CN103554246B - Interferon alpha mutant and polyethylene glycol derivative thereof - Google Patents

Interferon alpha mutant and polyethylene glycol derivative thereof Download PDF

Info

Publication number
CN103554246B
CN103554246B CN201310468202.4A CN201310468202A CN103554246B CN 103554246 B CN103554246 B CN 103554246B CN 201310468202 A CN201310468202 A CN 201310468202A CN 103554246 B CN103554246 B CN 103554246B
Authority
CN
China
Prior art keywords
cysteine mutant
interferon
polyethyleneglycol
consensus interferon
interferon alfacon
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201310468202.4A
Other languages
Chinese (zh)
Other versions
CN103554246A (en
Inventor
周敏毅
刘金毅
程永庆
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BEIJING TRI-PRIME GENE PHARMACEUTICAL CO., LTD.
Original Assignee
BEIJING SANYUAN GENE ENGINEERING Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by BEIJING SANYUAN GENE ENGINEERING Co Ltd filed Critical BEIJING SANYUAN GENE ENGINEERING Co Ltd
Priority to CN201310468202.4A priority Critical patent/CN103554246B/en
Publication of CN103554246A publication Critical patent/CN103554246A/en
Application granted granted Critical
Publication of CN103554246B publication Critical patent/CN103554246B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/555—Interferons [IFN]
    • C07K14/56—IFN-alpha
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/56—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule
    • A61K47/59—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes
    • A61K47/60—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an organic macromolecular compound, e.g. an oligomeric, polymeric or dendrimeric molecule obtained otherwise than by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyureas or polyurethanes the organic macromolecular compound being a polyoxyalkylene oligomer, polymer or dendrimer, e.g. PEG, PPG, PEO or polyglycerol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Toxicology (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention belongs to the field of biomedicine and relates to a consensus interferon cysteine mutant, a polyethylene glycol derivative of the consensus interferon cysteine mutant, a preparation method and a pharmaceutical composition of the polyethylene glycol derivative and application of the consensus interferon cysteine mutant and the polyethylene glycol derivative in preparation of drugs for treating viral diseases. The consensus interferon cysteine mutant is obtained by mutating an amino acid at the 81st position, which is counted from the N end of the amino acid sequence of the consensus interferon, into cysteine; and the polyethylene glycol derivative of the consensus interferon cysteine mutant is obtained through connecting the consensus interferon cysteine mutant with a polyethylene glycol modifier, and the molecular weight of the polyethylene glycol modifier is in a range of 5 to 40 KDa. The consensus interferon cysteine mutant and the polyethylene glycol derivative of the consensus interferon cysteine mutant provided by by the invention have higher biological activity, better pharmacological action and stability and more reliable safety.

Description

Interferon alpha mutant and polyethyleneglycol derivative thereof
The application is the applying date is on February 23rd, 2012, and application number is 201210043385.0, and denomination of invention is the divisional application of " interferon alpha mutant and polyethyleneglycol derivative thereof ".
Technical field
What the present invention was general relates to interferon alpha mutant, its polyethyleneglycol derivative, the preparation method of the latter, pharmaceutical composition and both purposes in the medicine of preparation treatment virus disease, relate to Interferon alfacon-1 cysteine mutant, its polyethyleneglycol derivative especially, the preparation method of the latter, pharmaceutical composition and both purposes in the medicine of preparation treatment virus disease.
Background technology
Interferon, rabbit (interferon, IFN) be a kind of cytokine class medicine with broad-spectrum disease resistance toxic action produced by animal body at first, the type that α, β, γ, λ etc. are large can be divided into according to its generating unit is different from the mechanism of action, and often kind of large type can be divided into some little hypotypes, between hypotypes different in same large type, in primary structure, difference is very little, on the above higher structure of secondary closely.In several large type, α type is most widely used one, and this kind of Interferon, rabbit of current clinical application mainly comprises Interferon a2a, interferon alpha 2 b, Interferon α1 b, Interferon alfacon-1 etc.Wherein Interferon alfacon-1 (consensus interferon or integrated interferon) is after carrying out sequence alignment to known alpha-interferon, Amino acid score the highest for the frequency of occurrences is fitted on corresponding position separately, and engineer's alpha-interferon of the non-natural amino acid sequence obtained after respective location is modified, comprise the molecule of multiple amino acids sequence, but homology is high to each other, their biologic activity is more than 10 times of natural alpha-interferon.
Although various alpha-interferon plays curative effect more and more widely in the process of Current therapeutic viral infectious diseases, but himself poor stability, transformation period short feature also limit its further clinical application, brings some troubles to patient's medication.Given this reason, fundamental research and the product development of a lot of long-acting interferon aspect are carried out both at home and abroad, comprise interferon molecule self is transformed, research and develop comprise interferon molecule aminoacid sequence fusion rotein, interferon molecule carried out to chemically modified, conveying and drug effect performance process etc. in the body of selecting suitable drug delivery system to optimize interferon molecule, wherein the listing of polyethylene glycol modified interferon (belonging to the Interferon, rabbit of chemically modified) is the maximum success obtained in this field.
Polyoxyethylene glycol (polyethelene glycol, PEG) be a kind of linear polymer, the parents characteristic of the biocompatibility good due to it and not only hydrophilic but also close ester, being able to shows one's talent from numerous chemical modifiers becomes the modifier of the widest protein and peptide drugs of current research and apply.Develop through years of researches, the interferon alpha product that existing two PEG modify at present successfully goes on the market, the Interferon a2a (commodity are called " PEG-IFN alpha-2a ") of the interferon alpha 2 b (commodity " happy energy of wearing " by name) of the PEG modification of U.S.'s Schering Plough (Schering-Plough) company (now being purchased by MSD Corp.) and the PEG modification of Switzerland's Roche (Roche) company respectively, respectively at calendar year 2001 and 2002 in U.S.'s listing, entered inland of China in 2003 simultaneously and sell.About the interferon alpha 2 b that the PEG of Schering Plough company modifies, described by having its formula composition in Chinese patent application CN00808452.1; The Interferon a2a that the PEG of Roche Holding Ag modifies then has a detailed description in Chinese patent CN97113049.3.In addition, the interferon alpha product also having more PEG to modify is researched and developed, and wherein closest to the listing stage is the Interferon alfacon-1 that the PEG of Intermune company exploitation modifies.
Make a general survey of the development of PEG modified interferon α technology, mainly along with the development of PEG modification technique.Early stage research and development is mainly around non-specific sites PEG modification technique, selected PEG modifier purity is low, molecular weight is little (generally at below 10KDa) and distribution range is wide, decorating site kind and quantity is many and the modified derivative formed is unstable, causes that modified outcome forms heterogeneity, purity relatively low (about 85%), quality control not easily realizes, long-acting is not obvious and still has certain toxic side effect.The interferon alpha 2 b product that the PEG of above-mentioned Schering Plough company modifies just belongs to this type.There is specific position PEG modification technique in the development along with PEG modifier, because the purity of selected PEG modifier obtains large increase, molecular weight can reach more than 20KDa and distribution range significantly constriction, and the improvement of modifying mechanism makes decorating site kind and quantity reduce, the modified derivative stability formed improves, thus the shortcoming of above-mentioned non-specific sites PEG modification technique is obtained improve significantly.
Specific position PEG modification technique can be divided into three types again, and a kind of is modify target protein molecule with the PEG modifier with branched structure, reaches the object reducing decorating site quantity by the space steric effect that branched structure PEG modifier is stronger.The Interferon a2a product that the PEG of above-mentioned Roche Holding Ag modifies just belongs to this type.But because this so-called " specific position " modification technique is from modifying amino acid mechanism can not accomplishing only to modify single kind, the amino acid only modifying single site can not be accomplished, so the kind of decorating site and number are still numerous, as Chinese patent CN200380103341.1 discloses the Interferon a2a that branched structure PEG modifies, there is (comprising PEG modified interferon α 2a product " PEG-IFN alpha-2a " of Roche Holding Ag) isomer of 12 decorating sites.
The second is the amino acid whose free alpha-amino group of modifying protein molecule N-terminal, principle is that the amino acid whose free alpha-amino group of protein N-terminal has lower pKa value compared with the free epsilon-amino of Methionin in other site of protein, with amido modified dose, modification reaction can occur under lower pH.But the specificity due to this pH selective reaction is not too high, even if the modification reaction on the free epsilon-amino of Methionin still can be there is under lower pH, and modification may cover the avtive spot of protein molecule, cause modified outcome activity greatly to reduce, therefore this modification technique is also restricted in actual applications.
The third is with the sulfydryl on thiol modifier modifying protein molecule halfcystine, because the halfcystine quantity in protein molecule is little, and sulfydryl on most halfcystine is for the formation of in molecule or intermolecular disulfide bond, only have few free sulfhydryl groups can supply to modify, so the specificity of this modification reaction is very high.As Chinese patent application CN200510076676.X discloses the Interferon α1 b of a kind of sulfydryl PEG modifier modification, make use of and in Interferon α1 b molecule, only have the feature sulfydryl PEG modifier of a free sulfhydryl group to modify it.But the greatest problem of this kind of actual expansive approach of technology there is no free cysteine residues in natural protein molecules, even if there is the protein sterling that also can be used in modification because obviously affecting the stability of protein molecule and purge process (easily being formed in molecule or intermolecular disulfide bond) to be difficult to obtain, make modification cannot realize (because once formed in molecule or intermolecular disulfide bond just do not have can for the free cysteine modified); And select the halfcystine of native sites to carry out modifying the avtive spot that may cover protein molecule equally, cause modified outcome activity greatly to reduce.The Interferon α1 b that above-mentioned PEG modifies is just also lower because of activity residual rate after the lower biological activity of Interferon α1 b self and modification, thus makes final PEG modified outcome activity lower, and practical application effect needs to be proved.
Interferon alpha kind hypotype is numerous in addition, there are many sites can supply to change to produce active higher mutation disturbance element α product, as US Patent No. 4695623, US4897471, US5372808 disclose the Interferon alfacon-1 molecule that a kind of activity is native sequences Interferon α1 more than 0 times in sequence.So this feature of interferon alpha also can be utilized to select the plain α of active high, that good stability is low with toxicity mutation disturbance to carry out PEG modification, with improve or improve modified outcome drug effect, medicine generation and security, the Interferon alfacon-1 that the PEG of aforementioned Intermune company modifies just belongs to this type, and and for example Chinese patent application CN02159951.3 also discloses the Interferon alfacon-1 that a kind of branched structure PEG modifier is modified.But single utilization this kind of technology still can not solve modified outcome composition heterogeneity, purity difference, quality control not easily realize, long-acting is not obvious and still have the problem of certain toxic side effect.
Summary of the invention
Primary and foremost purpose of the present invention is to provide a kind of cysteine mutant of Interferon alfacon-1, undesirable to solve in existing interferon alpha the free cysteine residues site not having free cysteine residues to have for the modification of specific position sulfydryl PEG modifier or institute or to suddenly change, cause protein molecule instability, activity is low, separation and purification is difficult and be unfavorable for the problem that specific position PEG modifier is modified.
For realizing this object, in the embodiment on basis, the amino acid mutation of one of the 80-82 position of holding meter from N in Interferon alfacon-1 aminoacid sequence is halfcystine by the cysteine mutant of Interferon alfacon-1 of the present invention, has the aminoacid sequence shown in SEQ ID No.1-3 respectively.
The present invention selects being that halfcystine predicts the outcome based on molecular computer space structure before and after sudden change from the amino acid mutation of one of the 80-82 position of N end meter in Interferon alfacon-1 aminoacid sequence, the space structure of known interferon alpha and receptors bind principle and Interferon a2a that oneself knows and interferon alpha 2 b.
In order to obtain Interferon alfacon-1 cysteine mutant, need successively to carry out the structure of genetic engineering bacterium or the genetically engineered cell of expressing Interferon alfacon-1 cysteine mutant molecule, genetic engineering bacterium or the fermentation of genetically engineered cell and the purifying of tunning, preferably carry out the purifying of the structure of the colibacillus engineering of expressing Interferon alfacon-1 cysteine mutant molecule, fermentation and tunning.
In the building process of genetic engineering bacterium or genetically engineered cell, first need to obtain and increase and express the gene of Interferon alfacon-1 cysteine mutant, the method adopted preferably well known to a person skilled in the art PCR method, and is more preferably the known Overlap extension PCR method of those skilled in the art.The carrier be suitable for is selected, with well known to a person skilled in the art that the gene of expression Interferon alfacon-1 cysteine mutant is proceeded to described carrier thus builds recombinant vectors by the method building recombinant vectors after the gene of Interferon alfacon-1 cysteine mutant is expressed in a large amount of acquisition.Described carrier and recombinant vectors preferred plasmid carrier, this plasmid vector should have the restriction enzyme site single separately of one or more groups pair of enzyme, and is suitable for being transferred into corresponding Host Strains or host cell.
Then first prepare competent Host Strains or host cell, recycling electroporation, PEG method etc. well known to a person skilled in the art that recombinant vectors is proceeded to genetic engineering bacterium or the genetically engineered cell of Host Strains or constructing host cell expression Interferon alfacon-1 cysteine mutant by method.Described Host Strains or the preferred intestinal bacteria of host cell, pichia spp and Chinese hamster ovary celI, and more preferably intestinal bacteria.
The fermentation of engineering bacteria or engineering cell should select the conditions such as the suitable substratum composition that it grows, pH, temperature, air flow, incubation time and feed operation.For the fermentation of colibacillus engineering, preferred LB substratum, temperature in culturing process controls between 30-37 DEG C, pH controls (to select pH adjusting agent control pH if desired between 6.0-8.0, described pH adjusting agent includes but not limited to NaOH, ammoniacal liquor and various organic nitrogen source, preferred ammoniacal liquor), air flow should meet the growth needs of thalline or cell and the needs of Product Expression synthesis, incubation time is relevant to the mode of feed operation, and when the feed operation condition taking to be suitable for, incubation time is between 6-48 hour.
If Interferon alfacon-1 cysteine mutant albumen express in engineering bacteria or engineering cell, need to fermentation culture results thalline or cell carry out break process to discharge Interferon alfacon-1 cysteine mutant albumen wherein.And for the engineering bacteria of the protokaryons such as intestinal bacteria, more need break process to discharge the Interferon alfacon-1 cysteine mutant albumen of expressing with inclusion bodies.Conventional breaking method is including, but not limited to ultrasonic disruption, ball mill fragmentation, N,O-Diacetylmuramidase process etc.
For the Interferon alfacon-1 cysteine mutant albumen of expressing with inclusion bodies, the thick inclusion body obtained break process is needed to carry out washing operation to remove the foreign protein such as a small amount of tropina, membranin wherein contained as far as possible.The damping fluid used in washing process is including, but not limited to Tris-HCl, PB, and the pH value of washing process should control between 7.0-9.0.In order to dissolve more insoluble hydrophobic protein impurity, can add a certain amount of salt in lavation buffer solution, that conventional is NaCl, and concentration range is between 0.05-0.5mol/L; In order to the membranin that solubilizing hydrophobic is stronger, a certain amount of tensio-active agent can be added in lavation buffer solution, this type of conventional tensio-active agent includes but not limited to tween-80, sodium laurylsulfonate (SDS), TritonX-100, and concentration is between 0.01-5%.
Because in shattering process, thalline or cell can discharge some proteolytic ferments, thus Interferon alfacon-1 cysteine mutant of likely degrading, therefore need to add some materials in the washing process in shattering process and after fragmentation to suppress the activity of these proteolytic ferments, the most direct method adds proteinase inhibitor, as trypsin inhibitor, round-about way also can add metal ion chelation agent, as EDTA, because metal ion chelation agent can play the hydrolytic action metal ion that must rely on by these proteolytic ferments of chelating.
Wash the inclusion body sex change dissolving obtained and can use the urea of 7-10mol/L or the Guanidinium hydrochloride of 5-8mol/L, also need if desired to add sulfhydryl reagent to improve the dissolving effect of denaturing agent, described sulfhydryl reagent is including, but not limited to mercaptoethanol, dithiothreitol (DTT).Dissolving the mass/volume ratio (g/ml) of inclusion body/denaturing agent that adopts can between 1:3 to 1:50, preferably between 1:5 to 1:30, best between 1:7 to 1:20.Sex change dissolution time should more than 2 hours.
Renaturing inclusion bodies can adopt dilution refolding method, dialysis renaturation method or on-column refolding method.Dilution refolding method be by a step or multistep dilution renaturation solution by the concentration dilution of denaturing agent to below 0.5mol/L, to make protein molecule renaturation gradually when breaking away from denaturing agent and affecting; Dialysis renaturation method dialyses make the concentration of denaturing agent to be reduced to 0.5mol/L below with the renaturation solution of upper volume to sex change liquid with 10 times, plays the effect of renaturation equally; On-column refolding method sex change liquid is directly gone up ion-exchange, hydrophobic, size-exclusion (gel) chromatographic column, then with carry out containing the elute soln constantly reducing denaturant concentration gradient elution with while realize target albumen Isolation and purification and renaturation.
The essentially consist of renaturation solution is the buffered soln of pH between 5.0-10.0, to ensure the basic alkaline environment needed for renaturation, can meet the buffered soln of this requirement including, but not limited to Tris-HCl, sodium borate buffer liquid.Disulfide linkage mispairing is formed in order to prevent renaturation excessive velocities in renaturation process, need in renaturation solution, add some oxidized forms and the reduced form sulfhydryl reagent redox equilibrium system material to composition, as the redox equilibrium system of Sleep-promoting factor B and reduced glutathion composition.In order to prevent renaturation excessive velocities from causing, protein folding is incomplete, disulfide linkage mispairing simultaneously, can add some other materials, as arginine, EDTA, metal ion and various molecular chaperones materials etc. in the renaturation solution of above-mentioned essentially consist.The selection of these materials and dosage have a lot of report in the prior art, repeat no more here.
The renaturation solution that above-mentioned dilution refolding method and dialysis renaturation method obtain, and by the broken centrifugal supernatant containing the Interferon alfacon-1 cysteine mutant that soluble form is expressed directly obtained, and with the centrifugal supernatant of fermentation culture of the Interferon alfacon-1 cysteine mutant of soluble form expression, all need to carry out further chromatographic separation and purification.Interferon alfacon-1 cysteine mutant molecule and the difference of impurity molecule on affine character, charge property, hydrophobic property, molecular size range is utilized can successively to select the combination of one or more in affinity chromatography, ion-exchange chromatography, hydrophobic chromatography, gel separation chromatography to carry out purifying.In order to better reach centrifugation, parting liquid can be treated carry out concentration before chromatographic separation and purification, the method that can select is anti-molten after organic solvent deposit, saltout after anti-molten, polyoxyethylene glycol concentrated, ultrafiltration and chromatography etc.
The Interferon alfacon-1 cysteine mutant molecule that chromatographic separation and purification obtains can with well known to a person skilled in the art that SDS-PAGE electrophoresis adds dying method with coomassie brilliant blue or high performance liquid chromatography determination purity; With mass spectroscopy determination molecular weight; With " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " subparts regulation, to measure the interferon activity that the obtains specific activity divided by protein concn determination Interferon alfacon-1 cysteine mutant.
Wherein high performance liquid chromatography purity detecting method can adopt reversed-phased high performace liquid chromatographic or Size Exclusion High Performance liquid phase chromatography, but preferred Size Exclusion High Performance liquid phase chromatography, because this kind of method is more convenient, accurate, quick.Adopt during Size Exclusion High Performance liquid phase chromatography and require that the number of theoretical plate of chromatographic column is greater than 10000, applied sample amount is between 5-100 μ l, and between preferred 10-50 μ l, the chromatographic separation time is 3 times of main peak appearance time.
Study on the stability is the Interferon alfacon-1 cysteine mutant solution that obtained by chromatographic separation and purification under the environment of 20-45 DEG C long-term storage 3-6 month, regularly the change of outward appearance is observed in sampling in the process, and detects the change of the major quality controlling such as purity, activity index.
The Interferon alfacon-1 cysteine mutant molecule that chromatographic separation and purification obtains also needs to carry out animal drugs for test evaluation and animal acute toxicity test evaluation.
In a preferred embodiment, the amino acid mutation of the 80th counted from N end in Interferon alfacon-1 aminoacid sequence is halfcystine by Interferon alfacon-1 cysteine mutant of the present invention, and it has the aminoacid sequence shown in SEQ IDNo.1.
In a preferred embodiment, the amino acid mutation of the 81st counted from N end in Interferon alfacon-1 aminoacid sequence is halfcystine by Interferon alfacon-1 cysteine mutant of the present invention, and it has the aminoacid sequence shown in SEQ IDNo.2.
In a preferred embodiment, the amino acid mutation of the 82nd counted from N end in Interferon alfacon-1 aminoacid sequence is halfcystine by Interferon alfacon-1 cysteine mutant of the present invention, and it has the aminoacid sequence shown in SEQ IDNo.3.
Second object of the present invention is to provide the polyethyleneglycol modified derivative of Interferon alfacon-1 cysteine mutant as above, to solve that existing interferon alpha polyethyleneglycol derivative composition heterogeneity, purity actives are low, quality control not easily realizes or long-acting is not obvious and to still have the problems such as certain toxic side effect.
For realizing this object, in the embodiment on basis, polyethyleneglycol derivative of the present invention to be connected with polyethyleneglycol modified dose by described Interferon alfacon-1 cysteine mutant and to obtain, and the molecular weight of described polyethyleneglycol modified dose is between 5KDa-40KDa pauses.
In a preferred embodiment, described polyethyleneglycol modified dose is mercapto-polyglycol modifier, is selected from the one in maleimide PEG modifier, ethene sulfuryl PEG modifier, iodo-acid amide PEG modifier or adjacent pyridyl disulfide PEG modifier.
For obtaining PEG modification reaction that described polyethyleneglycol derivative carries out mainly by the impact of the factors such as the kind of modifier, temperature, protein concn, pH, protein/modifier quality/mol ratio, stirring velocity, additive and modification reaction time.
PEG modifier for specific position sulfydryl modification mainly contains maleimide PEG modifier (mPEG-maleimide according to PEG activating group from the different of modification reaction mechanism, mPEG-MAL), ethene sulfuryl PEG modifier (mPEG-vinylsulfone, mPEG-VS), iodo-acid amide PEG modifier (mPEG-iodoacetamide, mPEG-IA) with adjacent pyridyl disulfide PEG modifier (mPEG-orthopyridyl disulfide, mPEG-OPSS), structure is following respectively, and (exemplarily property structure mainly provides the structure of activating group, but activating group is not limited to and is connected with a mPEG).
Maleimide PEG modifier:
Ethene sulfuryl PEG modifier:
Iodo-acid amide PEG modifier:
Adjacent pyridyl disulfide PEG modifier:
The mechanism that the above two modify sulfydryl is and the addition reaction of sulfydryl generation double bond, and both mechanism of modification sulfydryl rear are and sulfydryl generation disulfide linkage replacement(metathesis)reaction.Wherein preferably use mPEG-MAL, because it has speed of response faster, also can carry out modification reaction even in acid condition.The molecular weight of PEG modifier can between 5KDa-40KDa, but because low-molecular-weight PEG modifier is not obvious to the effect extending the interferon alpha transformation period, make its biological activity decline after the PEG modifier modified interferon α of high molecular serious, therefore the molecular weight of preferred PEG modifier is between 10KDa-20KDa.
The speed that temperature can improve modification reaction is improved in modification, but also can accelerate hydrolysis or the oxidation rate of modifier simultaneously, also be unfavorable for the stable of Interferon alfacon-1 cysteine mutant, therefore suitable modification reaction temperature is 2-40 DEG C, preferred modification reaction temperature is 2-25 DEG C, and optimum modification reaction temperature is 2-10 DEG C.
The speed that protein concn can improve modification reaction is improved in modification, but be unfavorable for the stable of protein, the concentration of therefore suitable Interferon alfacon-1 cysteine mutant is 2-20mg/ml, and preferred concentration is 1-10mg/ml, and optimum concentration is 2-5mg/ml.
In order to reach this protein concn, need to concentrate Interferon alfacon-1 cysteine mutant, needed for also pH and buffered soln can being transformed into simultaneously.Anti-molten after conventional concentration method includes but not limited to organic solvent deposit, saltout after concentrated, the chromatographic separation of anti-molten, ultrafiltration, polyoxyethylene glycol etc.
The pH needed in modification is relevant with the mechanism of modification reaction, pH when mPEG-MAL modifies as mentioned before can be lower, even acid range can be arrived, and the pH of mPEG-VS when modifying must medium-sized or alkaline, but the in general all relatively more suitable modification reaction of the weakly alkaline environment of 7.0 – 9.0.The pH of modification is slower lower than modification reaction speed during this pH scope; Although and fast higher than modification reaction speed during this pH scope, Interferon alfacon-1 cysteine mutant is unstable, easily forms intermolecular disulfide bond and significantly reduces the total amount of modifiable Interferon alfacon-1 cysteine mutant molecule.
Improve in modification or reduce protein/modifier quality or mol ratio and all can improve speed of response.To consider to increase input from the angle improving PEG modifier utilization ratio the amount of Interferon alfacon-1 cysteine mutant of reaction, to consider then should to increase input from the angle improving Interferon alfacon-1 cysteine mutant transformation efficiency the amount of PEG modifier of reaction, concrete how process should determine depending on particular case that (utilization ratio paying the utmost attention to modifier still pays the utmost attention to the utilization ratio of protein, depend on both cost ratios to a great extent), but generally suitable ratio should between 1:8 – 8:1, preferred ratio is between 1:4 – 4:1, optimum ratio is between 1:2 – 2:1.
Increase in modification to stir and can improve the speed of modification reaction, especially for from modifying the slower modification reaction of mechanism speed of response.But too fast stirring is unfavorable to stablizing of protein, also cannot accelerate the speed of modification reaction further simultaneously, therefore suitable modification reaction stirring velocity is between 0-40 rev/min, and preferred speed is between 1-20 rev/min, and optimum speed is between 2-10 rev/min.
Add Cucumber in modification or in protein buffer solution, there is the speed that Cucumber also can affect modification reaction, as added the tensio-active agent of some type or there is the NaCl of high density in protein buffer solution, but concrete affecting laws is owing to adding and there is material huge number, concentration range can be selected wide, so can not be discussed without exception, particular problem is needed specifically to study.
The time of modification reaction is all relevant with above-mentioned each influence factor, in general the prolongation modification reaction time all can improve modification reaction yield, but the time exceed a certain threshold value after this rule can become not obvious, and also can be unfavorable to stablizing of Interferon alfacon-1 cysteine mutant, the economic benefit of reaction process can be reduced, therefore the suitable modification reaction time, the preferred time, the optimum time was between 1 – 12 hours between 0.5 – 24 hours between 0.5 – 48 hours.
Modification reaction stops containing having neither part nor lot in the PEG modifier of modification reaction, not adorned Interferon alfacon-1 cysteine mutant, the Interferon alfacon-1 cysteine mutant of unit point modification and the Interferon alfacon-1 cysteine mutant of a small amount of multidigit point modification in rear modification reaction mixture in principle, must by the composition beyond the Interferon alfacon-1 cysteine mutant of follow-up separation and purification process removing unit point PEG modification.
The Interferon alfacon-1 cysteine mutant molecule utilizing target unit point PEG to modify and impurity molecule have the feature of notable difference on molecular weight, gel chromatography (gel filtration chromatography can be adopted, or molecular-exclusion chromatography (size exclusion chromatography GFC), SEC) they are separated, the filler that can adopt includes but not limited to Sephacryl S-100, Sephacryl S-200, Sephadex G-25, Sephadex G-50, Sephadex G-75, Superdex75, TSKgel HW-50, TSKgel HW-55 etc.
What modify due to thiol modifier is the halfcystine site of protein, protein can be made after modification to lose the electronegative group that dissociates, and other charged group of likely masking protein matter, and a rear effect of the modifier molecule connecting the larger modifier of molecular weight or connect more number is more obvious.The Interferon alfacon-1 cysteine mutant molecule that the change of protein molecule this charge property before and after modifying therefore can be utilized to modify target unit point PEG and impurity carry out ion-exchange chromatography (ion exchange chromatography, IEC) be separated, the filler that can adopt includes but not limited to DEAE Sepharose FF, Q Sepharose FF, CMSepharose FF, SP Sepharose FF, DEAE Sepharose CL-6B, Source15, Source30, TSKgel CM-650, TSKgel DEAE-650, TSKgel QAE-550, TSKgel SP-650, TSKgelCM-5PW, TSKgel DEAE-5PW etc.In this purge process, due to PEG modifier neutral, so can not be adsorbed in loading process.
Due to the molecule that PEG is a not only hydrophilic but also close ester, for the close ester performance of protein molecule can be improved after modifying protein molecule, and molecular weight is larger, more this Molecules raising connected be more obvious, the Interferon alfacon-1 cysteine mutant molecule that the change of protein molecule this hydrophobic performance before and after modifying therefore can be utilized to modify target unit point PEG and impurity carry out hydrophobic interaction chromatography (hydrophobic interactionchromatography, HIC) be separated, the filler that can adopt includes but not limited to Phenyl Sepharose6FF, Butyl Sepharose4FF, Source15PHE, Source15ETH, TSKgel Ether-5PW, TSKgelPhenyl-5PW etc.
The Interferon alfacon-1 cysteine mutant mercapto-polyglycol modifier modified derivative that purifying obtains also needs to carry out the evaluations such as purity, molecular weight, biologic activity, stability, medicine generation, security, the Interferon alfacon-1 cysteine mutant of the same described unmodified of method.
In a kind of embodiment be more preferably, the molecular weight of polyethyleneglycol modified dose of the present invention is between 10KDa-20KDa.
3rd object of the present invention is to provide the preparation method of above-mentioned Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative, comprises the steps:
1) the described Interferon alfacon-1 cysteine mutant solution that preparation is concentrated, make its concentration reach 2.0-20mg/ml, and make the described buffer solution system residing for Interferon alfacon-1 cysteine mutant be converted to the suitable buffer solution system carrying out polyethyleneglycol modified reaction;
2) concentrated Interferon alfacon-1 cysteine mutant solution obtained above is contacted with polyethyleneglycol modified dose carry out modification reaction;
3) chromatographic separation and purification is carried out to the mixture obtained after modification reaction, polyethyleneglycol modified dose that wherein has neither part nor lot in modification reaction with removing and the Interferon alfacon-1 cysteine mutant had neither part nor lot in described in modification reaction, and removing is connected with the Interferon alfacon-1 cysteine mutant mercapto-polyglycol derivative of multiple peg molecule.
4th object of the present invention is to provide the pharmaceutical composition of above-mentioned Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative.
In the embodiment on basis, containing treating significant quantity and the described Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative of safe dose in composition of the present invention, and pharmaceutically acceptable carrier of sufficient quantity.
Last object of the present invention is to provide above-mentioned Interferon alfacon-1 cysteine mutant and the purposes of polyethyleneglycol derivative in the medicine of preparation treatment virus disease thereof.
Interferon alfacon-1 cysteine mutant of the present invention and polyethyleneglycol derivative thereof have identical target indication with the Interferon alfacon-1 do not suddenlyd change, because Interferon, rabbit is to the extensive restraining effect of virus replication, so they are all effective in cure to nearly all disease of viral infection, especially in treatment hepatitis B and/or hepatitis C, comparatively natural interferon alpha molecule has quite or better in body or pharmacy in vitro.
The term " interferon-alpha " used in the present invention or " interferon alpha " comprise the natural antiviral activity material that human body or animal body are produced by white corpuscle under extraneous pathogenic agent stimulates, also the recombinant molecule identical with above-mentioned native sequences selecting suitable expression vector to express by gene engineering method is comprised, also comprise the molecule being integrated with the engineer of above-mentioned natural interferon alpha conserved sequence selecting suitable expression vector to express by gene engineering method, i.e. Interferon alfacon-1 molecule.
The term " Interferon alfacon-1 " (consensus interferon or integratedinterferon) used in the present invention only refers to the Interferon alfacon-1 with aminoacid sequence shown in SEQ ID No.4 in the application documents except specification sheets background technology part, this Interferon alfacon-1 has a detailed description in Chinese patent application CN02159950.5 (being called as wherein " Novel alpha interferon mutant ", the sequence 3 corresponding in sequence table).
The term " polyethyleneglycol modified dose " used in the present invention, also be that " PEG modifier " refers to mono methoxy polyethylene glycol modifier, also a hydroxyl of peg molecule one end is namely closed with methoxyl group, and with the activated polyethylene glycol of gained after a hydroxyl of the suitable activation method activation the other end.Because the reactive behavior of hydroxyl self is very low, so the reactive behavior of peg molecule after overactivation is greatly improved, just can be called as " polyethyleneglycol modified dose ".The modification reaction mechanism of polyethyleneglycol modified dose about the selection of activating group, the mechanism of activation and activation gained has a lot of bibliographical information in the prior art, applies for and obtained the authorization many sections about the patent of polyethyleneglycol modified dose as Nektar company of the U.S. (former Shearwater company)." mercapto-polyglycol modifier " of the present invention is polyethyleneglycol modified dose that has neither part nor lot in the free sulfhydryl groups forming disulfide linkage in narrow spectrum modifying protein molecule, to obtain by commercial channel or by known activating mechanism activation preparation, especially mPEG-MAL and mPEG-VS can from external Nektar company buy or from domesticly comprising Jiankai Science and Technology Co., Ltd., Beijing, the company of professional activated PEG modifier of Beijing Kaizheng Biotech Engineering Development Co., Ltd. buys.
The term " polyethyleneglycol modified " used in the present invention refer to by polyethyleneglycol modified agent molecule and protein molecule chemical coupling to together with.The group of polyethyleneglycol modified dose participating in linked reaction is the activating group that it introduces in reactivation process, amino group, mercapto groups, carboxylic group or oh group that the group of protein is mainly wherein free, preferably amino group or mercapto groups.
Embodiment
By following embodiment, enforcement of the present invention is described further, but embodiments of the present invention are not limited to following embodiment.
Embodiment 1: the expression engineering bacteria of Interferon alfacon-1 81 site cysteine mutant builds and confirms with sequence
Extract the plasmid of Interferon alfacon-1 as template, first run PCR comprises two reaction systems.
Reaction system 1 primer is:
P1：ATGTGTGACCTGCCGCAGAC，
P4：CTATTAGTCTTTACGACGCAG，
Increase the DNA sequence dna of 81 sites and upstream thereof.
Reaction system 2 primer is:
P2：GAATTTTTCCAGGCAAGATTCGTCC，
P3：CTGGAAAAATTCTACACCGAAC，
Increase the DNA sequence dna in 81 sites and downstream thereof.
Reaction conditions is: 93 DEG C, 4 minutes, 93 DEG C, 1 minute, then 55 DEG C, 2 minutes, 72 DEG C, totally 30 circulations in 2 minutes.
Second takes turns PCR with the product of first round PCR for template, with P1, P2 for primer carries out pcr amplification.Reaction conditions is: 93 DEG C, 4 minutes, 93 DEG C, 1 minute, then 55 DEG C, 2 minutes, 72 DEG C, totally 30 circulations in 2 minutes.
Second takes turns PCR primer through agarose electrophoretic analysis, selects the DNA fragmentation of about 720bp, and with NdeI/EcoR I double digestion, electrophoresis reclaims the target DNA fragment of about 500bp.
By pET-23b plasmid vector Nde I/EcoR I double digestion, reclaim the target DNA fragment of also taking turns PCR recovery with above-mentioned second through agarose electrophoresis and be connected.Ligation condition is: 2 × Rapid buffer4-5 μ l, T4DNA Lagase1 μ l, object fragment 1-2 μ l, carrier 3 μ l, 4 DEG C of connections of spending the night.
Prepare e. coli jm109 or DH5 α competent cell, transform above-mentioned connection product, coating ammonia benzyl is dull and stereotyped, 37 DEG C of incubated overnight.
Picking list bacterium colony is as template, and increase with primer P1, P2 of above-mentioned design, product detects through agarose electrophoresis, and positive colony occurs specific band at about 720bp; Get positive colony to cultivate in a small amount, extract plasmid Nde I/EcoR I double digestion.There is specific band at about 3kb and about 500bp respectively, conform to expectation situation, the success of preliminary explanation construction of recombinant plasmid.For confirming its sequence further, with T7 universal primer, full-automatic sequencing is carried out to ABI377 sequenator.
Embodiment 2: the fermentation of Interferon alfacon-1 80 site cysteine mutant, purifying and detection
The colibacillus engineering obtaining expressing Interferon alfacon-1 80 site cysteine mutant is built by the method that same embodiment 1 principle is identical, then (often liter with peptone 10g, yeast powder 5g, NaCl10g preparation through being coated with in the LB substratum that picking individual colonies after dull and stereotyped activation is inoculated in containing penbritin, pH is regulated to be 7.0), 37 DEG C, 230 revs/min shaking table shake-flask culture are to OD 600nmfor 0.6-0.8.Then be inoculated in the LB substratum of 50L in 80L fermentor tank, carry out the fermentation culture penbritin of 0.1% (often liter containing) with the volume inoculum size of 5%, culture temperature is 37 DEG C, regulate pH between 6.5-7.5 with ammoniacal liquor in culturing process, control oxygen dissolving value between 3-5% with rotating speed.At OD 600nmreach and add IPTG10g in the ratio of mass volume ratio 1:5000 after 1.0 and continue inducing culture 3 hours, inducing culture temperature is 35 DEG C, and suitably in fermentor tank in the process adds LB substratum.The inducing culture time to after put centrifugal 20 minutes of tank room temperature 5000 revs/min and collect thalline, gained thalline with TE damping fluid (50mmol/L Tris-HCl, 5mmol/L EDTA, pH8.0) wash centrifugal twice to remove the major impurity in fermented liquid.
Get thalline 40g that above-mentioned process obtains to add 600ml TE damping fluid with the mass volume ratio of 1:15 and put on sonicator and carry out ultrasonication, condition is for make a call to 5 seconds, have a rest 5 seconds, totally 60 minutes, the broken liquid chamber temperature 6000 revs/min of gained abandons supernatant in centrifugal 20 minutes, precipitate add that TE buffer solution is centrifugal with the mass volume ratio of 1:10 twice must isolation of occlusion bodies.
Gained 10g inclusion body to add after 100ml7mol/L Guanidinium hydrochloride under appropriate agitation condition denaturing treatment 2 hours with the mass volume ratio of 1:10, after inclusion body dissolves completely, room temperature 8000 revs/min abandons precipitation in centrifugal 20 minutes, supernatant carries out renaturation process with dilution refolding method, renaturation solution consists of: 0.15mol/L sodium borate buffer liquid, 3mmol/L Sleep-promoting factor B, 1mmol/L reduced glutathion, regulates pH to be 9.5.Renaturation process carries out in 2-8 DEG C of low-temperature cold store, first with renaturation solution, supernatant is diluted 4 times, to place after 8 hours to dilute 5 times with renaturation solution again and continue renaturation 6 hours, and then dilutes 5 times with renaturation solution, and last renaturation 6 hours is to reach final renaturation effect.After renaturation completes 4 DEG C 8000 revs/min centrifugal 30 minutes, get supernatant and carry out dialysis treatment by the volume ratio of 1:10 to 25mmol/L Tris-HCl, pH8.0 solution, dialysis time is 12-24 hour, and dialyzate is changed 1-2 time in centre.
Renaturation solution after dialysis above after centrifugal 30 minutes uses 25mmol/L Tris-HCl, the DEAE Sepharose FF chromatographic column of pH8.0 solution equilibria through 4 DEG C 8000 revs/min.First continue to rinse chromatographic column 1-3 column volume with level pad after completion of the sample, then with the 25mmol/L Tris-HCl containing 0.3mol/L NaCl, pH8.0 solution carries out wash-out and collects elution peak.Linear rate of flow in above-mentioned loading, flushing and elution process should control between 50-200cm/h.
DEAE Sepharose FF elution peak 50mmol/L Acetic acid-sodium acetate, the CM Sepharose FF chromatographic column balanced with same damping fluid on pH4.5 damping fluid is rear with the dilution of the volume ratio of 1:10.First continue to rinse chromatographic column 1-3 column volume with level pad after completion of the sample, then with the 25mmol/L Acetic acid-sodium acetate containing 0.1-0.15mol/L NaCl, with the 25mmol/L Acetic acid-sodium acetate containing 0.5mol/LNaCl behind pH4.5 buffer solution elution removing major impurity peak, pH4.5 buffer solution elution collects target peak.Linear rate of flow in above-mentioned loading, flushing and elution process should control between 50-200cm/h.
Add dying method with coomassie brilliant blue with SDS-PAGE electrophoresis and detect with size-exclusion HPLC method the purity that above-mentioned CM Sepharose FF chromatographic column is separated the Interferon alfacon-1 80 site cysteine mutant obtained respectively, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 19426.17(reduced state), be that theoretical value is 19425.77 under 0.40(reduced state with theoretical value deviation).Determine that its specific activity is 6.7 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 8iU/mg, the specific activity contrasting the Interferon alfacon-1 that do not suddenly change is 5.2 × 10 8iU/mg.
Embodiment 3: the fermentation of Interferon alfacon-1 81 site cysteine mutant, purifying and detection
Actication of culture and shake-flask culture is carried out by the method for embodiment 2 by obtaining colibacillus engineering with the method structure of embodiment 1.Cultivate with the LB of the volume inoculum size inoculation 140L of 6% and carry out fermentation culture based in 200L fermentor tank, condition is as embodiment 2, but inducing culture temperature is 36 DEG C.The inducing culture time to after put centrifugal 20 minutes of tank room temperature 5000 revs/min and collect thalline, gained thalline with above-mentioned TE buffer solution twice to remove the major impurity in fermented liquid.
Get thalline 40g that above-mentioned process obtains add the above-mentioned TE damping fluid of 600ml with the mass volume ratio of 1:15 and then by volume the ratio of mass ratio 100:1 add N,O-Diacetylmuramidase process more than 4 hours, the broken liquid chamber temperature 6000 revs/min of gained abandons supernatant in centrifugal 20 minutes, precipitation adds TE damping fluid (the 50mmol/L Tris-HCl containing surfactant SDS with the mass volume ratio of 1:10, 5mmol/L EDTA, 0.3%SDS pH8.0) wash centrifugal twice after again with containing tensio-active agent TE buffer solution three times with remove respectively broken after the SDS that introduces in the impurity introduced in supernatant and washing process.
Gained 10g inclusion body with the mass volume ratio of 1:15 add 150ml containing after the 8mol/L urea of 5mmol/L mercaptoethanol under appropriate agitation condition denaturing treatment 4 hours, after inclusion body dissolves completely, room temperature 8000 revs/min abandons precipitation in centrifugal 20 minutes, and supernatant carries out renaturation process with on-column refolding method in room temperature.Concrete grammar is: sex change liquid first uses 50mol/L Tris-HCl after DEAE Sepharose FF post, 5mmol/L EDTA, 4M urea, pH8.0 eluant solution 3-5 column volume; Use 50mol/L Tris-HCl again, 5mmol/L EDTA, 2M urea, pH8.0 solution washing 3-5 column volume; Use 50mol/L Tris-HCl again, 5mmol/L EDTA, 1M urea, pH8.0 solution washing 3-5 column volume; Use 50mol/L Tris-HCl damping fluid again, 3mmol/L Sleep-promoting factor B, 1mmol/L reduced glutathion, 5mmol/L EDTA, 50mmol/L arginine, pH8.0 solution washing 5-8 column volume; Using 50mmol/L Tris-HCl, with the 50mmol/L Tris-HCl containing 0.3mol/L NaCl after pH8.0 solution flushing 3-5 column volume, pH8.0 eluant solution collects elution peak.Linear rate of flow in above-mentioned loading, flushing and elution process should control between 50-200cm/h.
The volume ratio that DEAE Sepharose FF elution peak presses 2:3 mixes with 50% ammonium sulfate (mass body volume concentrations), pH is regulated to be the 8.0 rear upper 50mmol/L Tris-HCl containing 20% ammonium sulfate, the Phenyl Sepharose6FF(Low sub of pH8.0 solution equilibria) chromatographic column, with containing the 50mmol/LTris-HCl of 20% ammonium sulfate, pH8.0 solution uses 50mmol/L Tris-HCl after rinsing post 3-5 volume, and pH8.0 eluant solution collects target peak.Linear rate of flow in above-mentioned loading, flushing and elution process should control between 50-200cm/h.If wash-out collect target peak be not used in follow-up polyethyleneglycol modified reaction and for preserve, then carry out changing solution-treated with the Millipore ultra-filtration centrifuge tube that molecular weight cut-off is 3000Da, buffered soln is made to be converted to 25mmol/L Acetic acid-sodium acetate containing 0.5mol/L NaCl, pH4.5 solution, the liquor capacity after conversion is substantially identical with before conversion.
Dying method with coomassie brilliant blue is added and size-exclusion HPLC method detects above-mentioned Phenyl Sepharose6FF(Low sub respectively with SDS-PAGE electrophoresis) purity of Interferon alfacon-1 81 site cysteine mutant that chromatographic column separation and purification the conversion buffered liquid of ultrafiltration obtain, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 19399.48(reduced state), with theoretical value deviation for theoretical value under-0.23(reduced state is 19399.71).Determine that its specific activity is 7.6 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 8iU/mg, the activity contrasting the Interferon alfacon-1 that do not suddenly change is 5.2 × 10 8iU/mg.
Embodiment 4: the fermentation of Interferon alfacon-1 82 site cysteine mutant, purifying and detection
Build the colibacillus engineering bacterial classification obtaining expressing Interferon alfacon-1 82 site cysteine mutant by the method that same embodiment 1 principle is identical, then carry out actication of culture and shake-flask culture by the method for embodiment 2.Cultivate with the LB of the volume inoculum size inoculation 50L of 4% and carry out fermentation culture after in 80L fermentor tank, condition is as embodiment 3, but inducing culture temperature is 36 DEG C.The inducing culture time to after put centrifugal 20 minutes of tank room temperature 5000 revs/min and collect thalline, gained thalline with above-mentioned TE buffer solution twice to remove the major impurity in fermented liquid.
Get the thalline 40g that above-mentioned process obtains and add 600ml above-mentioned TE damping fluid ball mill break process more than 2 hours with the mass volume ratio of 1:15, the broken liquid chamber temperature 6000 revs/min of gained abandons supernatant in centrifugal 20 minutes, precipitation adds TE damping fluid (the 50mmol/L Tris-HCl containing tensio-active agent TritonX-100 with the mass volume ratio of 1:10, 5mmol/L EDTA, 0.5%TritonX-100, pH8.0) after washing centrifugal twice again with containing tensio-active agent TE buffer solution three times with remove respectively broken after the SDS that introduces in the impurity introduced in supernatant and washing process.
Gained 10g inclusion body with the mass volume ratio of 1:15 add 150ml containing after the 8mol/L urea of 5mmol/L DTT under appropriate agitation condition denaturing treatment 4 hours, after inclusion body dissolves completely, room temperature 8000 revs/min abandons precipitation in centrifugal 20 minutes, the 25mmol/L Tris-HCl of supernatant successively to 10 times of volumes, 4mol/L urea, pH8.0 solution, 25mmol/L Tris-HCl, 2mol/L urea, pH8.0 solution, 25mmol/L Tris-HCl, 1mol/L urea, pH8.0 solution and 25mmol/L Tris-HCl, pH8.0 solution carries out dialysis treatment, gained permeate adds the 2mol/L Acetic acid-sodium acetate of 1/20 volume, again to the 25mmol/L Acetic acid-sodium acetate of 100 times of volumes after pH4.5 damping fluid, pH4.5 damping fluid carries out dialysis treatment more than 12 hours.
Permeate is used 25mmol/L Acetic acid-sodium acetate, the CM Sepharose FF chromatographic column of pH4.5 damping fluid balance.First continue to rinse chromatographic column 1-3 column volume with level pad after completion of the sample, then with the 25mmol/L Acetic acid-sodium acetate containing 0.1-0.15mol/L NaCl, with the 25mmol/L Acetic acid-sodium acetate containing 0.5mol/L NaCl behind pH4.5 buffer solution elution removing major impurity peak, pH4.5 buffer solution elution collects target peak.Linear rate of flow in above-mentioned loading, flushing and elution process should control between 50-200cm/h.
Add with SDS-PAGE electrophoresis the purity that dying method with coomassie brilliant blue and size-exclusion HPLC method detect the Interferon alfacon-1 82 site cysteine mutant that the separation and purification of above-mentioned CM Sepharose FF chromatographic column obtains respectively, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 19400.16(reduced state), be that theoretical value is 19399.71 under 0.45(reduced state with theoretical value deviation).Determine that its specific activity is 6.8 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 8iU/mg, the activity contrasting the Interferon alfacon-1 that do not suddenly change is 5.2 × 10 8iU/mg.
Embodiment 5: 25 DEG C of stability test results of Interferon alfacon-1 80-82 site cysteine mutant
Table 1 Interferon alfacon-1 80 site cysteine mutant 25 DEG C of stability test results
Table 2 Interferon alfacon-1 81 site cysteine mutant 25 DEG C of stability test results
Table 3 Interferon alfacon-1 82 site cysteine mutant 25 DEG C of stability test results
Embodiment 6: the mPEG-MAL of Interferon alfacon-1 80 site cysteine mutant modifies, product purification and detection
The buffered soln of the Interferon alfacon-1 80 site cysteine mutant obtained with the separation and purification of CM Sepharose FF filled column is the 25mmol/L Acetic acid-sodium acetate containing 0.5mol/L NaCl, pH4.5 solution, too low for pH modification reaction, and concentration also only has 0.2mg/ml, do not reach the requirement of modification reaction.Therefore before modification reaction, first concentrated and buffered soln conversion is carried out to it, the way taked is ultrafiltration process, process with the Millipore ultra-filtration membrane that molecular weight cut-off is 8000Da, rinse mutant on collection membrane with a small amount of 25mmol/L phosphoric acid salt pH7.2 solution after complete soln filters, make concentration reach 3.0mg/ml.
1) molecular weight is that the modification reaction of the mPEG-MAL of 20KDa is separated with modified outcome, detects
Get the mutant solution 50ml after above-mentioned concentrating, add by the mass ratio of 1:2 Jiankai Science and Technology Co., Ltd., Beijing's commercial mPEG-MAL strand modifier that 300mg molecular-weight average is 20KDa, put cold compartment of refrigerator and jolt reaction 18 hours with the speed of 10 revs/min on horizontal shaker.
Reaction times, pH4.5 solution dilution reaction solution (20 times of volume dilution), with termination reaction, then went up the CM650S filled column balanced with same damping fluid, and unmodified PEG modifier stream in loading process is worn to rear 1000ml25mmol/L Acetic acid-sodium acetate.With containing the 25mmol/L Acetic acid-sodium acetate of 60mmol/L NaCl, with the 25mmol/L Acetic acid-sodium acetate containing 0.2mol/L NaCl after pH4.5 eluant solution modifier impurity, pH4.5 eluant solution object modifier, finally with the 25mmol/L Acetic acid-sodium acetate containing 0.5mol/L NaCl, the not adorned Interferon alfacon-1 cysteine mutant of pH4.5 eluant solution.Loading in this sepn process, flushing and wash-out linear rate of flow should control between 40-150cm/h.
Add dying method with coomassie brilliant blue with SDS-PAGE electrophoresis and detect with size-exclusion HPLC method the purity being separated the polyethyleneglycol derivative obtained respectively, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 39431.24.Determine that its specific activity is 8.7 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 7iU/mg, activity is left 12.99%.
2) molecular weight is that the modification reaction of the mPEG2-MAL of 40KDa is separated with modified outcome, detects
The modifier mPEG2-MAL with branch's duplex structure utilizing the commercial molecular weight in Jiankai Science and Technology Co., Ltd., Beijing to be 40KDa modifies Interferon alfacon-1 80 site cysteine mutant, modification reaction condition, method and the modification reaction of the same 20KDa mPEG-MAL of modification after product separation method and being separated of modified outcome.
Add dying method with coomassie brilliant blue with SDS-PAGE electrophoresis and detect with size-exclusion HPLC method the purity being separated the polyethyleneglycol derivative obtained respectively, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 59558.77.Determine that its specific activity is 5.7 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 7iU/mg, activity is left 8.51%.
3) molecular weight is that the modification reaction of the mPEG-MAL of 10KDa is separated with modified outcome
Get the mutant solution 50ml after above-mentioned concentrating, add by the mass ratio of 1:2 the commercial strand mPEG-MAL in the Jiankai Science and Technology Co., Ltd., Beijing modifier that 300mg molecular-weight average is 10KDa, put cold compartment of refrigerator and jolt reaction 18 hours with the speed of 10 revs/min on horizontal shaker.
Reaction times, pH4.5 solution dilution reaction solution (20 times of volume dilution), with termination reaction, then went up the CM650S filled column balanced with same damping fluid, and unmodified PEG modifier stream in loading process is worn to rear 1000ml25mmol/L Acetic acid-sodium acetate.With containing the 25mmol/L Acetic acid-sodium acetate of 75mmol/L NaCl, with the 25mmol/L Acetic acid-sodium acetate containing 0.2mol/L NaCl after pH4.5 eluant solution modifier impurity, pH4.5 eluant solution object modifier, finally with the 25mmol/L Acetic acid-sodium acetate containing 0.5mol/L NaCl, the not adorned Interferon alfacon-1 cysteine mutant of pH4.5 eluant solution.Loading in this sepn process, flushing and wash-out linear rate of flow should control between 40-150cm/h.
Add dying method with coomassie brilliant blue with SDS-PAGE electrophoresis and detect with size-exclusion HPLC method the purity being separated the polyethyleneglycol derivative obtained respectively, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 29430.18.Determine that its specific activity is 2.0 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 8iU/mg, activity is left 29.85%.
4) molecular weight is that the modification reaction of the mPEG-MAL of 5KDa is separated with modified outcome, detects
Modify Interferon alfacon-1 80 site cysteine mutant with the Jiankai Science and Technology Co., Ltd., Beijing of 5KDa commercial mPEG-MAL strand modifier, the modification reaction of modification reaction condition, method and the same 10KDa mPEG-MAL of modification after product separation method is separated with modified outcome.
Add dying method with coomassie brilliant blue with SDS-PAGE electrophoresis and detect with size-exclusion HPLC method the purity being separated the polyethyleneglycol derivative obtained respectively, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 24428.75.Determine that its specific activity is 3.2 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 8iU/mg, activity is left 47.76%.
Embodiment 7: the mPEG-MAL of Interferon alfacon-1 81,82 site cysteine mutant modifies, product purification and detection
With Phenyl Sepharose6FF(Low sub) buffered soln of Interferon alfacon-1 81 site cysteine mutant that obtains of filled column separation and purification is 25mmol/L Tris-HCl, pH8.0 solution, meet the pH needed for modifying with mPEG-MAL, but concentration only has 0.2mg/ml, do not reach the requirement of modification reaction, therefore for modification reaction needs to carry out concentration to it, the way taked is chromatography.To use the 25mmol/L Tris-HCl of the NaCl containing 0.5mol/L after DEAE SepharoseFF filled column on this mutant solution, pH8.0 solution carries out wash-out and obtains the concentrated mutant solution that concentration reaches 5.0mg/ml.
The mutant solution 40ml got after above-mentioned concentrating adds by the mass ratio of 2:1 Jiankai Science and Technology Co., Ltd., Beijing's commercial mPEG-MAL strand modifier that 100mg molecular-weight average is 20KDa, and room temperature 25 DEG C jolts reaction 18 hours with the speed of 8 revs/min.
Reaction times is to rear 800ml25mmol/L Tris-HCl, pH8.0 solution dilution reaction solution (20 times of volume dilution) is with basic termination reaction, then go up the DEAE SepharoseFF filled column balanced with same damping fluid, unmodified PEG modifier stream in loading process is worn.With containing the 25mmol/LTris-HCl of 80mmol/L NaCl, with the 25mmol/L Tris-HCl containing 0.2mol/L NaCl after pH8.0 eluant solution modifier impurity, pH8.0 eluant solution object modifier, finally with the 25mmol/L Tris-HCl containing 0.5mol/L NaCl, the not adorned Interferon alfacon-1 cysteine mutant of pH8.0 eluant solution.
The linear rate of flow of the loading in above-mentioned concentrated, modified outcome sepn process, flushing, wash-out all should control between 50-200cm/h.
The Millipore ultra-filtration centrifuge tube that it is 3000Da that wash-out is collected containing the elution peak molecular weight cut-off of object modifier carries out changing solution-treated, buffered soln is made to be converted to 25mmol/L Acetic acid-sodium acetate containing 0.2mol/L NaCl, pH4.5 solution, the liquor capacity after conversion is substantially identical with before conversion.
Add dying method with coomassie brilliant blue and size-exclusion HPLC method with SDS-PAGE electrophoresis and detect above-mentioned separation and purification respectively and the purity of polyethyleneglycol derivative that obtains of the conversion buffered liquid of ultrafiltration, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 39402.27.Determine that its specific activity is 1.2 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 8iU/mg, activity is left 15.79%.
Use the same method and can prepare the mPEG-MAL(molecular weight 20KDa of Interferon alfacon-1 82 site cysteine mutant, strand) derivative, add dying method with coomassie brilliant blue with SDS-PAGE electrophoresis and size-exclusion HPLC method detects its purity respectively, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 39401.47.Determine that its specific activity is 8.6 × 10 with " interferon activity assay method " and " protein determination " that " Pharmacopoeia of People's Republic of China 2010 editions (three) " specify 7iU/mg, activity is left 12.65%.
Embodiment 8: 25 DEG C of stability test results of Interferon alfacon-1 80-82 site cysteine mutant mPEG-MAL modified outcome
Table 4 Interferon alfacon-1 80 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) modified outcome 25 DEG C of stability test results
Table 5 Interferon alfacon-1 80 site cysteine mutant mPEG-MAL(molecular weight 10KDa, strand) modified outcome 25 DEG C of stability test results
Table 6 Interferon alfacon-1 81 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) modified outcome 25 DEG C of stability test results
Table 7 Interferon alfacon-1 82 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) modified outcome 25 DEG C of stability test results
Embodiment 9: the pharmacokinetic trial of Interferon alfacon-1 80-82 site cysteine mutant and mPEG-MAL modified outcome thereof
Get the SD rat 48 that body weight is about 300g, be divided into 8 groups, often organize 6, male and female half and half.Group 1 to group 8 subcutaneous single injection Interferon alfacon-1 80 site cysteine mutant respectively, Interferon alfacon-1 81 site cysteine mutant, Interferon alfacon-1 82 site cysteine mutant, Interferon alfacon-1, Interferon alfacon-1 80 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 80 site cysteine mutant mPEG-MAL(molecular weight 10KDa, strand) mono-modified product, Interferon alfacon-1 81 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 82 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, respectively at 0, 0.2, 0.5, 0.75, 1, 2, 4, 8, 12, 24, 48, 72, 96, within 168 hours, blood is got on eyeground, wherein interferon biological activity is measured after collected by centrifugation serum.The main pharmacokinetic parameter as shown in following table 8 and table 9 is obtained by measurement result mean value calculation.
The main pharmacokinetic parameter obtained is calculated after table 8SD rat single subcutaneous injection Interferon alfacon-1 cysteine mutant or Interferon alfacon-1
The main pharmacokinetic parameter obtained is calculated after table 9SD rat single subcutaneous injection Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative
Embodiment 10: the acute toxicity test in mice of Interferon alfacon-1 80-82 site cysteine mutant mPEG-MAL modified outcome
Get the mouse 60 that body weight is about 20g, be divided into 5 groups, often organize 12.Group 1 to group 5 subcutaneous single injection Interferon alfacon-1, Interferon alfacon-1 80 site cysteine mutant mPEG-MAL(molecular weight 20KDa respectively, strand) mono-modified product, Interferon alfacon-1 80 site cysteine mutant mPEG-MAL(molecular weight 10KDa, strand) mono-modified product, Interferon alfacon-1 81 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 82 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand).Continuous Observation 14 days after injection, except group 1 has 4 dead mouses, other groups do not show any abnormalities performance, show that the maximum tolerated dose of mouse to Interferon alfacon-1 80-82 site cysteine mutant mPEG-MAL modified outcome is all at more than 6.4mg/Kg, is equivalent to 3840 times of people's quantity.Interferon alfacon-1 80-82 site cysteine mutant mPEG-MAL modified outcome significantly improves compared with the security of Interferon alfacon-1.

Claims (7)

1. consensus interferon mutant, it is characterized in that the amino acid mutation of the 81st by counting from N end in Interferon alfacon-1 aminoacid sequence is halfcystine, aminoacid sequence is as shown in SEQ ID No.2.
2. the polyethyleneglycol derivative of consensus interferon mutant according to claim 1, it is characterized in that described polyethyleneglycol derivative to be connected with polyethyleneglycol modified dose by described consensus interferon mutant to obtain, the molecular weight of described polyethyleneglycol modified dose is between 5KDa-40KDa.
3. polyethyleneglycol derivative according to claim 2, it is characterized in that described polyethyleneglycol modified dose is mercapto-polyglycol modifier, is selected from the one in maleimide PEG modifier, ethene sulfuryl PEG modifier, iodo-acid amide PEG modifier or adjacent pyridyl disulfide PEG modifier.
4. polyethyleneglycol derivative according to claim 2, is characterized in that the described molecular weight of polyethyleneglycol modified dose is between 10KDa-20KDa.
5., according to the preparation method of the polyethyleneglycol derivative one of claim 2-4 Suo Shu, comprise the steps:
1) the described consensus interferon mutant solution that preparation is concentrated, makes its concentration reach 2.0-20mg/ml, and makes the buffer solution system residing for described consensus interferon mutant be converted to the suitable buffer solution system carrying out polyethyleneglycol modified reaction;
2) concentrated consensus interferon mutant solution obtained above is contacted with described polyethyleneglycol modified dose carry out modification reaction;
3) chromatographic separation and purification is carried out to the mixture obtained after modification reaction, polyethyleneglycol modified dose that wherein has neither part nor lot in modification reaction with removing and the consensus interferon mutant had neither part nor lot in described in modification reaction, and removing is connected with the Interferon alfacon-1 polyethyleneglycol derivative of multiple peg molecule.
6. pharmaceutical composition, is characterized in that containing treatment significant quantity and the described polyethyleneglycol derivative of one of claim 2-4 of safe dose, and pharmaceutically acceptable carrier of sufficient quantity.
7. the purposes in the medicine of preparation treatment virus disease according to the consensus interferon mutant one of claim 1-4 Suo Shu or its polyethyleneglycol derivative.
CN201310468202.4A 2012-02-23 2012-02-23 Interferon alpha mutant and polyethylene glycol derivative thereof Active CN103554246B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310468202.4A CN103554246B (en) 2012-02-23 2012-02-23 Interferon alpha mutant and polyethylene glycol derivative thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310468202.4A CN103554246B (en) 2012-02-23 2012-02-23 Interferon alpha mutant and polyethylene glycol derivative thereof

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN2012100433850A Division CN102584980B (en) 2012-02-23 2012-02-23 Interferon alpha mutant and polyethylene glycol derivative thereof

Publications (2)

Publication Number Publication Date
CN103554246A CN103554246A (en) 2014-02-05
CN103554246B true CN103554246B (en) 2015-04-01

Family

ID=50008636

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310468202.4A Active CN103554246B (en) 2012-02-23 2012-02-23 Interferon alpha mutant and polyethylene glycol derivative thereof

Country Status (1)

Country Link
CN (1) CN103554246B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104711239A (en) * 2013-12-12 2015-06-17 北京百川飞虹生物科技有限公司 PEG modified methyl parathion hydrolase (MPH) and application thereof

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1531600A (en) * 2001-03-30 2004-09-22 ˹��������ͼ˹�����µ� New polynucleotides and polypeptides of IFN 2-21 gene
CN1738640A (en) * 2002-11-18 2006-02-22 马克西根公司 Interferon-alpha polypeptides and conjugates
CN1970572A (en) * 2006-12-21 2007-05-30 北京三元基因工程有限公司 Interferon alpha mutant and its polyethylene glycol derivative
CN101921329A (en) * 2010-04-19 2010-12-22 北京三元基因工程有限公司 Alpha interferon mutant and polyethylene glycol derivative thereof

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN1531600A (en) * 2001-03-30 2004-09-22 ˹��������ͼ˹�����µ� New polynucleotides and polypeptides of IFN 2-21 gene
CN1738640A (en) * 2002-11-18 2006-02-22 马克西根公司 Interferon-alpha polypeptides and conjugates
CN1970572A (en) * 2006-12-21 2007-05-30 北京三元基因工程有限公司 Interferon alpha mutant and its polyethylene glycol derivative
CN101921329A (en) * 2010-04-19 2010-12-22 北京三元基因工程有限公司 Alpha interferon mutant and polyethylene glycol derivative thereof

Also Published As

Publication number Publication date
CN103554246A (en) 2014-02-05

Similar Documents

Publication Publication Date Title
CN101547935B (en) Interferon alpha mutant and its polyethylene glycol derivative
CN101921329B (en) Alpha interferon mutant and polyethylene glycol derivative thereof
CN101514229B (en) Human interferon alpha derivative and polyethylene glycol modified substance thereof
CN103923209B (en) A kind of Lambda interferon mutant and polyethyleneglycol derivative
CN105037523B (en) Interferon mutant and its polyethyleneglycol derivative
CN102286490B (en) Preparation and renaturation method of chicken interferon gamma
CN101280001B (en) Preparation of human SDF-1 alpha, human SDF-1 alpha obtained therefrom and use thereof
CN103554246B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN103145826B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN103288947B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN102453089A (en) Preparation and application of recombinant consensus interferon mutant polyethylene glycol conjugate
CN102532300B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN105085658B (en) Interleukin 29 mutant and polyethylene glycol derivative
CN103467592B (en) Interferon alpha mutant and polyethylene glycol derivate thereof
CN103288948B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN102584980B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN103113465B (en) Interferon-alpha mutant and polyethylene glycol derivative thereof
CN103288949B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN102558337B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN102532299B (en) Interferon alpha mutant and polyethylene glycol derivative thereof
CN102584981B (en) Mutant of interferon alpha and polyethylene glycol derivatives of mutant
CN103641905B (en) Interferon alpha1b mutant and fusion protein containing interferon alpha1b and human serum albumin
CN105085657A (en) Interferon mutant and polyethylene glycol derivative
CN101352573A (en) Recombinant human granulocyte colony stimulating factor lysine defect body modified by polyethyleneglycol

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C56 Change in the name or address of the patentee
CP01 Change in the name or title of a patent holder

Address after: 102600 Beijing City, Daxing District Daxing Industrial Development Zone Jinyuan Road No. 1

Patentee after: BEIJING TRI-PRIME GENE PHARMACEUTICAL CO., LTD.

Address before: 102600 Beijing City, Daxing District Daxing Industrial Development Zone Jinyuan Road No. 1

Patentee before: Beijing Sanyuan Gene Engineering Co., Ltd.