CN105126120B - Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation - Google Patents
Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation Download PDFInfo
- Publication number
- CN105126120B CN105126120B CN201510523539.XA CN201510523539A CN105126120B CN 105126120 B CN105126120 B CN 105126120B CN 201510523539 A CN201510523539 A CN 201510523539A CN 105126120 B CN105126120 B CN 105126120B
- Authority
- CN
- China
- Prior art keywords
- cancer
- platinum
- drug
- coding rna
- long non
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Biophysics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Epidemiology (AREA)
- Analytical Chemistry (AREA)
- Immunology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The present invention relates to long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation, it relates to reduce and/or inhibits the medicament of the long non-coding RNA H19 expression in cancer cell in the purposes in the drug that preparation treats or prevents cancer and the purposes in the drug that preparation reduces the platinum-based chemotherapy drug resistance of cancer, purposes of the medicament for further relating to be able to detect long non-coding RNA H19 expression in preparation detection kit, for diagnosing cancer cancer return occurs or predicts for the kit, and for predicting, the platinum-based chemotherapy drug resistance of detection or diagnosis cancer patient, further relate to the pharmaceutical composition comprising foregoing agents.In the present invention, the cancer is can to use the cancer of platinum-based chemotherapy drug therapy, and the preferably described cancer is oophoroma.
Description
Technical field
The invention belongs to biomedical and pharmaceutical fields, and in particular to long non-coding RNA H19 and cancer platinum-based chemotherapy medicine
Object drug resistance correlation.
Background technique
Ovarian cancer mortality still occupies first of gynecological tumor.Although treatment of ovarian cancer scheme is continuously improved, such as operation excision model
The combined chemotherapy of the expansion, taxol and the platinum medicine that enclose, but the death rate is still high, it was reported that the lifes in 5 years of III phase patient
The rate of depositing is only 29%.To find out its cause, chemotherapy resistance is the important of influence ovarian cancer patients survival rate other than early diagnosing difficulty
Factor.At present in chemotherapy in ovarian cancer scheme, platinum medicine is clinically one of choice drug.Although ovarian cancer patients are to platinum
Effective percentage reaches 70%-80% for the first time for combined chemotherapy based on class, but most of patient can all be generated in chemotherapy from now on after
Hair property drug resistance.Therefore how to predict drug resistance, how to avoid occur drug resistance, and how reversing drug resistance and exploitation be directed to drug-resistant tumor
The new drug etc. of cell, is not only the hot spot of current research, also will be the long-range mission in oophoroma research from now on.
The deep understanding of ovarian cancer drug-resistant mechanism is the basis for solving the problems, such as clinical drug-resistant, and improves the pass of chemotherapy effect
Key.The mechanism that existing experimental result shows that oophoroma generates platinum medicine drug resistance may be related with following factor: 1) swelling
Oncocyte reduces the absorption of platinum medicine, discharge enhancing or drug effect are failed: the Asia BJ Union Hospital Pan Ling seminar
The study found that oophoroma platinum class drug resistance specific marker proteins Annexin A3 is by reducing intracellular platinum content and platinum-DNA
Binding capacity and cause cell generate drug resistance.2) DNA damage repair system is related: DNA damage caused by platinum medicine mainly passes through
Nucleotide Sequence Analysis approach, such as the expression product and DNA of Excision repair cross-completion 1 gene (ERCC1) and ERCC1 gene
It repairs azymia complementary genes F (XPF) and forms close heterodimer (ERCC1/XPF) gene etc. to correct.DNA homology simultaneously
Reparation approach and archaeal dna polymerase related gene are also related with platinum medicine resistance, such as mammary cancer 1 number (BRCA1), archaeal dna polymerase
Eta etc..Therefore, DNA damage repair system is often defective in platinum class sensitive cells.3) apoptotic pathways are related:
The exception of apoptosis pathway is related with cisplatin.P53 low expression or Mdm2 high expression make tumour cell to cis-platinum not
It is sensitive.4) signal path is related: platinum class resistance mechanism is also related with associated signal paths, such as Cadherins/catenins and
The signal paths such as PTEN/PI3K/AKT, PI3K inhibitor increase persister to the sensibility of cis-platinum.5) miRNAs is related: miR-
128 in cisplatin-resistant human ovarian cancer Cell line SKOV3/CP low expression, in the cell strain be overexpressed miR-128 reduce ABCC5
With Bmi-1 protein expression, but also the cell increases the sensibility of cis-platinum.Although we have oophoroma platinum class resistance mechanism
More understanding, but dissociate and determine that there are also a certain distance for clinical drug-resistant problem, expansion is also needed to its resistance mechanism deeply
Research.
Research recently finds that some long segment non-coding RNAs (long noncoding RNA, IncRNA) take part in tumour
Response when cell is to DNA damage.The researchs such as Huarte discovery lncRNAs plays an important role in p53 approach, wherein
LincRNA-p21 works in DNA damage as the target gene of p53；LincRNA-p21 further makees mutually with hnRNP-K
With down-stream system gene expression is regulated and controled, to influence Apoptosis.Another long segment non-coding RNA PANDA's and p53
Target gene is induced in DNA damage；PANDA further causes cell cycle arrest with transcription factor NF-YA interaction.For another example
Cdc28lncRNA can induce CDC28 expression under adverse circumstance, and CDC28 expression quantity increase makes cell be easy the weight after adverse circumstance is eliminated
Newly enter cell cycle etc..It can be seen that the long segment non-coding RNA wide participation links of DNA damage response.And platinum
Class drug is mainly crosslinked with DNA, radiation-indued DNA damage, so as to cause series of biologic effect.Thus, long segment non-coding RNA has
The drug resistant mechanism of action of oophoroma platinum class may be taken part in.But about the research relevant to platinum class drug resistance of long segment non-coding RNA
So far it has not been reported.
H19 gene encodes the non-coding RNA molecule of a 2.3kb, includes 5 exons, is the trace base found earliest
One of because.The sequence (as shown in SEQ ID NO:1) of long non-coding RNA H19 can know from GeneBank database lookup,
Its accession number in ncbi database, Nucleotide word bank is NR_002196.2.Existing research finds H19 wide participation
Various pathological processes.The expression of H19 by upstream 2 at 4kb marking control region (imprintingcontrolregion,
ICR) regulate and control with the enhancer of upstream and downstream, marking control region includes differential methylation area
(differentiallymethylatedregion, DMR) and silencing elements (silencer element), DMR can be combined
CTCF insulator albumen.In the allele of matrilinear inheritance, the area DMR combines CTCF, H19 to activate by its upstream and downstream enhancer.
And in the allele of paternal inheritance, the area DMR is methylated, and H19 transcription is silenced element inhibition.Although in cytoplasm and cell
H19 molecule can be detected in core, but H19 is primarily present in cytoplasm, embryonic development regulation is not only taken part in, also with suppression
Oncogene or oncogene role participate in kinds of tumors occurrence and development.Foreign scholar has found long-chain non-coding H19 in kinds of tumors
Unconventionality expression, such as bladder cancer Several Kinds of Malignancy, and find that it has former cancer activity.But also there is research to think that H19 has suppression
Cancer activity can inhibit malignant proliferation, invasion transfer and the tumor neovasculature formation of tumour.Therefore, H19 participates in tumour hair
The mechanism of hair tonic exhibition may be more complicated.In addition, up to now, the case where H19 participates in cisplatin-resistant human ovarian cancer and tool
Body mechanism of action is not yet seen in report.
Summary of the invention
In view of this, it is an object of the invention to: it is resistance to by research long non-coding RNA H19 and cancer platinum-based chemotherapy drug
Medicine correlation provides long non-coding RNA H19 in preparation and treats or prevents the drug of cancer, for diagnosing cancer generation or prediction
Application in the kit of cancer return, and long non-coding RNA H19 is provided in the platinum-based chemotherapy Drug-resistant of regulation cancer
Property, prediction, detection or diagnose cancer patient platinum-based chemotherapy drug resistance in application.
One aspect of the present invention is to provide the long non-coding RNA H19 table that can be reduced and/or inhibit in cancer cell
Purposes of the medicament reached in the drug that preparation treats or prevents cancer.
One aspect of the present invention is to provide the long non-coding RNA H19 table that can be reduced and/or inhibit in cancer cell
Purposes of the medicament reached in the drug that preparation reduces the platinum-based chemotherapy drug resistance of cancer.
Such as:
With regard to such use of the invention, the medicament preferably is selected from: inhibiting the antisense of the long non-coding RNA H19 expression
RNA or the ribozyme for specifically cutting the long non-coding RNA H19.
With regard to such use of the invention, the medicament preferably is selected from: inhibiting the small molecule of the long non-coding RNA H19 expression
Chemical agent.
In some embodiments of such use of the present invention, antisense RNA according to the present invention, it includes can specifically tie
The all or part of nucleotide sequence of the long non-coding RNA H19 or any sequence of its complementary series are closed, it is preferably described
Antisense RNA includes sequence area with one or more partial complementarities of H19, and the more preferably described antisense RNA includes and overall length
The DNA sequence dna of H19 complete complementary, it is preferable that the GEM 132 is DNA or RNA or its derivative, most preferably,
The antisense RNA is included in the expression plasmid that can express it, preferably in eukaryon expression plasmid.
In some embodiments of such use of the present invention, the medicament is preferably to the long non-coding RNA H19
It is oriented the slow virus plasmid of interference.
In an embodiment of such use of the present invention, preferably construct used in the slow virus plasmid to the length
The nucleotide sequence that non-coding RNA H19 is oriented interference is as follows:
Positive-sense strand is as shown in SEQ ID NO:6；
Antisense strand is as shown in SEQ ID NO:7.
Another aspect of the present invention is that provide the medicament for being able to detect long non-coding RNA H19 expression is used in preparation
Cancer is diagnosed to occur or predict the diagnosis of cancer return or predict the purposes in kit.
Another aspect of the present invention is to provide the medicament for the long non-coding RNA H19 expression being able to detect in cancer cell
In preparation for detecting the platinum-based chemotherapy drug resistance of cancer cell or diagnosing the platinum-based chemotherapy drug resistance of cancer patient
Purposes in detection or diagnostic kit.That is, generally, can detecte cancer cell line or the tumor biopsy obtained from cancer patient
The expression quantity of long non-coding RNA H19 in tissue, and resulting amount is compared with scheduled threshold value, thus prediction or prognosis
Whether the cancer cell and cancer patient have platinum-based chemotherapy drug resistance.
With regard to such use of the invention, the medicament, which is selected from, has detection specificity to the long non-coding RNA H19
Nucleotide probe or PCR primer.
It is described that there is detection to the long non-coding RNA H19 in an embodiment of such use of the present invention
The nucleotide sequence of the PCR primer of specificity is preferably as follows:
Positive-sense strand is as shown in SEQ ID NO:2；
Antisense strand is as shown in SEQ ID NO:3.
Another aspect of the invention is to provide a kind of pharmaceutical composition, can reduce and/or inhibits comprising above-mentioned
The medicament or the long non-coding RNA above-mentioned being able to detect in cancer cell of long non-coding RNA H19 expression in cancer cell
The medicament of H19 expression.
In all aspects of the invention, if applicable, it is preferred that the cancer is can to use platinum-based chemotherapy drug
The cancer for the treatment of, such as oophoroma, breast cancer, lung cancer, orchioncus, head and neck cancer, osteosarcoma, melanoma, the cancer of the esophagus, preferably
Oophoroma, in one embodiment, it is preferred to ovarian epithelial carcinoma, including it is inner membrance sample cancer, serous carcinoma, mucus cancer, transparent
Cell cancer, in another embodiment, preferred people's serous ovarian cancer.
In all aspects of the invention, if applicable, it is preferred that the platinum-based chemotherapy drug is cis-platinum, carboplatin
Deng more preferably cis-platinum.
In the present invention, by taking oophoroma as an example, single cell clone first is used to oophoroma cisplatin medicine sensitive cells strain A2780
It is denoted as A2780-B8, on the basis of then carrying out medicine irritation and domestication, obtains to have and stablizes drug resistance character
A2780-B8/CP (cisplatin-resistant human ovarian cancer cell strain).This two groups of cell (i.e. A2780-B8 and A2780-B8/CP) is carried out
QPCR detection, finds H19 significantly high expression in cisplatin-resistant human ovarian cancer cell strain, to filter out closely related with drug resistance
Non-coding RNA --- LncRNA H19.Further, it is verified through tissue of patient sample qPCR, discovery: high-level serous ovarian cancer
H19 also high expression in tissue, and the highly expressed ovarian cancer patients of H19 are easy recurrence, to verify non-coding RNA --- LncRNA
There are significant correlations for the generation and prognosis of H19 and oophoroma.Finally, interfering H19 in drug-resistant cell strain to express by slow virus
And drug sensitive experiment is carried out to it, find: drug-resistant cell strain enhances the sensibility of cis-platinum after H19 is interfered, and further proves
The lncRNA H19 has very high correlation with oophoroma platinum class drug resistance, and is capable of reversing drug resistance strain to a certain extent
Drug susceptibility makes it be restored to sensitive level.It therefore, can be very to the monitoring of tumour patient LncRNA H19 expression
The platinum medicine drug resistance for predicting the patient well, provides reference for prognosis.Meanwhile designing related controllable H19 expression
Drug can effectively improve the chemotherapy effect of patient, improve survival rate.
Compared with the existing technology, the invention has the following beneficial technical effects:
The long non-coding RNA expression of first passage detection patient of the present invention is realized to tumor patient platinum medicine
The monitoring of drug resistance is treated, and gives assessment tumor patient for the first time to the method for platinum-based chemotherapy drug susceptibility, is made it possible to
It early finds platinum-based chemotherapy Drug-resistant, changes cancer immunotherapies in time, improve 5 years survival rates, and improve prognosis.This
Outside, the present invention is also expected to realize the platinum medicine drug resistance for reducing patient by interfering the medicament of H19 expression.
Specific embodiment
Embodiment of the present invention is described in detail below in conjunction with embodiment.It will be understood by those skilled in the art that
The following examples are merely to illustrate the present invention, and should not be taken as limiting the scope of the invention.
In the examples where no specific technique or condition is specified, according to the literature in the art described technology or conditions or
Person carries out according to product description.Reagents or instruments used without specified manufacturer, be can be commercially available it is normal
Advise product.
One, the foundation and identification of human ovarian cancer drug-resistant cell line
1, cell line and its condition of culture
Abortion syndrome A2780 is purchased from China typical culture collection center (address: Hubei Province in August, 2008
No. 299 Wuhan Universitys of wuchang, wuhan area Bayi Road are in the school), CCTCC number GDC198.
A2780-B8 is the monoclonal by cultivate and expand from the hole B8 in the experiment of 96 hole single cell clones to A2780
Cell strain.Cell culture condition: DMEM/F12 culture solution contains 10% fetal calf serum (abbreviation FBS), is placed on the training of 5% carbon dioxide
Case is supported, is cultivated under the conditions of 37 DEG C.
Wherein, DMEM/F12 culture solution and fetal calf serum are purchased from Hyclone company.
2, the foundation of drug-resistant cell strain
By A2780-B8 passage to 24 orifice plates, each orifice plate is inoculated with 1000 or so cells, is placed on the training of 5% carbon dioxide
Case is supported, under the conditions of 37 DEG C, is cultivated 24 hours in the DMEM/F12 culture solution containing 10% fetal calf serum；Then, in above-mentioned culture
10umol/L cis-platinum is added in liquid, continues culture 24 hours；Then, the fresh medium (DMEM/ containing 10% fetal calf serum is changed
F12 culture solution) continue to cultivate, it is passed on after the cell expansion culture wait survive, is routinely passed in the culture solution that drug is not added
4 generations of generation；Repeat identical drug concentration processing: 10umol/L cis-platinum coprocessing 10 times.The cisplatin-resistant cell strain of acquisition is denoted as
A2780-B8/CP。
Said medicine cis-platinum is purchased from Sigma company.
The drug-resistant cell strain routine culture is using no cis-platinum culture medium, its resistance or stable after stablizing culture 8 months.
3, drug sensitivity assay
Two kinds of cell strains of A2780-B8 and A2780-B8/CP are laid on 24 hole cells with same cell number (100 or so)
In culture dish.After 24 hours, various concentration is separately added into culture solution (the DMEM/F12 culture solution containing 10% fetal calf serum)
Cis-platinum, so that the final concentration of cis-platinum is respectively reached 5umol/L, 10umol/L and 20umol/L, drug-treated cell strain 24 hours
Afterwards, replacement contains the DMEM/F12 culture solution of 10% fetal calf serum, continues culture 7 days, observes cell clone under inverted microscope
Quantity (50 cells are effectively cloned the above are one), calculates its survival rate, result is as shown in table 1 below.
From drug sensitive experiment result table 1: drug-resistant cell strain A2780-B8/CP is under the effect of different cis-platin concentrations
The survival rate of (5umol/L, 10umol/L, 20umol/L) is all significantly higher than sensitive cells strain A2780-B8.
1: two kind of cell strain A2780-B8 and A2780-B8/CP of table compares the drug resistance of cis-platinum
Note: * < 0.01 *；*<0.05
Two, human ovarian cancer platinum class drug resistance correlation long non-coding RNA H19 is detected
Long segment non-coding RNA H19 differential expression is detected using fluorescent quantitative PCR technique:
Total RNAs extraction uses in freezing tissue and cellTriPrep kit (MACHEREY-
NAGEL, Germany).RNA concentration is measured by NanoDrop 1000 (thermo scientific, the U.S.).1ug total serum IgE passes through
PrimeScriptTMRT reagent kit (TaKaRa, China) reverse transcription is at cDNA.Analysis instrument is ABI 7500PCR
System (Applied Biosystems), quantitative fluorescent PCR reaction usePremix Ex Taq kit
(TaKaRa,China).PCR response parameter: 42 DEG C of 5min, 95 DEG C of 10sec；95 DEG C of 5sec, 60 DEG C of 30sec are recycled for 40 totally.60
DEG C to 95 DEG C of drafting solubility curves.The above experiment is in triplicate.Using GAPDH as internal reference, by Δ Δ CT method calculate each group it
Between target gene H19 expression difference；The relative expression quantity of sample: wherein Δ Δ Ct=Δ Ct is calculated according to the following formula
Processing group-Δ Ct control group；Δ Ct=Ct H19-Ct GAPDH.
Primer for PCR amplification is synthesized by Jikang Biotechnology Co Ltd, Shanghai.It is specific as follows:
H19 primer
Positive-sense strand: 5'-GGGTCTGTTTCTTTACTTCCTCCAC-3'(SEQ ID NO:2)
Antisense strand: 5'-GATGTTGGGCTGATGAGGTCTGG-3'(SEQ ID NO:3)
Amplified fragments are 240bp；
The gene coding region GAPDH primer:
Positive-sense strand: 5'-GAAGGTGAAGGTCGGAGTC-3'(SEQ ID NO:4)
Antisense strand: 5'-GAAGATGGTGATGGGATTTC-3'(SEQ ID NO:5)
Amplified fragments are 226bp.
1, H19 differential expression in A2780-B8 and A2780-B8/CP cell strain is detected
For oophoroma sensitive cells strain A2780-B8 and drug-resistant cell strain A2780-B8/CP, according to above-mentioned fluorescent quantitation
PCR method detects long segment non-coding RNA H19 differential expression, the results are shown in Table 2.As can be seen from Table 2, select GAPDH for internal reference,
H19 high expression in ovarian cancer drug-resistant cell strain.
H19 differential expression situation in table 2:A2780-B8 and A2780-B8/CP cell strain
2, H19 differential expression in ovarian cancer tissue and normal tissue is detected
The carcinoid normal ovarian epithelium tissue of 52 high-level serous ovarian cancer tissues and 13 gynaecology is selected to use
H19 differential expression is detected, the results are shown in Table 3 according to above-mentioned fluorescence quantifying PCR method in further research.It can from table 3
Out: H19 high expression in cancerous tissue.
Table 3: H19 differential expression situation in ovarian cancer tissue and normal tissue
3, H19 differential expression in different RFS ovarian cancer patients tissues is detected
Ovarian cancer patients cancerous tissue to hospital is fixed according to above-mentioned fluorescence for further studying after selecting 27 recurrences
PCR method is measured, H19 differential expression is detected.
It is grouped by boundary of (RFS) December recurrence-free survival time, analysis the results are shown in Table 4, it can be found that H19 from table 4
Highly expressed patient is easy recurrence.
Table 4: H19 differential expression situation in different RFS ovarian cancer patients tissues
4, A2780-B8 H19 differential expression under cisplatin effect different time is detected
Cisplatin medicine processing is carried out to oophoroma sensitive strain A2780-B8, and in the different time points of processing and changes routine
Different time points after culture solution (DMEM/F12,10%FBS) extract cellular RNA sample, according to above-mentioned fluorescence quantifying PCR method
It is tested, compares the H19 expression of different phase, the results are shown in Table 5.
Visible in table 5: H19 is significantly increased after drug-treated 24 hours, and expression quantity reaches most after changing liquid 8 hours
It is high.Illustrate that the expression of H19 is induced by cisplatin medicine.
Table 5:A2780-B8 different time H19 differential expression under cisplatin effect
| Time | GAPDH | H19 |
| 0hour | 19.88 | 32.0 |
| 0.5hour | 20.26 | 32.07 |
| 0.5hour△△Ct | -0.31 | |
| 2hour△△Ct | -0.44 | |
| 24hour△△Ct | -1.8 | |
| Change liquid 2h △ △ Ct | -1.74 | |
| Change liquid 8h △ △ Ct | -3.06 | |
| Change liquid △ △ Ct for 24 hours | 0.34 | |
| Change liquid 48h △ △ Ct | 1.2 |
In summary experimental result, can determine the cisplatin resistance of H19 and tumour (especially oophoroma) there are correlation,
That is the highly expressed tumour cell of H19 shows the drug resistance to cis-platinum, and the highly expressed tumor patient of H19 is easy recurrence.
Three, the Function Identification of drug resistance correlation long non-coding RNA H19
1, slow virus interference experiment
It is constructed using the H19 interference sequence as shown in SEQ ID NO:6 and SEQ ID NO:7 for in tumour cell
H19 is oriented the slow virus plasmid of interference, and interference sequence is synthesized by invitrogen company.
Positive-sense strand:
CTAGACCCACCGCAATTCATTTAGTCTCGAGACTAAATGAATTGCGGTGGGTTTTTTG(SEQ ID NO:
6)
Antisense strand:
AATTCAAAAAACCCACCGCAATTCATTTAGTCTCGAGACTAAATGAATTGCGGTGGGT(SEQ ID NO:
7)
Slow virus plasmid is subjected to the extracting of high-purity endotoxin-free, by Invitrogen company Lipofectamine 2000
Operation instruction carries out cotransfection 293T cell, and 8h replaces culture solution (the DMEM/F12 culture containing 10% fetal calf serum after transfection
Liquid), 37 DEG C, 5%CO2After cultivating 48h in cell incubator, the cell supernatant rich in lentiviral particle is collected by centrifugation, passes through
It is concentrated in super filter tube, obtains the slow virus concentrate of high titre, measures in 293T cell and demarcate virus titer.It will
Viral concentration liquid and polybrene infect ovarian cancer drug-resistant cell strain in proportion, and screen the stable H19 of acquisition by puromycin and do
Disturb cell strain A2780-B8/CP/H19si.
Meanwhile negative control plasmids are handled according to above-mentioned steps, obtain negative control cell strain A2780-B8/
CP/control.It is as follows to construct negative control plasmids the primer sequence:
Positive-sense strand (control-F):
TATGTGTGGTGTCATTCTCTATATTCTCGAGAATATAGAGAATGACACCACATTTTTG(SEQ ID NO:
8)
Antisense strand (control-R):
AATTCAAAAATGTGGTGTCATTCTCTATATTCTCGAGAATATAGAGAATGACACCACACA(SEQ ID
NO:9)
2, slow virus interference cell strain identification
The interference cell strain of stablizing screened by puromycin is carried out fluorescent quantitative PCR experiment by us, detects it
H19 interference effect.
It the results are shown in Table 6, as seen from Table 6: H19 stablizes the expression of H19 in the cell strain A2780-B8/CP/H19si after interference
Level is significantly lower than original persister A2780-B8/CP and control cell strain A2780-B8/CP/control, basically reaches sensitivity
The expression of strain.
Expression of the table 6:H19 in different Ovarian Cancer Cells compares
3, H19 stablizes interference cell strain drug sensitive experiment
We are to cis-platinum sensitive strain A2780-B8, persister A2780-B8/CP, negative control cell strain A2780-B8/CP/
Control and the identified rear H19 interference strain A2780-B8/CP/H19si obtained have carried out different cisplatin medicine concentration processing
Drug sensitivity experimental analysis.
The results are shown in Table 7, and after being interfered from table 7: H19, the cisplatin medicine sensibility of ovarian cancer drug-resistant strain is obviously risen
The survival rate of height, the processing of 5umol/L drug concentration is reduced to 20% from original 90%.At 20umol/L high concentration medicine
Under reason, almost all is dead.Medicaments insensitive level has substantially resumed to the level of medicaments insensitive strain.
Table 7: the susceptibility situation after cisplatin-resistant cell strain and H19 interference
Illustrate: persister cell A2780-B8/CP reduces H19 content by artificial, and it is aobvious that cisplatin medicine handles survival rate
Write decline.
As it can be seen that the cisplatin-resistant of persister is remarkably decreased after by carrying out slow virus interference to persister cell.This
Show that lncRNA H19 is the relevant non-coding RNA of platinum class drug resistance.
It will be understood by those skilled in the art that in the above-described embodiments, for the tumor tissues of cancer cell or cancer patient
The detection of H19 expression in sample (or blood sample), other than above-mentioned qPCR detection, there are also other a variety of this fields are general
Determination form known to logical technical staff can be used.Such as: it can be in hybridization assays using the few core specifically hybridized with H19
Thuja acid probe detects H19 content in biological sample.
Equally, it will be understood by those skilled in the art that in the above-described embodiments, for the tumour of cancer cell or cancer patient
The inhibition or reduction of H19 expression in tissue samples, other than above-mentioned slow virus interference plasmid, there are also other a variety of abilities
Method known to the those of ordinary skill of domain can use.Such as: building GEM 132 expression plasmid is other using ribozyme etc.
Means.
It can be seen that the purpose of the present invention completely and is effectively achieved.Method and principle of the invention is
It is shown and is illustrated in embodiment, without departing substantially from the principle, embodiment can make any modification.So
Present invention comprises all variant embodiments based on claim spirit and scope of the claims.
Claims (5)
1. the medicament that can be reduced and/or the long non-coding RNA H19 in cancer cell is inhibited to express is preparing the platinum for reducing cancer
Purposes in the drug of based chemotherapy drug resistance, the cancer are oophoroma, and the platinum-based chemotherapy drug is cis-platinum or carboplatin.
2. purposes as described in claim 1, which is characterized in that the medicament is selected from: inhibiting the long non-coding RNA H19 table
The antisense RNA that reaches or the ribozyme for specifically cutting the long non-coding RNA H19.
3. purposes as claimed in claim 2, which is characterized in that the antisense RNA is included in the expression plasmid that can express it
In.
4. purposes as claimed in claim 2, which is characterized in that the medicament, which is selected from, carries out the long non-coding RNA H19
The slow virus plasmid of directional jamming.
5. purposes as claimed in claim 4, which is characterized in that construct used in the slow virus plasmid to the long non-coding
The nucleotide sequence that RNA H19 is oriented interference is as follows:
Positive-sense strand is as shown in SEQ ID NO:6；
Antisense strand is as shown in SEQ ID NO:7.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510523539.XA CN105126120B (en) | 2015-08-24 | 2015-08-24 | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation |
| PCT/CN2016/079538 WO2017031993A1 (en) | 2015-08-24 | 2016-04-18 | Correlation between long non-coding rna h19 and cancer platinum-based chemotherapeutic drug resistance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510523539.XA CN105126120B (en) | 2015-08-24 | 2015-08-24 | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105126120A CN105126120A (en) | 2015-12-09 |
| CN105126120B true CN105126120B (en) | 2018-12-21 |
Family
ID=54711921
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510523539.XA Active CN105126120B (en) | 2015-08-24 | 2015-08-24 | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation |
Country Status (2)
| Country | Link |
|---|---|
| CN (1) | CN105126120B (en) |
| WO (1) | WO2017031993A1 (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105126120B (en) * | 2015-08-24 | 2018-12-21 | 浙江大学 | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation |
| CN105400879B (en) * | 2015-12-10 | 2017-06-16 | 深圳市默赛尔生物医学科技发展有限公司 | LncRNAs screening techniques, ADSCs, chondrogenic differentiation method |
| CN110272997B (en) * | 2018-03-14 | 2023-04-28 | 华中科技大学同济医学院附属同济医院 | Application of C/EBP beta gene or protein |
| CN112359113B (en) * | 2020-11-26 | 2023-03-21 | 中国人民解放军总医院第一医学中心 | Application of LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit |
| CN112980960B (en) * | 2021-04-23 | 2022-05-10 | 中南大学 | Application method of long-chain non-coding RNA LOC730101 and detection and treatment preparation |
| CN113136430B (en) * | 2021-04-23 | 2022-09-23 | 中南大学 | Application method of circular RNA CircSERPINE2 and detection and treatment preparation |
| WO2023082242A1 (en) * | 2021-11-15 | 2023-05-19 | 中国科学院动物研究所 | Use of ctd-2256p15.2 and encoding micropeptide thereof as target in development of tumor treatment drug |
| WO2024027547A1 (en) * | 2022-08-02 | 2024-02-08 | Hung, Mien-Chie | Lincrna-p21 and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002022175A2 (en) * | 2000-09-11 | 2002-03-21 | Musc Foundation For Research Development | Method and composition for treating tumors by selective induction of apoptosis |
| CN101273130A (en) * | 2005-07-07 | 2008-09-24 | 耶路撒冷希伯来大学伊森姆研究发展公司 | Nucleic acid agents for downregulating H19, and methods of using same |
| CN103623429A (en) * | 2013-11-26 | 2014-03-12 | 广州中国科学院先进技术研究所 | Application of LincRNA (large intergenic non-coding RNA) in preparation of medicine for controlling tumor treatment drug resistance of methotrexate |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU2003272367A1 (en) * | 2002-09-12 | 2004-04-30 | Yissum Research Development Company Of The Hebrew University Of Jerusalem | Method for detection of micro-metastasis |
| CN105126120B (en) * | 2015-08-24 | 2018-12-21 | 浙江大学 | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation |
-
2015
- 2015-08-24 CN CN201510523539.XA patent/CN105126120B/en active Active
-
2016
- 2016-04-18 WO PCT/CN2016/079538 patent/WO2017031993A1/en active Application Filing
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002022175A2 (en) * | 2000-09-11 | 2002-03-21 | Musc Foundation For Research Development | Method and composition for treating tumors by selective induction of apoptosis |
| CN101273130A (en) * | 2005-07-07 | 2008-09-24 | 耶路撒冷希伯来大学伊森姆研究发展公司 | Nucleic acid agents for downregulating H19, and methods of using same |
| CN103623429A (en) * | 2013-11-26 | 2014-03-12 | 广州中国科学院先进技术研究所 | Application of LincRNA (large intergenic non-coding RNA) in preparation of medicine for controlling tumor treatment drug resistance of methotrexate |
Non-Patent Citations (3)
| Title |
|---|
| Expression of the imprinted H19 oncofetal RNA in epithelial ovarian cancer;Vasilios Tanos et al.;《European Journal of Obstetrics & Gynecology》;19990731;第85卷;第7-10页 * |
| Histone H1.3 Suppresses H19 Noncoding RNA Expression and Cell Growth of Ovarian Cancer Cells;Magdalena Medrzycki et al.;《Molecular and Cellular Pathobiology》;20140909;第74卷;第6463-6473页 * |
| Oncofetal H19 RNA promotes tumor metastasis;Imad J. Matouk et al.;《Biochimica et Biophysica Acta》;20140731;第1843卷;第1418页第3.1.3节，图3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2017031993A1 (en) | 2017-03-02 |
| CN105126120A (en) | 2015-12-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105126120B (en) | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation | |
| Chen et al. | miR-338-3p suppresses neuroblastoma proliferation, invasion and migration through targeting PREX2a | |
| Qiang et al. | Plexin-B1 is a target of miR-214 in cervical cancer and promotes the growth and invasion of HeLa cells | |
| Li et al. | Increased miR-222 in H. pylori-associated gastric cancer correlated with tumor progression by promoting cancer cell proliferation and targeting RECK | |
| Peng et al. | Long noncoding RNA HULC predicts poor clinical outcome and represents pro-oncogenic activity in diffuse large B-cell lymphoma | |
| Ge et al. | AntagomiR-27a targets FOXO3a in glioblastoma and suppresses U87 cell growth in vitro and in vivo | |
| CN104818334A (en) | Tiny RNA related to lung adenocarcinoma metastasis | |
| CN106701900A (en) | Long-chain noncoding RNA HERC2P3 gene and application thereof in gastric cancer | |
| CN107630092A (en) | The 3p of miR 505 are applied to diagnosis, prognosis and the treatment of prostate cancer with osseous metastasis | |
| Han et al. | A novel microRNA signature predicts vascular invasion in hepatocellular carcinoma | |
| CN105274110A (en) | Non-small-cell lung cancer metastasis and miRNA marker of pre-judging risk of non-small-cell lung cancer metastasis | |
| CN108504658A (en) | Purposes of the LINC01836 in preparing diagnosing gastric cancer product, medicine | |
| Liu et al. | LncRNA-TMPO-AS1 promotes apoptosis of osteosarcoma cells by targeting miR-329 and regulating E2F1. | |
| Dai et al. | LncRNA ITGB1 promotes the development of bladder cancer through regulating microRNA-10a expression. | |
| Ye et al. | MicroRNA-802 inhibits cell proliferation and induces apoptosis in human laryngeal cancer by targeting cAMP-regulated phosphoprotein 19 | |
| CN109576366A (en) | Purposes of the lnc-TALC as molecular marker in assessment glioblastoma TMZ chemotherapeutic efficacy and prognosis | |
| CN109394779B (en) | miR-183 regulator of liver cells and application of miR-183 regulator in preparation of medicine for treating and regulating liver cells | |
| CN110923324A (en) | Breast cancer miRNA marker and application thereof | |
| Li et al. | miR-218 affects the invasion and metastasis of cervical cancer cells by inhibiting the expression of SFMBT1 and DCUNIDI | |
| Wang et al. | miR-760 mediated the proliferation and metastasis of hepatocellular carcinoma cells by regulating HMGA2 | |
| CN105603117B (en) | MiR-3613 is used to distinguish lung squamous cancer transfer and non-diverting miRNA marker | |
| CN105457041B (en) | Application of miR-26a in non-small cell lung cancer | |
| CN104774966A (en) | Lung adenocarcinoma miRNA marker | |
| CN109224076B (en) | Gene miR-140-3P related to lung cancer diagnosis and treatment, and mimics and application thereof | |
| Wang et al. | Circular RNAs sparkle in the diagnosis and theranostics of Hepatocellular Carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |