CN112359113B - Application of LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit - Google Patents
Application of LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit Download PDFInfo
- Publication number
- CN112359113B CN112359113B CN202011347359.8A CN202011347359A CN112359113B CN 112359113 B CN112359113 B CN 112359113B CN 202011347359 A CN202011347359 A CN 202011347359A CN 112359113 B CN112359113 B CN 112359113B
- Authority
- CN
- China
- Prior art keywords
- esophageal cancer
- pcr
- primer pair
- kit
- marker
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an application of LncRNA18q21.2 in serving as a marker for diagnosing esophageal cancer, a primer pair and a kit, belonging to the technical field of genetic engineering, wherein the LncRNA18q21.2 can be used as a marker for diagnosing esophageal cancer. The detection of the expression of LncRNA18q21.2 in esophageal cancer tissues by using the kit and the primers provided by the invention can be used as effective means for esophageal cancer diagnosis, curative effect observation, prognosis judgment, lesion residue, recurrence detection and the like, and has the advantages of simplicity and convenience in operation, good stability, high sensitivity and profound clinical significance and popularization.
Description
Technical Field
The invention belongs to the technical field of genetic engineering, and particularly relates to application of LncRNA18q21.2 in serving as a marker for diagnosing esophageal cancer, a primer pair and a kit.
Background
Esophageal cancer is the eighth most common malignancy worldwide, the sixth among lethal cancers worldwide, esophageal squamous carcinoma is the most common type of esophageal cancer, and the pathogenesis of esophageal squamous carcinoma is related to ethnicity, genes and diet. Like other tumors, the physiological characteristics of esophageal squamous carcinoma also include epigenetic abnormalities and loss of control of physiological functional signaling pathways. Chemotherapy, radiotherapy and surgical resection are the current major treatment for esophageal squamous carcinoma. However, the 5-year survival rate of esophageal squamous carcinoma is arbitrarily low (< 15%). Therefore, the discovery of effective methods for early diagnosis and treatment of esophageal squamous cell carcinoma is of great significance.
Historically, many non-protein-encoding portions of the human genome have been considered "garbage" DNA. However, in the last decade, non-coding genomes have been intensively studied with the development of high-throughput technologies such as next generation sequencing. Surprisingly, such studies have shown that, although under certain conditions most of all nucleotides can be transcribed, less than 2% of the human genome encodes a protein. Among the various types of non-protein-coding transcripts, long non-coding RNA (lncRNA) has attracted increasing attention. lncRNA is defined as a transcript that does not encode a protein and is greater than 200 nucleotides in length. Lncrnas can be classified into intergenic transcripts, enhancer RNAs (edrnas), and sense or antisense transcripts overlapping other genes according to their transcription sites. lncRNA regulates protein-protein, protein-DNA and protein-RNA interactions through transcriptional regulation, splicing regulatory factors, post-transcriptional processing, chromatin remodeling regulation, or as enhancers, molecular "decoys" of mirnas. LncRNA affects cell proliferation, migration, apoptosis, invasion, tumorigenicity, cell cycle, metastasis, and the like by these means.
With the development of high-throughput sequencing technology and the maturation of RNA chip technology, more and more lncrnas were discovered. Although most lncRNA has unclear functions, some LncRNA related to tumors are mature, such as MALAT1, PANDA, PCAT-1, PCA3, etc., and some LncRNA are under study and can be used as a new strategy for diagnosing or treating tumors. For example, SAMMSON is specifically expressed in more than 90% of clinical specimens of malignant (but not benign) melanoma in humans and can be used as a biomarker for malignant melanoma; since SAMSSON gene is not expressed in benign melanoma, its emergence is likely to be a key factor in developing new diagnostic tools to significantly improve melanoma prognosis. HULC (the hepatocellular cancer (HCC) up-regulated lncRNA) is highly expressed in HCC patients and can be detected in blood by conventional PCR methods. The developed plasmid BC-819 (DTA-H19) utilizes tumor-specific expression of IncRNA H19, carrying the gene for the A subunit of diphtheria toxin under the control of the H19 promoter. Intratumoral injection induces high levels of diphtheria toxin expression in tumors, thereby reducing the size of a variety of human tumors in the trial. However, the research on lncRNA related to the occurrence and development of esophageal cancer is still few, and the action mechanism and clinical value of lncRNA in esophageal cancer are yet to be deeply researched.
