell lung cancer cell is 95D.
4. purposes as claimed in claim 1, it is characterised in that described miR-493 sequence is as shown in SEQ ID NO:1.
5. purposes as claimed in claim 1, it is characterised in that the dosage form of described medicine be liquid preparation, granule,
Tablet or soft gelatin capsule.
6. purposes as claimed in claim 1, it is characterised in that described medicine also includes pharmaceutically acceptable carrier.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310438244.3A CN103656678B (en) | 2013-09-24 | 2013-09-24 | Application of miR-493 gene in preparation of medicament for inhibiting cancer cell proliferation |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310438244.3A CN103656678B (en) | 2013-09-24 | 2013-09-24 | Application of miR-493 gene in preparation of medicament for inhibiting cancer cell proliferation |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103656678A CN103656678A (en) | 2014-03-26 |
CN103656678B true CN103656678B (en) | 2017-01-11 |
Family
ID=50296232
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310438244.3A Expired - Fee Related CN103656678B (en) | 2013-09-24 | 2013-09-24 | Application of miR-493 gene in preparation of medicament for inhibiting cancer cell proliferation |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103656678B (en) |
-
2013
- 2013-09-24 CN CN201310438244.3A patent/CN103656678B/en not_active Expired - Fee Related
Non-Patent Citations (2)
Title |
---|
Resveratrol Alters microRNA Expression Profiles in A549 Human Non-Small Cell Lung Cancer Cells;Seunghee Bae,et al;《Molecules and Cells》;20110930;第32卷;第243页摘要,表1-3 * |
Tumor Suppressor MicroRNA-493 Decreases Cell Motility and Migration Ability in Human Bladder Cancer Cells by Downregulating RhoC and FZD4;Koji Ueno,et al;《Molecular Cancer Therapeutics》;20111104;第11卷(第1期);第244页摘要,第245页左栏第3段 * |
Also Published As
Publication number | Publication date |
---|---|
CN103656678A (en) | 2014-03-26 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Ma et al. | MicroRNA-200c overexpression inhibits chemoresistance, invasion and colony formation of human pancreatic cancer stem cells | |
CN105126120B (en) | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation | |
CN105524924A (en) | Cyclic RNA circ-ZKSCAN1 use | |
Hao et al. | MicroRNA-124 regulates the radiosensitivity of non-small cell lung cancer cells by targeting TXNRD1 | |
CN110452907A (en) | Target the ASO of long-chain non-coding RNA DDX11-AS1, kit and application in the treatment of liver cancer | |
CN107663539A (en) | Circular rna circ PTGR1 purposes | |
CN104774929B (en) | The application of diagnosis, treatment and prognosis of the 3p of miR 455 in esophageal squamous cell carcinoma | |
CN104208723B (en) | MiR-638 application in anti-acute myeloid leukemia | |
CN108004322A (en) | A kind of applications of lncRNA in adenocarcinoma of lung is diagnosed and/or treated | |
CN102488903A (en) | Application of miR-224 to preparation of medicament for treating non-small cell lung cancer | |
WO2020073630A1 (en) | Application of long-chain non-coding in detecting head and neck cancer and reversing tumor resistance | |
CN107488733B (en) | Application of the miR-133b in prostate cancer with osseous metastasis diagnoses, predicts, treats | |
CN109750104A (en) | Application of the ABHD6 in Diagnosis of Non-Small Cell Lung, prognosis, treatment product | |
CN103920164B (en) | MiR-424-5p is suppressing the application in secondary liver cancer | |
CN110251529A (en) | MiR-124-3p and its analog are preparing the application in anti-breast cancer disease medicament | |
CN105412944A (en) | Effect of miR-451a cells in non-small cell lung cancer | |
CN104726584A (en) | Application of miR-425 in tumor diagnosis, treatment and prognosis | |
CN110317878A (en) | A kind of long-chain non-coding RNA and its application for bladder cancer diagnosis and treatment monitoring | |
CN103243163A (en) | Novel applications of miR-27a (microRNA-27a) | |
CN110283912A (en) | Application of the has-miR-3656 as esophageal squamous cell carcinoma molecular marker | |
CN104419715B (en) | Applications of the miR 125b in antitumor | |
CN103656678B (en) | Application of miR-493 gene in preparation of medicament for inhibiting cancer cell proliferation | |
CN109010831A (en) | The application of LncRNA RET modulate tumor cellular radiosensitivity | |
CN105457041B (en) | Application of miR-26a in non-small cell lung cancer | |
CN101096670B (en) | SiRNA interfering human a-fetoprotein gene and recombinant adenovirus |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170111 Termination date: 20210924 |
|
CF01 | Termination of patent right due to non-payment of annual fee |