Disclosure of Invention
In view of the above, the present invention aims to provide an application of lncrna18q21.2 as a marker for diagnosing esophageal cancer, a primer pair and a kit, and the lncrna18q21.2 provided by the present invention can be used as a marker for diagnosing esophageal cancer.
In order to achieve the above purpose, the invention provides the following technical scheme:
the invention provides application of LncRNA18q21.2 in serving as a marker for diagnosing esophageal cancer.
The invention also provides an RT-PCR primer pair for detecting the LncRNA18q21.2 in the technical scheme, wherein the nucleotide sequence of an upstream primer of the RT-PCR primer pair is shown as SEQ ID No.1, and the nucleotide sequence of a downstream primer is shown as SEQ ID No. 2.
Preferably, the procedure of RT-PCR of the RT-PCR primer pair comprises: 5min at 95 ℃; 30s at 95 ℃, 30s at 64 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 61 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 58 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 55 ℃, 60s at 72 ℃ and 26 cycles; 5min at 72 ℃.
Preferably, the RT-PCR system of the RT-PCR primer pair comprises every 25 μ L: 2.5 μ L template, 1 μ L upstream primer at a concentration of 10 μ M, 1 μ L downstream primer at a concentration of 10 μ M, 12.5 μ L2 XTAQAQAQA PCR MasterMix and ddH 2 O 8μL。
The invention also provides a kit for detecting esophageal cancer, which comprises the RT-PCR primer pair in the technical scheme.
Preferably, the kit further comprises 2 XTAQA PCR MasterMix and ddH 2 O。
The invention provides application of LncRNA18q21.2 in serving as a marker for diagnosing esophageal cancer, and the LncRNA18q21.2 can be used as a marker for diagnosing esophageal cancer.
The invention has the following advantages:
the primer pair and the kit are used for detecting esophageal cancer tissues and tissues beside the esophageal cancer, and compared with tissues beside the esophageal cancer, the expression of LncRNA18q21.24 in the esophageal cancer tissues is increased by 77.1% (27/35), so that the lncRNA is highly expressed in the esophageal cancer, is a potential cancer-promoting gene in the esophageal cancer, and can be used as a new molecular marker of the esophageal cancer.
The kit provided by the invention selects LncRNA18q21.2 as a detection marker for the first time, and the lncRNA is expression-increased lncRNA which is screened from esophageal cancer for the first time and is expressed in esophageal cancer tissues, so that the kit is pioneering.
Drawings
FIG. 1 shows the expression level detection of the RT-PCR primer pair in 16 esophageal cancer cell lines LncRNA18q21.2, in which GAPDH is internal reference and ddH 2 O is used as a system control to evaluate whether a PCR product exists in the systemContamination of, e.g. ddH 2 The result of the O detection is negative, the system result is credible, and the size of the amplification product of the system is 373bp;
FIG. 2 shows that 8 pairs of RT-PCR primer pairs are applied to detect the expression level of LncRNA18q21.2 in esophageal cancer and paracarcinoma tissues, wherein GAPDH is internal reference and ddH 2 O is a system control to evaluate whether the system is contaminated with PCR products, such as ddH 2 The result of the O detection is negative, the system result is credible, and the size of the amplification product of the system is 373bp;
FIG. 3 shows that LncRNA18q21.2 semiquantitative RT-PCR primer pairs are used for detecting the expression level of LncRNA18q21.2, wherein the content of COLO680N cell cDNA is 100%,50%,5%,1%,0.5%,0%, ddH 2 O is a system control to evaluate whether the system is contaminated with PCR products, such as ddH 2 And if the result of the O detection is negative, the system result is credible, and the size of the amplification product of the system is 373bp.
Detailed Description
The invention provides application of LncRNA18q21.2 in serving as a marker for diagnosing esophageal cancer. In the invention, the nucleotide sequence of the LncRNA18q21.2 is shown as SEQ ID No.5, and specifically comprises the following steps:
AAAACATTTGCTGACTGCTGTTCTATCTAGGATATCATCAGTGTGTAGATGATCAGAGTTCATGTCAGTGTTCCTACAAGCCAATGAAGAAAAACAGAGATCTGTGTTCTGAATGGAAAAATTCCTACTGATGCCAGTAAGTGAGCCATCCATCTATGATGTGTCTATGGGGAAGAAAGTGACATGAATGAGTAAAATAGAATATATGCTTTAAATCATGAAAATTGAGTCCAGATGGAAAGGTTAGGAGGAAATGGAGTGGAAAGGTGGATGAAGAAGAGTGAGAACTCATGCAGTCGTTGCGACTTGGTTGACACTTCCTTCCCTGTGACTACAATTCCAAGTTCAGTACTCCTGAGCTTTTATAGATGGATGAGAATATAGGGGGAAGAAACAAGAGGAAGGAGTTTTCTGAAATCTCGGTGGAGAGGAGGGAGAAAAAAGATGGGAAAATGTTACAAGCATTCTGTTCATGTTGTATCACTTAGTGCAGTCTTGTCTTCCCAGCCCACTAGTCTGGAACAAGTCAGTCTCAAACATAACAACAGACACTGGGGAGCTCTCCAACAAAAGATCACCTCCCAAAGAACAGGATGGTGTCGAAGACTGAATGCCAGCCTGAGGAAACAGAAATACTACAGAAGCACGCCAGAGCCTGCAGTGTCTCCTCGCTGCCTCTCAATGAACTGCTAAAAGACCAAGAACTCTGCTGAGAGATAAGAAGAGGGGAGGGTGTGCTGCAGGTGGTGCTGGGAGGCCCAGACCTTCTCCTGACATCTGGGGCTGGCTACAGGAAACAGAAACATCACCCAGGCCTTGGCGCGAGACAGGACAGAGGCAGATTGTGACTCAGATCTGCAGGTGGAAAGTGGGCCTTTCGTTTTCTCCTAGGGGTAGAGCAAAGCCAGAGGGCTCAGTCAGAGGAAACCTAAGGCAGTTCATGATCCCTTCAACTTTATACCATTTCCTCAAAACTGCCTCCAAACAGTGGGCAACTGGAAAGGTGGTCTGACCTCCAGTGATCACACAGTATGCATTATAACAGAAGGCTGTCACTGTCAATTGCATGGCTCCCTCACTATGCATTCCTTCTATCAATTTACGACAACACACTGTAGTGAGTACCTGCACATTGCTGGGTATTTTGGCAGACATTGATAGTAGATGAATAACACCTGGTACTTGACCTTGAGACGCTCACTGCCTAGTGTGGGGAACCAATGGTTGCAATATAAAGTATTAACTAGAGGGATAGAGGACTGCCTGAGGATCTCTGCACTCAGAGGAAGGGCCATGAGATCAGCCAGGACAGTAGGGAGGCAGTGACTCATGAAATTAGCAAGTGGTGAGAAGAGGGCA。
the invention also provides an RT-PCR primer pair for detecting the LncRNA18q21.2 in the technical scheme, wherein the primer pair is designed according to the mRNA of the LncRNA18q21.1 with human sources. The nucleotide sequence of the upstream primer of the RT-PCR primer pair is shown as SEQ ID No.1, and specifically comprises the following steps:
5’-TGTCAGTGTTCCTACAAGCCAA-3’；
the nucleotide sequence of the downstream primer is shown as SEQ ID No.2, and specifically comprises the following steps:
5’-CCCTCCTCTCCACCGAGATT-3’。
in the present invention, the procedure of RT-PCR of the RT-PCR primer pair preferably comprises: 5min at 95 ℃; 30s at 95 ℃, 30s at 64 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 61 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 58 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 55 ℃, 60s at 72 ℃ and 26 cycles; 5min at 72 ℃. In the present invention, the RT-PCR system of the RT-PCR primer pair preferably comprises, per 25. Mu.L: 2.5 μ L template, 1 μ L upstream primer at a concentration of 10 μ M, 1 μ L downstream primer at a concentration of 10 μ M, 12.5 μ L2 XTAQAQAQA PCR MasterMix and ddH 2 O 8μL。
The invention provides a kit for detecting esophageal cancer, which comprises an RT-PCR primer pair in the technical scheme. In the present invention, the kit preferably further comprises 2 XTAQ PCR MasterMix and ddH 2 And O. The invention relates to the RT-PCR primer pair, the 2 xTaq PCR MasterMix and ddH in the kit 2 The amount of O to be placed is not particularly limited, and may be the amount of a reagent to be placed in a conventional kit.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
1. Preparation of template (extraction of Total RNA and reverse transcription Process)
Preparation of RNA: the method comprises the steps of obtaining esophageal cancer tissue samples and corresponding paracarcinoma tissue samples, taking 8 esophageal cancer tissue samples EC 1-EC 8 and 8 paracarcinoma tissue samples EN 1-EN 8 matched with esophageal cancer tissues in the embodiment, respectively extracting total RNA of the samples by using a TRIZOL extraction method, determining the content and purity of the samples by using an ultraviolet spectrophotometer to determine the value of absorbance (A), and identifying the quality of the RNA by using 1% agarose gel electrophoresis.
And (3) cDNA synthesis: 5 μ g of total RNA extracted from the esophageal cancer tissues and the corresponding paracarcinoma tissues is subjected to reverse transcription to obtain first strand cDNA by using a random primer in Superscript III-reverse transcriptase kit (Invitrogen), the obtained cDNA is diluted to 100 μ l by adding deionized water, and 2.5 μ l of the cDNA is taken to be used for 25 μ l of systematic semi-quantitative RT-PCR.
2. Semi-quantitative RT-PCR
The PCR reaction system for amplification by using LncRNA18q21.2 semi-quantitative RT-PCR primers comprises the following components in a total volume of 25 mu l:
template (cDNA): 2.5 mul;
semi-quantitative RT-PCR primers (10 pmol/. Mu.l):
an upstream primer LncRNA18q21.2-F: (5' TGTCAGTGTTCCTACAAGCCAA-): 1 mul;
the downstream primer LncRNA18q21.2-R: (5-: 1 mul;
2×Taq PCR MasterMix(Real Timer)：12.5μl；
ddH 2 O：8μl。
amplification conditions:
lncrna18q21.2 was amplified using Stepdown PCR conditions as follows:
95℃5min；
95 ℃ 30s → 64 ℃ 30s → 72 ℃ 60s,3 cycles;
95 ℃ 30s → 61 ℃ 30s → 72 ℃ 60s,3 cycles;
95 ℃ 30s → 58 ℃ 30s → 72 ℃ 60s,3 cycles;
30s at 95 ℃ → 30s at 55 ℃ → 60s at 72 ℃,26 cycles;
72℃5min。
the product is a fragment of lncrna18q21.1, size: 373bp.
A25. Mu.l system of semi-quantitative RT-PCR with internal control GAPDH comprises:
template (cDNA): 2.5 mul;
semi-quantitative RT-PCR primers (10 pmol/. Mu.l):
upstream primer GAPDH-F (SEQ ID No. 3): (5 'GACCACAGTCCATGCCATCATCAC-3'): 1 mul of the total amount of the components,
downstream primer GAPDH-R (SEQ ID No. 4): (5-: 1 mul;
2×Taq PCR MasterMix(Real Timer)：12.5μl；
ddH 2 O：8μL。
the size of the product is as follows: 454bp.
The amplification conditions were:
the reaction condition is that the temperature is 95 ℃ for 5min;95 ℃ 30s → 63 ℃ 30s → 72 ℃ 45s,25 cycles; 5min at 75 ℃, the product is GAPDH fragment, size: 454bp.
Detection of PCR reaction product
The PCR product was subjected to 2% agarose gel electrophoresis, examined by an ultraviolet transmission analyzer and photographed.
4. Results
And judging the expression quantity of LncRNA18q21.2 in the esophageal cancer tissue and the matched paracancerous tissue according to the intensity of the agarose gel electrophoresis PCR product band. In 8 pairs of esophageal cancer tissues and paired paracarcinoma tissues, the expression level of LncRNA18q21.2 in the esophageal cancer tissues is lower than that in the paired paracarcinoma tissues (FIG. 2), the brightness of a strip represents the expression level of a PCR template, and if the expression level is higher than that in the case of being brighter, the expression level is lower than that in the case of being weaker. Wherein EC is esophageal cancer tissue, EN is matched esophageal cancer paracancerous tissue, GAPDH is internal reference, ddH 2 O is a system control to evaluate whether the system is contaminated with PCR products, such as ddH 2 And if the result of the O detection is negative, the system result is credible, and the size of the amplification product of the system is 373bp.
Example 2
Clinical specimen detection
(1) 35 pairs of matched esophageal cancer tissues and paracarcinoma tissues are taken to carry out semi-quantitative RT-PCR amplification of LncRNA18q21.2, the preparation of a template, the PCR amplification system and conditions, and the detection of an amplification product are the same as those in the embodiment 1, and the detection results are shown in the following table 1:
TABLE 1 test results
Example 3
Sensitivity test
cDNA and ddH of esophageal cancer cell line COLO680N highly expressed by LncRNA18q21.2 2 O was mixed in proportion, and the expression level of LncRNA18q21.2 was detected using the LncRNA18q21.2 semiquantitative RT-PCR primer set in example 1, and the amplification band was as shown in FIG. 3. The content of cDNA in COLO680N cells was 100%,50%,5%,1%,0.5%,0% in this order. ddH 2 O is a system control to evaluate whether the system is contaminated with PCR products, such as ddH 2 And if the result of the O detection is negative, the system result is credible, and the size of the amplification product of the system is 373bp.
The results of fig. 3 show that: the specific primer pair of LncRNA18q21.2, a reaction system and conditions in the invention are used for detecting the expression of the cell LncRNA18q21.2, the sensitivity can reach 5 percent, and the sensitivity is high.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> first medical center of general hospital of people liberation force of China
Application of <120> LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgtcagtgtt cctacaagcc aa 22
<210> 2
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
ccctcctctc caccgagatt 20
<210> 3
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tgtcagtgtt cctacaagcc aa 22
<210> 4
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
ccctcctctc caccgagatt 20
<210> 5
<211> 1359
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
aaaacatttg ctgactgctg ttctatctag gatatcatca gtgtgtagat gatcagagtt 60
catgtcagtg ttcctacaag ccaatgaaga aaaacagaga tctgtgttct gaatggaaaa 120
attcctactg atgccagtaa gtgagccatc catctatgat gtgtctatgg ggaagaaagt 180
gacatgaatg agtaaaatag aatatatgct ttaaatcatg aaaattgagt ccagatggaa 240
aggttaggag gaaatggagt ggaaaggtgg atgaagaaga gtgagaactc atgcagtcgt 300
tgcgacttgg ttgacacttc cttccctgtg actacaattc caagttcagt actcctgagc 360
ttttatagat ggatgagaat atagggggaa gaaacaagag gaaggagttt tctgaaatct 420
cggtggagag gagggagaaa aaagatggga aaatgttaca agcattctgt tcatgttgta 480
tcacttagtg cagtcttgtc ttcccagccc actagtctgg aacaagtcag tctcaaacat 540
aacaacagac actggggagc tctccaacaa aagatcacct cccaaagaac aggatggtgt 600
cgaagactga atgccagcct gaggaaacag aaatactaca gaagcacgcc agagcctgca 660
gtgtctcctc gctgcctctc aatgaactgc taaaagacca agaactctgc tgagagataa 720
gaagagggga gggtgtgctg caggtggtgc tgggaggccc agaccttctc ctgacatctg 780
gggctggcta caggaaacag aaacatcacc caggccttgg cgcgagacag gacagaggca 840
gattgtgact cagatctgca ggtggaaagt gggcctttcg ttttctccta ggggtagagc 900
aaagccagag ggctcagtca gaggaaacct aaggcagttc atgatccctt caactttata 960
ccatttcctc aaaactgcct ccaaacagtg ggcaactgga aaggtggtct gacctccagt 1020
gatcacacag tatgcattat aacagaaggc tgtcactgtc aattgcatgg ctccctcact 1080
atgcattcct tctatcaatt tacgacaaca cactgtagtg agtacctgca cattgctggg 1140
tattttggca gacattgata gtagatgaat aacacctggt acttgacctt gagacgctca 1200
ctgcctagtg tggggaacca atggttgcaa tataaagtat taactagagg gatagaggac 1260
tgcctgagga tctctgcact cagaggaagg gccatgagat cagccaggac agtagggagg 1320
cagtgactca tgaaattagc aagtggtgag aagagggca 1359
Claims (5)
- The application of LncRNA18q21.2 as a biomarker in the preparation of products for diagnosing esophageal cancer; the product comprises an RT-PCR primer pair for detecting the LncRNA18q21.2; the nucleotide sequence of the upstream primer of the RT-PCR primer pair is shown as SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown as SEQ ID No. 2.
- 2. The use of claim 1, wherein the RT-PCR procedure of the RT-PCR primer pair comprises: 5min at 95 ℃; 30s at 95 ℃, 30s at 64 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 61 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 58 ℃, 60s at 72 ℃ and 3 cycles; 30s at 95 ℃, 30s at 55 ℃, 60s at 72 ℃ and 26 cycles; 5min at 72 ℃.
- 3. The use according to claim 1 or 2, wherein the system of RT-PCR of the RT-PCR primer pair comprises per 25 μ Ι _ of: 2.5 μ L template, 1 μ L upstream primer at a concentration of 10 μ M, 1 μ L downstream primer at a concentration of 10 μ M, 12.5 μ L2 XTAQAQAQA PCR MasterMix and ddH 2 O 8μL。
- 4. The use according to claim 1, wherein the product is a kit.
- 5. The use of claim 4, wherein the kit further comprises 2 XTaqPCRMastermix and ddH 2 O。
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011347359.8A CN112359113B (en) | 2020-11-26 | 2020-11-26 | Application of LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011347359.8A CN112359113B (en) | 2020-11-26 | 2020-11-26 | Application of LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112359113A CN112359113A (en) | 2021-02-12 |
| CN112359113B true CN112359113B (en) | 2023-03-21 |
Family
ID=74532881
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011347359.8A Active CN112359113B (en) | 2020-11-26 | 2020-11-26 | Application of LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112359113B (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103952474B (en) * | 2014-03-27 | 2018-05-15 | 南京市第一医院 | A kind of esophagus cancer diagnosis marker and its application method |
| CN105126120B (en) * | 2015-08-24 | 2018-12-21 | 浙江大学 | Long non-coding RNA H19 and cancer platinum-based chemotherapy Drug-resistant correlation |
| CN107523647A (en) * | 2017-10-24 | 2017-12-29 | 南阳师范学院 | Detect the LncRNA combinations of early stage cancer of the esophagus prognosis situation and the kit containing the combination |
-
2020
- 2020-11-26 CN CN202011347359.8A patent/CN112359113B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112359113A (en) | 2021-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lee et al. | Genome‐wide profiling in melatonin‐exposed human breast cancer cell lines identifies differentially methylated genes involved in the anticancer effect of melatonin | |
| Li et al. | Downregulation of microRNA-139 is associated with hepatocellular carcinoma risk and short-term survival | |
| CN107488726B (en) | Kidney cancer prognosis evaluation biomarker and detection reagent and application thereof | |
| Vidal et al. | hsa-miR-29c and hsa-miR-135b differential expression as potential biomarker of gastric carcinogenesis | |
| Kanda et al. | Clinical significance of expression and epigenetic profiling of TUSC1 in gastric cancer | |
| KR20150067151A (en) | Method for screening cancer | |
| CN104877998A (en) | Long noncoding RNA (LncRNA), and primer pair and kit for detecting expression level of long noncoding RNA in cells and tissues | |
| CN109371137B (en) | Method for detecting hsa _ circ _0007986 in serum of esophageal cancer patient as novel biomarker and application | |
| Qi et al. | Downregulation of microRNA-382 is associated with poor outcome of esophageal squamous cell carcinoma | |
| WO2013148151A1 (en) | Plasma microribonucleic acids as biomarkers for endometriosis and endometriosis-associated ovarian cancer | |
| CN113913522B (en) | Reagent and kit for detecting endometrial cancer | |
| ZONG et al. | Expression and prognostic significance of long noncoding RNA AK001796 in esophageal squamous cell carcinoma. | |
| CN111187840A (en) | Biomarker for early breast cancer diagnosis | |
| KR20110015013A (en) | Methods for assessing colorectal cancer and compositions for use therein | |
| CN109439747B (en) | CircRNA markers for lung cancer diagnosis and application thereof | |
| CN112359113B (en) | Application of LncRNA18q21.2 in serving as marker for diagnosing esophageal cancer, primer pair and kit | |
| CN106319062B (en) | Minimally invasive kit for thyroid cancer auxiliary diagnosis or curative effect prediction | |
| Sun et al. | Clinical significance of the long noncoding RNA RP11-19P22. 6-001 in gastric cancer | |
| Tu et al. | Co-upregulation of miR-31 and its host gene lncRNA MIR31HG in oral squamous cell carcinoma | |
| CN110172512A (en) | A kind of application of carcinoma of endometrium biomarker in cancer diagnosis and the prediction of prognosis situation | |
| CN110438210A (en) | The enriched multiple detection method of non-small cell lung cancer targeted drug correlation low frequency mutation | |
| CN116083579A (en) | circRNA-miRNA-mRNA regulation network for non-small cell lung cancer diagnosis and application thereof | |
| CN112251513B (en) | Esophageal cancer and/or gastric cancer molecular marker Lnc5q31.1, primer, kit and application | |
| Habel et al. | Mir-21 and Mir-125b as theranostic biomarkers for epithelial ovarian cancer in Tunisian women | |
| CN111471769A (en) | Method for amplifying circular RNA, specific amplification primer and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |