CN103145826B

CN103145826B - Interferon alpha mutant and polyethylene glycol derivative thereof

Info

Publication number: CN103145826B
Application number: CN201310069953.9A
Authority: CN
Inventors: 周敏毅; 刘金毅; 程永庆
Original assignee: BEIJING SANYUAN GENE ENGINEERING Co Ltd
Current assignee: BEIJING TRI-PRIME GENE PHARMACEUTICAL CO., LTD.
Priority date: 2012-02-23
Filing date: 2012-02-23
Publication date: 2014-05-28
Anticipated expiration: 2032-02-23
Also published as: CN103145826A

Abstract

The invention belongs to the field of biological medicines and relates to a composite interferon cysteine mutant and a polyethylene glycol derivative thereof, a preparation method and a medicinal composition of the polyethylene glycol derivative and an application of the two in preparing a medicine for treating viral diseases. The composite interferon cysteine mutant is obtained by mutating the amino acid on the 77th site from the N-terminal in the amino acid sequence of the composite interferon into cysteine; and the polyethylene glycol derivative of the composite interferon cysteine mutant is obtained by connecting the composite interferon cysteine mutant with a polyethylene glycol modifier, wherein the molecular weight of the polyethylene glycol modifier is 5-40KDa. The composite interferon cysteine mutant and the polyethylene glycol derivative thereof provided by the invention have high bioactivity, good pharmacological action and stability and reliable safety.

Description

Interferon alpha mutant and polyethyleneglycol derivative thereof

The application is to be on February 23rd, 2012 applying date, and application number is 201210043689.7, and denomination of invention is the divisional application of " interferon alpha mutant and polyethyleneglycol derivative thereof ".

Technical field

What the present invention was general relates to interferon alpha mutant, its polyethyleneglycol derivative, the latter's preparation method, pharmaceutical composition and both purposes in the medicine of preparation treatment virus disease, relate to especially Interferon alfacon-1 cysteine mutant, its polyethyleneglycol derivative, the latter's preparation method, pharmaceutical composition and both purposes in the medicine of preparation treatment virus disease.

Background technology

Interferon, rabbit (interferon, IFN) be a kind of cytokine class medicine with broad-spectrum disease resistance toxic action being produced by animal body at first, produce according to it that position is different from the mechanism of action can be divided into the type that α, β, γ, λ etc. are large, and every kind of large type can be divided into some little hypotypes, in same large type, between different hypotype, in primary structure, difference is very little, very approaching on the above higher structure of secondary.In several large types, α type is most widely used one, and this kind of Interferon, rabbit of clinical application at present mainly comprises interferon alpha 2a, interferon alpha 2 b, Interferon α1 b, Interferon alfacon-1 etc.Wherein Interferon alfacon-1 (consensus interferon or integrated interferon) carries out after sequence alignment at the alpha-interferon to known, the amino acid the highest frequency of occurrences is assigned to corresponding position separately, and the artificial design alpha-interferon of the alpha-non-natural amino acid sequence obtaining after being modified in indivedual positions, comprise the molecule of multiple amino acids sequence, but homology is high to each other, it is more than 10 times that their biologic activity is natural alpha-interferon.

Although various alpha-interferons are being brought into play curative effect more and more widely in the process of current treatment viral infection disease, but himself poor stability, short feature of transformation period have also limited its further clinical application, bring some troubles to patient's medication.Given this reason, fundamental research and the product development of a lot of long-acting interferons aspect are carried out both at home and abroad, comprise interferon molecule self is transformed, researched and developed and comprise the fusion rotein of interferon molecule aminoacid sequence, interferon molecule is carried out chemically modified, selects suitable drug delivery system to optimize to carry in the body of interferon molecule with drug effect performance process etc., wherein the listing of polyethylene glycol modified interferon (belonging to the Interferon, rabbit of chemically modified) is the maximum success obtaining in this field.

Polyoxyethylene glycol (polyethelene glycol, PEG) be a kind of linear polymer, due to the parents characteristic of its good biocompatibility and not only hydrophilic but also close ester, being able to show one's talent from numerous chemical modifiers becomes the modifier of current research and most widely used protein and peptide drugs.Through years of researches exploitation, the interferon alpha product that existing two PEG modify at present successfully goes on the market, respectively the interferon alpha 2a(commodity " Pai Luoxin " by name of the interferon alpha 2 b (commodity " the happy energy of wearing " by name) of the PEG modification of U.S.'s Schering Plough (Schering-Plough) company (now being purchased by MSD Corp.) and the PEG modification of Switzerland's Roche (Roche) company),, entered inland of China in 2003 simultaneously and sell in U.S.'s listing respectively at calendar year 2001 and 2002.The interferon alpha 2 b of modifying about the PEG of Schering Plough company is described to some extent its formula composition in Chinese patent application CN00808452.1; The interferon alpha 2a that the PEG of Roche Holding Ag modifies has a detailed description in Chinese patent CN97113049.3.In addition, the interferon alpha product that also has more PEG to modify is is researched and developed, and what wherein approach most the listing stage is the Interferon alfacon-1 of the PEG modification of Intermune company exploitation.

Making a general survey of the development of PEG modified interferon α technology, is mainly the development that is accompanied by PEG modification technique.Early stage research and development is mainly around non-specific site PEG modification technique, the modified derivatives that selected PEG modifier purity is low, molecular weight is little (generally below 10KDa) and distribution range is wide, decorating site kind and quantity many and form are unstable, cause that modified outcome composition heterogeneity, purity relatively low (85% left and right), quality control are difficult for realizing, long-acting is not obvious and still have certain toxic side effect.The interferon alpha 2 b product that the PEG of above-mentioned Schering Plough company modifies just belongs to this type.There is specificity site PEG modification technique in the development that is accompanied by PEG modifier, because the purity of selected PEG modifier has obtained large increase, molecular weight can reach 20KDa above and significantly constriction of distribution range, and the improvement of modifying mechanism reduces decorating site kind and quantity, the modified derivative stability forming improves, thereby makes the shortcoming of above-mentioned non-specific site PEG modification technique obtain improving significantly.

Specificity site PEG modification technique can be divided into again three types, and a kind of is to modify target protein molecule with the PEG modifier with branched structure, reaches the object that reduces decorating site quantity by the stronger space steric effect of branched structure PEG modifier.The interferon alpha 2a product that the PEG of above-mentioned Roche Holding Ag modifies just belongs to this type.But because this so-called " specificity site " modification technique can not accomplish only to modify the amino acid of single kind from modifying mechanism, can not accomplish only to modify the amino acid in single site, so the kind of decorating site and number are still numerous, as Chinese patent CN200380103341.1 discloses the PEG modified interferon α 2a product " Pai Luoxin " that interferon alpha 2a(that branched structure PEG modifies comprises Roche Holding Ag) there is the isomer of 12 decorating sites.

The second is the amino acid whose free alpha-amino group of modifying protein molecule N-terminal, principle is to have lower pKa value compared with the free epsilon-amino of Methionin in other site of free alpha-amino group and protein of protein N end amino acid, can under lower pH, with amido modified dose, modification reaction occur.But because the specificity of this pH selective reaction is not too high, even if still can there is the modification reaction on the free epsilon-amino of Methionin under lower pH, and modification may be covered the avtive spot of protein molecule, cause modified outcome activity greatly to reduce, therefore this modification technique is also restricted in actual applications.

The third is with the sulfydryl on thiol modifier modifying protein molecule halfcystine, because the halfcystine quantity in protein molecule is little, and the sulfydryl on most halfcystines is used to form in molecule or intermolecular disulfide bond, only have few free sulfhydryl groups can supply to modify, so the specificity of this modification reaction is very high.As Chinese patent application CN200510076676.X discloses the Interferon α1 b that a kind of sulfydryl PEG modifier is modified, utilize and in Interferon α1 b molecule, only had the feature sulfydryl PEG modifier of a free sulfhydryl group to modify it.But this kind of actual greatest problem of expanding application of technology is in natural protein molecule, to there is no free cysteine residues, even if there is also the protein sterling that can be used in because very significantly affecting the stability of protein molecule and purge process (easily forming in molecule or intermolecular disulfide bond) modification be difficult to obtain, make modification cannot realize (once because form in molecule or intermolecular disulfide bond just do not have can be for the free cysteine of modifying); And the halfcystine of selecting natural site is modified the avtive spot that may cover equally protein molecule, cause modified outcome activity greatly to reduce.The Interferon α1 b that above-mentioned PEG modifies is just also lower because of activity residual rate after the lower biological activity of Interferon α1 b self and modification, thereby makes final PEG modified outcome activity lower, and practical application effect needs to be proved.

Interferon alpha kind hypotype is numerous in addition, in sequence, having many sites can, for changing to produce active higher mutation disturbance element α product, be 0 times of above Interferon alfacon-1 molecule of native sequences Interferon α1 as U.S. Pat 4695623, US4897471, US5372808 disclose a kind of activity.Select the plain α of mutation disturbance that active high, good stability and toxicity are low to carry out PEG modification so also can utilize this feature of interferon alpha, to improve or to improve drug effect, medicine generation and the security of modified outcome, the Interferon alfacon-1 that the PEG of aforementioned Intermune company modifies just belongs to this type, and and for example Chinese patent application CN02159951.3 also discloses the Interferon alfacon-1 that a kind of branched structure PEG modifier is modified.But this kind of technology of single utilization still can not solve that modified outcome composition heterogeneity, purity difference, quality control are difficult for realizing, long-acting is not obvious and still have the problem of certain toxic side effect.

Summary of the invention

Primary and foremost purpose of the present invention is to provide a kind of cysteine mutant of Interferon alfacon-1, in existing interferon alpha, do not have the free cysteine residues can be undesirable for the free cysteine residues site that specificity site sulfydryl PEG modifier is modified or institute has or suddenly change to solve, cause that protein molecule is unstable, activity is low, separation and purification is difficult and be unfavorable for the problem of specificity site PEG modifier modification.

For realizing this object, in basic embodiment, the cysteine mutant of Interferon alfacon-1 of the present invention is halfcystine by the amino acid mutation of one of 75-77 position of counting from N end in Interferon alfacon-1 aminoacid sequence, has respectively the aminoacid sequence shown in SEQ ID No.1-3.

The present invention select by the amino acid mutation one of from 75-77 position of N end meter in Interferon alfacon-1 aminoacid sequence be halfcystine based on molecular computer space structure before and after sudden change predict the outcome, known interferon alpha and receptors bind principle and interferon alpha 2a that oneself knows and the space structure of interferon alpha 2 b.

In order to obtain Interferon alfacon-1 cysteine mutant, need to successively express the genetic engineering bacterium of Interferon alfacon-1 cysteine mutant molecule or the fermentation of structure, genetic engineering bacterium or genetically engineered cell of genetically engineered cell and the purifying of tunning, preferably express the purifying of structure, fermentation and the tunning of the colibacillus engineering of Interferon alfacon-1 cysteine mutant molecule.

In the building process of genetic engineering bacterium or genetically engineered cell, first need to obtain and increase and express the gene of Interferon alfacon-1 cysteine mutant, the method adopting preferably well known to a person skilled in the art PCR method, and is more preferably the known overlapping extension PCR method of those skilled in the art.After a large amount of genes that obtain expression Interferon alfacon-1 cysteine mutant, select suitable carrier, build recombinant vectors thereby the gene of expressing Interferon alfacon-1 cysteine mutant is proceeded to described carrier by the method that well known to a person skilled in the art structure recombinant vectors.Described carrier and recombinant vectors preferred plasmid carrier, this plasmid vector should have the single restriction enzyme site separately of one or more groups pair of enzyme, and suitable corresponding Host Strains or the host cell of being proceeded to.

Then first prepare competent Host Strains or host cell, recycling electroporation, PEG method etc. well known to a person skilled in the art that method proceeds to recombinant vectors genetic engineering bacterium or the genetically engineered cell of Host Strains or constructing host cell expression Interferon alfacon-1 cysteine mutant.The preferred intestinal bacteria of described Host Strains or host cell, pichia spp and Chinese hamster ovary celI, and more preferably intestinal bacteria.

The fermentation of engineering bacteria or engineering cell should be selected the conditions such as substratum composition, pH, temperature, air flow, incubation time and the feed supplement operation of suitable its growth.For the fermentation of colibacillus engineering, preferably LB substratum, temperature in culturing process is controlled between 30-37 ℃, pH is controlled between 6.0-8.0 and (selects if desired pH adjusting agent control pH, described pH adjusting agent includes but not limited to NaOH, ammoniacal liquor and various organic nitrogen source, preferably ammoniacal liquor), air flow should meet growth needs and the synthetic needs of Product Expression of thalline or cell, incubation time is relevant to the mode of feed supplement operation, is between 6-48 hour in the case of taking incubation time suitable feed supplement operational condition.

If Interferon alfacon-1 cysteine mutant albumen is expressed in engineering bacteria or engineering cell, need to carry out break process to discharge Interferon alfacon-1 cysteine mutant albumen wherein to thalline or the cell of fermentation culture results.And for the engineering bacteria of the protokaryons such as intestinal bacteria, more need break process to discharge the Interferon alfacon-1 cysteine mutant albumen of expressing with inclusion body form.Conventional breaking method is including, but not limited to ultrasonic disruption, ball mill fragmentation, N,O-Diacetylmuramidase processing etc.

For the Interferon alfacon-1 cysteine mutant albumen of expressing with inclusion body form, the thick inclusion body that need to obtain break process carries out washing operation to remove as far as possible the foreign protein such as a small amount of tropina, membranin wherein containing.The damping fluid using in washing process is including, but not limited to Tris-HCl, PB, and the pH value of washing process should be controlled between 7.0-9.0.In order to dissolve more insoluble hydrophobic protein impurity, can in lavation buffer solution, add a certain amount of salt, that conventional is NaCl, concentration range is between 0.05-0.5mol/L; For the stronger membranin of solubilizing hydrophobic, can in lavation buffer solution, add a certain amount of tensio-active agent, this type of conventional tensio-active agent includes but not limited to tween-80, sodium laurylsulfonate (SDS), TritonX-100, and concentration is between 0.01-5%.

Because thalline in shattering process or cell can discharge some proteolytic ferments, thereby likely degrade Interferon alfacon-1 cysteine mutant, therefore need in the washing process in shattering process and after fragmentation, add some materials to suppress the activity of these proteolytic ferments, the most direct method is to add proteinase inhibitor, as trypsin inhibitor, round-about way also can add metal ion chelation agent, as EDTA because metal ion chelation agent can chelating these proteolytic ferments performance hydrolytic actiones institutes must dependence metal ion.

The inclusion body sex change that washing obtains is dissolved can use the urea of 7-10mol/L or the Guanidinium hydrochloride of 5-8mol/L, also need if desired to add sulfhydryl reagent to improve the dissolving effect of denaturing agent, described sulfhydryl reagent is including, but not limited to mercaptoethanol, dithiothreitol (DTT).The mass/volume of dissolving inclusion body/denaturing agent of adopting can be at 1:3 between 1:50 than (g/ml), preferably at 1:5 between 1:30, best at 1:7 between 1:20.Sex change dissolution time should be more than 2 hours.

Renaturing inclusion bodies can adopt dilution refolding method, dialysis renaturation method or on-column refolding method.Dilution refolding method be by a step or multistep dilution renaturation solution by the concentration dilution of denaturing agent below 0.5mol/L, so that protein molecule renaturation gradually in the situation that breaking away from denaturing agent and affecting; Dialysis renaturation method is with 10 times of renaturation solutions with upper volume, sex change liquid to be dialysed so that the concentration of denaturing agent is reduced to below 0.5mol/L, plays equally the effect of renaturation; On-column refolding method is that sex change liquid is directly gone up to ion-exchange, hydrophobic, size-exclusion (gel) chromatographic column, then with carrying out the Isolation and purification and renaturation of gradient elution with while realize target albumen containing the elute soln that constantly reduces denaturing agent concentration.

The essentially consist of renaturation solution is the buffered soln of pH between 5.0-10.0, with the basic alkaline environment that guarantees that renaturation is required, can meet the buffered soln of this requirement including, but not limited to Tris-HCl, sodium borate buffer liquid.In order to prevent that in renaturation process, renaturation excessive velocities forms disulfide linkage mispairing, need in renaturation solution, add some oxidized forms and the reduced form sulfhydryl reagent redox equilibrium system material to composition, as the redox equilibrium system of Sleep-promoting factor B and reduced glutathion composition.Simultaneously for prevent renaturation excessive velocities cause protein folding not exclusively, disulfide linkage mispairing, can in the renaturation solution of above-mentioned essentially consist, add some other materials, as arginine, EDTA, metal ion and various molecular chaperones materials etc.The selection of these materials and dosage have a lot of reports in the prior art, repeat no more here.

The renaturation solution that above-mentioned dilution refolding method and dialysis renaturation method obtain, and the centrifugal supernatant of the Interferon alfacon-1 cysteine mutant that contains soluble form expression directly obtaining by fragmentation, and the centrifugal supernatant of fermentation culture of the Interferon alfacon-1 cysteine mutant of expressing with soluble form, all need to carry out further chromatographic separation and purification.Utilize Interferon alfacon-1 cysteine mutant molecule and the impurity molecule difference on affine character, charge property, hydrophobic property, molecular size range can successively select one or more the combination in affinity chromatography, ion-exchange chromatography, hydrophobic chromatography, gel separation chromatography to carry out purifying.In order better to reach centrifugation, before chromatographic separation and purification, can treat parting liquid and carry out concentration, the method that can select including, but not limited to anti-molten after organic solvent deposit, anti-molten after saltouing, polyoxyethylene glycol concentrated, ultrafiltration and chromatography etc.

The Interferon alfacon-1 cysteine mutant molecule that chromatographic separation and purification obtains can be with well known to a person skilled in the art that SDS-PAGE electrophoresis adds coomassie brilliant blue staining method or high performance liquid chromatography is determined purity; Determine molecular weight by mass spectroscopy; With " interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " appendix part regulation, determine the specific activity of Interferon alfacon-1 cysteine mutant divided by protein concn to measure the interferon activity obtaining.

Wherein high performance liquid chromatography purity detecting method can adopt reversed-phased high performace liquid chromatographic or size-exclusion high performance liquid chromatography, but preferred size-exclusion high performance liquid chromatography is more convenient, accurate, quick because being this kind of method.While adopting size-exclusion high performance liquid chromatography, require the number of theoretical plate of chromatographic column to be greater than 10000, applied sample amount is between 5-100 μ l, and preferably, between 10-50 μ l, the chromatographic separation time is 3 times of main peak appearance time.

Study on the stability is Interferon alfacon-1 cysteine mutant solution that chromatographic separation and purification is obtained under the environment of 20-45 ℃ long-term storage 3-6 month, in this process, regularly the variation of outward appearance is observed in sampling, and detects the variation of the major quality controlling such as purity, activity index.

The Interferon alfacon-1 cysteine mutant molecule that chromatographic separation and purification obtains also needs to carry out animal drugs for test evaluation and animal acute toxicity test evaluation.

In a preferred embodiment, Interferon alfacon-1 cysteine mutant of the present invention will be halfcystine from the amino acid mutation of the 75th of N end meter in Interferon alfacon-1 aminoacid sequence, and it has the aminoacid sequence shown in SEQ ID No.1.

In a preferred embodiment, Interferon alfacon-1 cysteine mutant of the present invention will be halfcystine from the amino acid mutation of the 76th of N end meter in Interferon alfacon-1 aminoacid sequence, and it has the aminoacid sequence shown in SEQ ID No.2.

In a preferred embodiment, Interferon alfacon-1 cysteine mutant of the present invention will be halfcystine from the amino acid mutation of the 77th of N end meter in Interferon alfacon-1 aminoacid sequence, and it has the aminoacid sequence shown in SEQ ID No.3.

Second object of the present invention is to provide the polyethyleneglycol modified derivative of Interferon alfacon-1 cysteine mutant as above, and to solve, existing interferon alpha polyethyleneglycol derivative composition heterogeneity, purity actives are low, quality control is difficult for realizing or long-acting is not obvious and still have the problem of certain toxic side effect.

For realizing this object, in basic embodiment, polyethyleneglycol derivative of the present invention is connected and obtains with polyethyleneglycol modified dose by described Interferon alfacon-1 cysteine mutant, and the described molecular weight of polyethyleneglycol modified dose is between 5KDa-40KDa.

In a preferred embodiment, described polyethyleneglycol modified dose is mercapto-polyglycol modifier, is selected from the one in maleimide PEG modifier, ethene sulfuryl PEG modifier, iodo-acid amide PEG modifier or adjacent pyridyl disulfide PEG modifier.

Mainly be subject to the impact of the factor such as kind, temperature, protein concn, pH, protein/modifier quality/mol ratio, stirring velocity, additive and modification reaction time of modifier for obtaining PEG modification reaction that described polyethyleneglycol derivative carries out.

For the PEG modifier of specificity site sulfydryl modification according to PEG activating group the different maleimide PEG modifier (mPEG-maleimide that mainly contain from modification reaction mechanism, mPEG-MAL), ethene sulfuryl PEG modifier (mPEG-vinylsulfone, mPEG-VS), iodo-acid amide PEG modifier (mPEG-iodoacetamide, mPEG-IA) with adjacent pyridyl disulfide PEG modifier (mPEG-orthopyridyl disulfide, mPEG-OPSS), structure (mainly provides the structure of activating group respectively as follows as example arrangement, but activating group is not limited to a mPEG and is connected).

Maleimide PEG modifier:

Ethene sulfuryl PEG modifier:

Iodo-acid amide PEG modifier:

Adjacent pyridyl disulfide PEG modifier:

The mechanism that the above two modify sulfydryl is, with sulfydryl, two key addition reactions occur, and the mechanism that both modify sulfydryl is afterwards and sulfydryl generation disulfide linkage replacement(metathesis)reaction.Wherein preferably use mPEG-MAL, because it has speed of response faster, even under acidic conditions, also can carry out modification reaction.The molecular weight of PEG modifier can be between 5KDa-40KDa, but because low-molecular-weight PEG modifier is not obvious to extending the effect of interferon alpha transformation period, after the PEG modifier modified interferon α of high molecular, make its biological activity decline serious, therefore the molecular weight of preferred PEG modifier is between 10KDa-20KDa.

In modification, improve the speed that temperature can improve modification reaction, but also can accelerate hydrolysis or the oxidation rate of modifier simultaneously, also be unfavorable for the stable of Interferon alfacon-1 cysteine mutant, therefore suitable modification reaction temperature is 2-40 ℃, preferred modification reaction temperature is 2-25 ℃, and optimum modification reaction temperature is 2-10 ℃.

In modification, improve the speed that protein concn can improve modification reaction, but be unfavorable for the stable of protein, therefore the concentration of suitable Interferon alfacon-1 cysteine mutant is 2-20mg/ml, and preferred concentration is 1-10mg/ml, and optimum concentration is 2-5mg/ml.

In order to reach this protein concn, need to concentrate Interferon alfacon-1 cysteine mutant, also can pH and buffered soln be transformed into required simultaneously.That conventional concentration method includes but not limited to is anti-molten after organic solvent deposit, anti-molten after saltouing, ultrafiltration, polyoxyethylene glycol are concentrated, chromatographic separation etc.

The pH needing in modification is relevant with the mechanism of modification reaction, pH when mPEG-MAL modifies as mentioned before can be lower, even can arrive acid range, and the pH of mPEG-VS while modifying must be medium-sized or alkaline, but all more suitable modification reactions of the weakly alkaline environment of 7.0 – 9.0 in general.The pH of modification during lower than this pH scope modification reaction speed slower; Although and modification reaction speed is fast during higher than this pH scope, Interferon alfacon-1 cysteine mutant is unstable, easily forms intermolecular disulfide bond and significantly reduce the total amount of modifiable Interferon alfacon-1 cysteine mutant molecule.

In modification, raising or reduction protein/modifier quality or mol ratio all can improve speed of response.From improving the angle of PEG modifier utilization ratio consider the to increase input amount of Interferon alfacon-1 cysteine mutant of reaction, from improving the angle of Interferon alfacon-1 cysteine mutant transformation efficiency consider should the to increase input amount of PEG modifier of reaction, specifically how to process and should determine that (utilization ratio of paying the utmost attention to modifier is still paid the utmost attention to the utilization ratio of protein depending on particular case, depend on to a great extent both cost ratios), but generally suitable ratio should be between 1:8 – 8:1, preferred ratio is between 1:4 – 4:1, optimum ratio is between 1:2 – 2:1.

In modification, increase to stir and can improve the speed of modification reaction, especially for from modifying the slower modification reaction of mechanism speed of response.But too fast stirring is unfavorable to stablizing of protein, also cannot further accelerate the speed of modification reaction simultaneously, therefore suitable modification reaction stirring velocity is between 0-40 rev/min, and preferred speed is between 1-20 rev/min, and optimum speed is between 2-10 rev/min.

In modification, add Cucumber or in protein buffer solution, exist Cucumber also can affect the speed of modification reaction, as add the tensio-active agent of some type or in protein buffer solution, have the NaCl of high density, but specifically affect rule owing to adding and existing substance classes numerous, can select concentration range wide, so can not be discussed, need particular problem specifically to study without exception.

The time of modification reaction is all relevant with above-mentioned each influence factor, in general extending the modification reaction time all can improve modification reaction yield, but the time exceed a certain threshold value after this rule can become not obvious, and also can be unfavorable to stablizing of Interferon alfacon-1 cysteine mutant, can reduce the economic benefit of reaction process, therefore the preferred time, the optimum time was between 1 – 12 hours between 0.5 – 24 hours between 0.5 – 48 hours the suitable modification reaction time.

Modification reaction contains in modification reaction mixture after stopping and has neither part nor lot in the Interferon alfacon-1 cysteine mutant that Interferon alfacon-1 cysteine mutant that the PEG modifier of modification reaction, not adorned Interferon alfacon-1 cysteine mutant, unit point modify and a small amount of multidigit point are modified in principle, must remove Interferon alfacon-1 cysteine mutant that unit point PEG modifies composition in addition by follow-up separation and purification process.

Utilize Interferon alfacon-1 cysteine mutant molecule and the impurity molecule that target unit point PEG modifies on molecular weight, to have the feature of notable difference, can adopt gel chromatography (gel filtration chromatography, or molecular-exclusion chromatography (size exclusion chromatography GFC), SEC) they are separated, the filler that can adopt includes but not limited to Sephacryl S-100, Sephacryl S-200, Sephadex G-25, Sephadex G-50, Sephadex G-75, Superdex 75, TSKgel HW-50, TSKgel HW-55 etc.

Due to thiol modifier modification is the halfcystine site of protein, after modification, can make protein lose the electronegative group that dissociates, and likely other charged group of masking protein matter, and connect the larger modifier of molecular weight or connect the rear effect of modifier molecule of more number more obvious.Therefore can utilize Interferon alfacon-1 cysteine mutant molecule and the impurity that before and after modifying, the change of this charge property of protein molecule is modified target unit point PEG to carry out ion-exchange chromatography (ion exchange chromatography, IEC) separate, the filler that can adopt includes but not limited to DEAE Sepharose FF, Q Sepharose FF, CM Sepharose FF, SP Sepharose FF, DEAE Sepharose CL-6B, Source 15, Source 30, TSKgel CM-650, TSKgel DEAE-650, TSKgel QAE-550, TSKgel SP-650, TSKgel CM-5PW, TSKgel DEAE-5PW etc.In this purge process, due to PEG modifier neutral, so can not be adsorbed in loading process.

Because PEG is the molecule of a not only hydrophilic but also close ester, for improving the close ester performance of protein molecule after modifying protein molecule, and molecular weight is larger, more this molecule number raising connecting be more obvious, therefore can utilize Interferon alfacon-1 cysteine mutant molecule and the impurity that before and after modifying, the change of this hydrophobic performance of protein molecule is modified target unit point PEG to carry out hydrophobic interaction chromatography (hydrophobic interaction chromatography, HIC) separate, the filler that can adopt includes but not limited to Phenyl Sepharose 6 FF, Butyl Sepharose 4 FF, Source 15PHE, Source 15ETH, TSKgel Ether-5PW, TSKgel Phenyl-5PW etc.

The Interferon alfacon-1 cysteine mutant mercapto-polyglycol modifier modified derivative that purifying obtains also needs to carry out the evaluations such as purity, molecular weight, biologic activity, stability, medicine generation, security, the Interferon alfacon-1 cysteine mutant of the same described unmodified of method.

In a kind of embodiment being more preferably, the molecular weight of polyethyleneglycol modified dose of the present invention is between 10KDa-20KDa.

The 3rd object of the present invention is to provide the preparation method of above-mentioned Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative, comprises the steps:

1) the concentrated described Interferon alfacon-1 cysteine mutant solution of preparation, make its concentration reach 2.0-20mg/ml, and make the described residing buffer solution system of Interferon alfacon-1 cysteine mutant be converted to the suitable buffer solution system that carries out polyethyleneglycol modified reaction;

2) concentrated Interferon alfacon-1 cysteine mutant solution obtained above is contacted and carries out modification reaction with polyethyleneglycol modified dose;

3) mixture obtaining after modification reaction is carried out to chromatographic separation and purification, to remove polyethyleneglycol modified dose of wherein having neither part nor lot in modification reaction and the described Interferon alfacon-1 cysteine mutant that has neither part nor lot in modification reaction, and remove the Interferon alfacon-1 cysteine mutant mercapto-polyglycol derivative that is connected with multiple peg molecules.

The 4th object of the present invention is to provide the pharmaceutical composition of above-mentioned Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative.

In basic embodiment, in composition of the present invention, contain the described Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative for the treatment of significant quantity and safe dose, and pharmaceutically acceptable carrier of sufficient quantity.

Last object of the present invention is to provide above-mentioned Interferon alfacon-1 cysteine mutant and the purposes of polyethyleneglycol derivative in the medicine of preparation treatment virus disease thereof.

Interferon alfacon-1 cysteine mutant of the present invention and polyethyleneglycol derivative thereof have identical target indication with the Interferon alfacon-1 of not sudden change, due to the extensive restraining effect of Interferon, rabbit to virus replication, so they are all effective in cure to nearly all disease of viral infection, especially aspect treatment hepatitis B and/or hepatitis C, have quite compared with natural interferon alpha molecule or better in body or external drug effect.

The term " interferon-alpha " using in the present invention or " interferon alpha " comprise the natural anti-virus active substance that human body or animal body are produced by white corpuscle under extraneous pathogenicity bo material incentive, also comprise select by gene engineering method that suitable expression vector expresses with the identical recombinant molecule of above-mentioned native sequences, also comprise the molecule of the artificial design of the integrated above-mentioned natural interferon alpha conserved sequence of selecting by gene engineering method that suitable expression vector expresses, i.e. Interferon alfacon-1 molecule.

The term " Interferon alfacon-1 " (consensus interferon or integrated interferon) using in the present invention only refers to have the Interferon alfacon-1 of aminoacid sequence shown in SEQ ID No.4 in the application documents except specification sheets background technology part, this Interferon alfacon-1 has a detailed description (being called as therein " Novel alpha interferon mutant ", corresponding to the sequence 3 in sequence table) in Chinese patent application CN02159950.5.

The term " polyethyleneglycol modified dose " using in the present invention, also be that " PEG modifier " refers to mono methoxy polyethylene glycol modifier, also with the hydroxyl of methoxyl group sealing peg molecule one end, and activate the activated polyethylene glycol of gained after a hydroxyl of the other end with suitable activation method.Because the reactive behavior of hydroxyl self is very low, so the reactive behavior of the peg molecule after overactivation is greatly improved, just can be called as " polyethyleneglycol modified dose ".There are in the prior art a lot of bibliographical informations about the mechanism of the selection of activating group, activation and the modification reaction mechanism of polyethyleneglycol modified dose of activation gained, as Nektar company of the U.S. (former Shearwater company) applies for and obtained the authorization many pieces about the patent of polyethyleneglycol modified dose." mercapto-polyglycol modifier " of the present invention is in narrow spectrum modifying protein molecule, to have neither part nor lot in polyethyleneglycol modified dose of free sulfhydryl groups that forms disulfide linkage, can obtain or can or buy from the company of domestic professional activated PEG modifier including Jiankai Science and Technology Co., Ltd., Beijing, Beijing Kaizheng Biotech Engineering Development Co., Ltd. from external Nektar company's purchase by known activating mechanism activation preparation, especially mPEG-MAL and mPEG-VS by commercial channel.

The term " polyethyleneglycol modified " using in the present invention refer to by polyethyleneglycol modified agent molecule and protein molecule chemical coupling to together with.The group of polyethyleneglycol modified dose that participates in linked reaction is its activating group of introducing in reactivation process, the group of protein is mainly amino group, mercapto groups, carboxylic group or the oh group wherein dissociating, preferably amino group or mercapto groups.

Embodiment

By following embodiment, enforcement of the present invention is described further, but embodiments of the present invention are not limited to following embodiment.

Embodiment 1: the expression engineering bacteria of Interferon alfacon-1 76 site cysteine mutants builds with sequence to be confirmed

Extract the plasmid of Interferon alfacon-1 as template, first run PCR comprises two reaction systems.

Reaction system 1 primer is:

P1：ATGTGTGACCTGCCGCAGAC，

P4：CTATTAGTCTTTACGACGCAG，

The DNA sequence dna of 76 sites and upstream thereof increases.

Reaction system 2 primers are:

P2：GATTCGTCCCAGCAAGCAGAAG，

P3：TGGGACGAATCTCTGCTGGA，

The DNA sequence dna in 76 sites and downstream thereof increases.

Reaction conditions is: 94 ℃, and 4 minutes, 93 ℃, 1 minute, then 55 ℃, 2 minutes, 72 ℃, totally 30 circulations in 2 minutes.

Second takes turns PCR take the product of first round PCR as template, carries out pcr amplification take P1, P2 as primer.Reaction conditions is: 94 ℃, and 4 minutes, 93 ℃, 1 minute, then 56 ℃, 2 minutes, 72 ℃, totally 30 circulations in 2 minutes.

Second takes turns PCR product through agarose electrophoretic analysis, selects the DNA fragmentation of 720bp left and right, and with NdeI/EcoR I double digestion, electrophoresis reclaims the target DNA fragment of 500bp left and right.

By Nde I/EcoR I double digestion for pET-23b plasmid vector, reclaim and be connected with the above-mentioned second target DNA fragment of taking turns PCR recovery through agarose electrophoresis.Ligation condition is: 2 × Rapid buffer4-5 μ l, T4DNA Lagase1 μ l, object fragment 1-2 μ l, carrier 3 μ l, 4 ℃ of connections of spending the night.

Prepare e. coli jm109 or DH5 α competent cell, transform above-mentioned connection product, coating ammonia benzyl flat board, 37 ℃ of incubated overnight.

Picking list bacterium colony is as template, increases with primer P1, the P2 of above-mentioned design, and product detects through agarose electrophoresis, and positive colony occurs specific band in 720bp left and right; Get positive colony and cultivate in a small amount, extract plasmid Nde I/EcoR I double digestion.There is specific band in 3kb left and right and 500bp left and right respectively, conform to expectation situation, construction of recombinant plasmid success is tentatively described.For further confirming its sequence, with T7 universal primer, ABI377 sequenator is carried out to full-automatic sequencing.

Embodiment 2: fermentation, purifying and the detection of Interferon alfacon-1 75 site cysteine mutants

The method identical by same embodiment 1 principle builds the colibacillus engineering that obtains expressing Interferon alfacon-1 75 site cysteine mutants, then after being coated with dull and stereotyped activation, select single colony inoculation (prepares with peptone 10g, yeast powder 5g, NaCl 10g for every liter in containing the LB substratum of penbritin, regulating pH is 7.0), 37 ℃, 210 revs/min shaking table shake-flask culture are to OD _600nmfor 0.6-0.8.Then be inoculated in and in the LB substratum of 50L, in 80L fermentor tank, carry out fermentation culture (every liter containing 0.1% penbritin) with 5% volume inoculum size, culture temperature is 37 ℃, in culturing process with ammoniacal liquor regulate pH between 6.5-7.5, with rotating speed control oxygen dissolving value between 3-5%.At OD _600nmreach after 1.0 in the ratio of mass volume ratio 1:5000 and add IPTG10g to continue inducing culture 3 hours, inducing culture temperature is 35 ℃, and in this process to the suitable LB substratum of adding in fermentor tank.The inducing culture time to after put 5000 revs/min of tank room temperatures and within centrifugal 20 minutes, collect thalline, gained thalline with TE damping fluid (50mmol/L Tris-HCl, 5mmol/L EDTA, pH8.0) wash centrifugal twice to remove the major impurity in fermented liquid.

Getting thalline 40g that above-mentioned processing obtains adds 600ml TE damping fluid to put with the mass volume ratio of 1:15 on ultrasonic disruption instrument, to carry out ultrasonication, condition is for to make a call to 5 seconds, have a rest 5 seconds, totally 60 minutes, 6000 revs/min of broken liquid chamber temperature of gained are abandoned supernatant for centrifugal 20 minutes, precipitation with the mass volume ratio of 1:10 add TE damping fluid wash centrifugal twice must isolation of occlusion bodies.

Gained 10g inclusion body adds after 100ml 7mol/L Guanidinium hydrochloride under appropriate agitation condition denaturing treatment 2 hours with the mass volume ratio of 1:10, after inclusion body dissolves completely, 8000 revs/min of room temperatures are abandoned precipitation for centrifugal 20 minutes, supernatant carries out renaturation processing with dilution refolding method, renaturation solution consists of: 0.15mol/L sodium borate buffer liquid, 4mmol/L Sleep-promoting factor B, 1mmol/L reduced glutathion, regulating pH is 9.5.Renaturation process carries out in 2-8 ℃ of low-temperature cold store, first with renaturation solution by 4 times of supernatant dilutions, places after 8 hours and continues renaturation 6 hours with 5 times of renaturation solution dilutions again, and then with 5 times of renaturation solution dilutions, finally renaturation 6 hours is to reach final renaturation effect.After renaturation completes 4 ℃ 8000 revs/min centrifugal 30 minutes, get supernatant by the volume ratio of 1:10 to 25mmol/L Tris-HCl, pH8.0 solution carries out dialysis treatment, dialysis time is 12-24 hour, dialyzate is changed 1-2 time in centre.

Renaturation solution after dialysis is through the 4 ℃ 8000 revs/min upper 25mmol/L Tris-HCl, the DEAE Sepharose FF chromatographic column of pH8.0 solution equilibria of using after centrifugal 30 minutes.After completion of the sample, first continue to rinse 1-3 column volume of chromatographic column with level pad, the then 25mmol/L Tris-HCl to contain 0.3mol/L NaCl, pH8.0 solution carries out wash-out and collects elution peak.Linear rate of flow in above-mentioned loading, flushing and elution process should be controlled between 50-200cm/h.

50mmol/L acetic acid-sodium-acetate for DEAE Sepharose FF elution peak, pH4.5 damping fluid is with the rear upper CM Sepharose FF chromatographic column by same damping fluid balance of volume ratio dilution of 1:10.After completion of the sample, first continue to rinse 1-3 column volume of chromatographic column with level pad, then at the 25mmol/L acetic acid-sodium-acetate with containing 0.1-0.15mol/L NaCl, pH4.5 buffer solution elution is used the 25mmol/L acetic acid-sodium-acetate that contains 0.5mol/L NaCl after removing major impurity peak, and pH4.5 buffer solution elution is collected target peak.Linear rate of flow in above-mentioned loading, flushing and elution process should be controlled between 50-200cm/h.

The purity that adds coomassie brilliant blue staining method and size-exclusion HPLC method and detect respectively above-mentioned CM Sepharose FF chromatographic column and separate the Interferon alfacon-1 75 site cysteine mutants that obtain with SDS-PAGE electrophoresis, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 19442.05(reduced state), with theoretical value deviation be that under 0.29(reduced state, theoretical value is 19441.76).Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 6.4 × 10 ⁸iU/mg, the specific activity that contrasts the Interferon alfacon-1 that do not suddenly change is 5.2 × 10 ⁸iU/mg.

Embodiment 3: fermentation, purifying and the detection of Interferon alfacon-1 76 site cysteine mutants

Method structure with embodiment 1 is obtained to colibacillus engineering and carry out actication of culture and shake-flask culture by the method for embodiment 2.The LB of volume inoculum size inoculation 140L with 6% cultivates based on carrying out fermentation culture in 200L fermentor tank, and condition is as embodiment 2, but inducing culture temperature is 36 ℃.The inducing culture time to after put 5000 revs/min of tank room temperatures and within centrifugal 20 minutes, collect thalline, gained thalline by above-mentioned TE damping fluid washed twice to remove the major impurity in fermented liquid.

Get thalline 40g that above-mentioned processing obtains with the mass volume ratio of 1:15 add the above-mentioned TE damping fluid of 600ml and then by volume the ratio of mass ratio 100:1 add N,O-Diacetylmuramidase to process more than 4 hours, 6000 revs/min of broken liquid chamber temperature of gained are abandoned supernatant for centrifugal 20 minutes, precipitation adds TE damping fluid (the 50mmol/L Tris-HCl containing surfactant SDS with the mass volume ratio of 1:10, 5mmol/L EDTA, 0.3%SDS, pH8.0) wash after centrifugal twice again with not containing the TE damping fluid washing of tensio-active agent three times to remove respectively the SDS introducing in the impurity introduced in supernatant after broken and washing process.

Gained 10g inclusion body adds 150ml to contain after the 8mol/L urea of 4mmol/L mercaptoethanol under appropriate agitation condition denaturing treatment 4 hours with the mass volume ratio of 1:15, after inclusion body dissolves completely, 8000 revs/min of room temperatures are abandoned precipitation in centrifugal 20 minutes, and supernatant carries out renaturation processing with on-column refolding method in room temperature.Concrete grammar is: on sex change liquid, after DEAE Sepharose FF post, first use 50mol/L Tris-HCl, 5mmol/L EDTA, 4M urea, 3-5 column volume of pH8.0 eluant solution; Use again 50mol/L Tris-HCl, 5mmol/L EDTA, 2M urea, 3-5 column volume of pH8.0 solution washing; Use again 50mol/L Tris-HCl, 5mmol/L EDTA, 1M urea, 3-5 column volume of pH8.0 solution washing; Use again 50mol/L Tris-HCl damping fluid, 4mmol/L Sleep-promoting factor B, 1mmol/L reduced glutathion, 5mmol/L EDTA, 50mmol/L arginine, 5-8 column volume of pH8.0 solution washing; Using 50mmol/L Tris-HCl, pH8.0 solution is collected elution peak with the 50mmol/L Tris-HCl pH8.0 eluant solution that contains 0.3mol/L NaCl after rinsing 3-5 column volume.Linear rate of flow in above-mentioned loading, flushing and elution process should be controlled between 50-200cm/h.

DEAE Sepharose FF elution peak is pressed the volume ratio of 2:3 and is mixed with 50% ammonium sulfate (mass body volume concentrations), regulating pH is the 50mmol/L Tris-HCls of 8.0 rear upper use containing 20% ammonium sulfate, the Phenyl Sepharose6FF(Low sub of pH8.0 solution equilibria) chromatographic column, at the 50mmol/LTris-HCl with containing 20% ammonium sulfate, pH8.0 solution is used 50mmol/L Tris-HCl after rinsing 3-5 volume of post, and pH8.0 eluant solution is collected target peak.Linear rate of flow in above-mentioned loading, flushing and elution process should be controlled between 50-200cm/h.If wash-out collect target peak be not used in follow-up polyethyleneglycol modified reaction and for preserve, the Millipore ultra-filtration centrifuge tube that is 3000Da with molecular weight cut-off changes solution-treated, make buffered soln be converted to the 25mmol/L acetic acid-sodium-acetate containing 0.5mol/L NaCl, pH4.5 solution, the liquor capacity after conversion is front basic identical with conversion.

Add coomassie brilliant blue staining method and size-exclusion HPLC method detects respectively above-mentioned Phenyl Sepharose 6 FF(Low sub with SDS-PAGE electrophoresis) purity of the Interferon alfacon-1 76 site cysteine mutants that obtain of chromatographic column separation and purification the conversion buffered liquid of ultrafiltration, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 19441.35(reduced state), with theoretical value deviation for theoretical value under-0.41(reduced state be 19441.76).Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 7.5 × 10 ⁸iU/mg, the activity that contrasts the Interferon alfacon-1 that do not suddenly change is 5.2 × 10 ⁸iU/mg.

Embodiment 4: fermentation, purifying and the detection of Interferon alfacon-1 77 site cysteine mutants

The method identical by same embodiment 1 principle builds the colibacillus engineering bacterial classification that obtains expressing Interferon alfacon-1 77 site cysteine mutants, then carries out actication of culture and shake-flask culture by the method for embodiment 2.The LB of volume inoculum size inoculation 50L with 4% cultivates and carry out fermentation culture after in 80L fermentor tank, and condition is as embodiment 3, but inducing culture temperature is 36 ℃.The inducing culture time to after put 5000 revs/min of tank room temperatures and within centrifugal 20 minutes, collect thalline, gained thalline by above-mentioned TE damping fluid washed twice to remove the major impurity in fermented liquid.

Getting the thalline 40g that above-mentioned processing obtains adds the above-mentioned TE damping fluid of 600ml ball mill break process more than 2 hours with the mass volume ratio of 1:15, 6000 revs/min of broken liquid chamber temperature of gained are abandoned supernatant for centrifugal 20 minutes, precipitation adds TE damping fluid (the 50mmol/L Tris-HCl containing tensio-active agent TritonX-100 with the mass volume ratio of 1:10, 5mmol/L EDTA, 0.5%TritonX-100, pH8.0) wash after centrifugal twice again with not containing the TE damping fluid washing of tensio-active agent three times to remove respectively the SDS introducing in the impurity introduced in supernatant after broken and washing process.

Gained 10g inclusion body adds 150ml to contain after the 8mol/L urea of 4mmol/L DTT under appropriate agitation condition denaturing treatment 4 hours with the mass volume ratio of 1:15, after inclusion body dissolves completely, 8000 revs/min of room temperatures are abandoned precipitation for centrifugal 20 minutes, supernatant is the 25mmol/L Tris-HCl to 10 times of volumes successively, 4mol/L urea, pH8.0 solution, 25mmol/L Tris-HCl, 2mol/L urea, pH8.0 solution, 25mmol/L Tris-HCl, 1mol/L urea, pH8.0 solution and 25mmol/L Tris-HCl, pH8.0 solution carries out dialysis treatment, gained sees through 2mol/L acetic acid-sodium-acetate that liquid adds 1/20 volume, 25mmol/L acetic acid-sodium-acetate to 100 times of volumes again after pH4.5 damping fluid, pH4.5 damping fluid carries out dialysis treatment more than 12 hours.

See through on liquid by 25mmol/L acetic acid-sodium-acetate, the CM Sepharose FF chromatographic column of pH4.5 damping fluid balance.After completion of the sample, first continue to rinse 1-3 column volume of chromatographic column with level pad, then at the 25mmol/L acetic acid-sodium-acetate with containing 0.1-0.15mol/L NaCl, pH4.5 buffer solution elution is used the 25mmol/L acetic acid-sodium-acetate that contains 0.5mol/L NaCl after removing major impurity peak, and pH4.5 buffer solution elution is collected target peak.Linear rate of flow in above-mentioned loading, flushing and elution process should be controlled between 50-200cm/h.

The purity that adds coomassie brilliant blue staining method and size-exclusion HPLC method and detect respectively the Interferon alfacon-1 77 site cysteine mutants that the separation and purification of above-mentioned CM Sepharose FF chromatographic column obtains with SDS-PAGE electrophoresis, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 19327.11(reduced state), with theoretical value deviation be that under 0.39(reduced state, theoretical value is 19326.72).Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 6.8 × 10 ⁸iU/mg, the activity that contrasts the Interferon alfacon-1 that do not suddenly change is 5.2 × 10 ⁸iU/mg.

Embodiment 5: 25 ℃ of stability test results of Interferon alfacon-1 75-77 site cysteine mutant

25 ℃ of stability test results of table 1 Interferon alfacon-1 75 site cysteine mutant

25 ℃ of stability test results of table 2 Interferon alfacon-1 76 site cysteine mutant

25 ℃ of stability test results of table 3 Interferon alfacon-1 77 site cysteine mutant

Embodiment 6: mPEG-MAL modification, product purification and the detection of Interferon alfacon-1 75 site cysteine mutants

The buffered soln of the Interferon alfacon-1 75 site cysteine mutants that obtain with the separation and purification of CM Sepharose FF filled column is the 25mmol/L acetic acid-sodium-acetate containing 0.5mol/L NaCl, pH4.5 solution, for modification reaction, pH is too low, and concentration also only has 0.2mg/ml, do not reach the requirement of modification reaction.Therefore before modification reaction, first it is concentrated and buffered soln conversion, the way of taking is ultrafiltration process, the Millipore ultra-filtration membrane that is 8000Da with molecular weight cut-off is processed, after complete soln filters, rinse mutant on collection membrane with a small amount of 25mmol/L phosphoric acid salt pH7.2 solution, make concentration reach 3.0mg/ml.

1) modification reaction of the mPEG-MAL that molecular weight is 20KDa separates, detects with modified outcome

Get the mutant solution 50ml after above-mentioned concentrating, adding 300mg molecular-weight average by the mass ratio of 1:2 is Jiankai Science and Technology Co., Ltd., Beijing's commercial mPEG-MAL strand modifier of 20KDa, puts cold compartment of refrigerator and jolt reaction 18 hours with the speed of 10 revs/min on horizontal shaking table.

Reaction times, then, above with the CM650S filled column of same damping fluid balance, unmodified PEG modifier stream in loading process was worn to the rear 1000ml 25mmol/L acetic acid-sodium-acetate pH4.5 solution dilution reaction solution (20 times of volume dilution) of using with termination reaction.At the 25mmol/L acetic acid-sodium-acetate with containing 60mmol/L NaCl, after pH4.5 eluant solution modifier impurity, use the 25mmol/L acetic acid-sodium-acetate containing 0.2mol/L NaCl, pH4.5 eluant solution object modifier, finally with the 25mmol/L acetic acid-sodium-acetate containing 0.5mol/L NaCl, the not adorned Interferon alfacon-1 cysteine mutant of pH4.5 eluant solution.Loading, flushing and wash-out linear rate of flow in this sepn process should be controlled between 40-150cm/h.

Add coomassie brilliant blue staining method with SDS-PAGE electrophoresis and detect respectively with size-exclusion HPLC method the purity that separates the polyethyleneglycol derivative obtaining, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 39452.30.Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 8.0 × 10 ⁷iU/mg, activity is left 12.50%.

2) modification reaction of the mPEG2-MAL that molecular weight is 40KDa separates, detects with modified outcome

The modifier mPEG2-MAL of what to utilize the commercial molecular weight in Jiankai Science and Technology Co., Ltd., Beijing be 40KDa have branch's duplex structure modifies Interferon alfacon-1 75 site cysteine mutants, modification reaction condition, method and modify the modification reaction of the same 20KDa mPEG-MAL of after product separation method and separating of modified outcome.

Add coomassie brilliant blue staining method with SDS-PAGE electrophoresis and detect respectively with size-exclusion HPLC method the purity that separates the polyethyleneglycol derivative obtaining, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 59631.04.Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 5.3 × 10 ⁷iU/mg, activity is left 8.28%.

3) modification reaction of the mPEG-MAL that molecular weight is 10KDa separates with modified outcome

Get the mutant solution 50ml after above-mentioned concentrating, adding 300mg molecular-weight average by the mass ratio of 1:2 is the commercial strand mPEG-MAL in the Jiankai Science and Technology Co., Ltd., Beijing modifier of 10KDa, puts cold compartment of refrigerator and jolt reaction 18 hours with the speed of 10 revs/min on horizontal shaking table.

Reaction times, pH4.5 solution dilution reaction solution (20 times of volume dilution) was with termination reaction to rear with 1000ml 25mmol/L acetic acid-sodium-acetate, and then, above with the CM650S filled column of same damping fluid balance, unmodified PEG modifier stream in loading process is worn.At the 25mmol/L acetic acid-sodium-acetate with containing 75mmol/L NaCl, after pH4.5 eluant solution modifier impurity, use the 25mmol/L acetic acid-sodium-acetate containing 0.2mol/L NaCl, pH4.5 eluant solution object modifier, finally with the 25mmol/L acetic acid-sodium-acetate containing 0.5mol/L NaCl, the not adorned Interferon alfacon-1 cysteine mutant of pH4.5 eluant solution.Loading, flushing and wash-out linear rate of flow in this sepn process should be controlled between 40-150cm/h.

Add coomassie brilliant blue staining method with SDS-PAGE electrophoresis and detect respectively with size-exclusion HPLC method the purity that separates the polyethyleneglycol derivative obtaining, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 29446.33.Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 1.7 × 10 ⁸iU/mg, activity is left 26.56%.

4) modification reaction of the mPEG-MAL that molecular weight is 5KDa separates, detects with modified outcome

Modify Interferon alfacon-1 75 site cysteine mutants with Jiankai Science and Technology Co., Ltd., Beijing's commercial mPEG-MAL strand modifier of 5KDa, the modification reaction of modification reaction condition, method and the same 10KDa mPEG-MAL of modification after product separation method separates with modified outcome.

Add coomassie brilliant blue staining method with SDS-PAGE electrophoresis and detect respectively with size-exclusion HPLC method the purity that separates the polyethyleneglycol derivative obtaining, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 24443.81.Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 3.0 × 10 ⁸iU/mg, activity is left 46.88%.

Embodiment 7: mPEG-MAL modification, product purification and the detection of Interferon alfacon-1 76,77 site cysteine mutants

With Phenyl Sepharose 6 FF(Low sub) buffered soln of the Interferon alfacon-1 76 site cysteine mutants that obtain of filled column separation and purification is 25mmol/L Tris-HCl, pH8.0 solution, meet and modify required pH with mPEG-MAL, but concentration only has 0.2mg/ml, do not reach the requirement of modification reaction, therefore for modification reaction need to carry out concentration to it, the way of taking is chromatography.Will be after DEAE SepharoseFF filled column on this mutant solution with the 25mmol/L Tris-HCl of the NaCl containing 0.5mol/L, pH8.0 solution carries out wash-out and obtains concentration and reach the concentrated mutant solution of 5.0mg/ml.

Getting above-mentioned mutant solution 40ml after concentrated, to add 100mg molecular-weight average by the mass ratio of 2:1 be Jiankai Science and Technology Co., Ltd., Beijing's commercial mPEG-MAL strand modifier of 20KDa, and 25 ℃ of the room temperatures speed with 8 revs/min jolts reaction 18 hours.

Reaction times is to the rear 800ml 25mmol/L Tris-HCl that uses, pH8.0 solution dilution reaction solution (20 times of volume dilution) is with basic termination reaction, then the upper DEAE SepharoseFF filled column by same damping fluid balance, unmodified PEG modifier stream in loading process is worn.At the 25mmol/LTris-HCl with containing 80mmol/L NaCl, after pH8.0 eluant solution modifier impurity, use the 25mmol/L Tris-HCl containing 0.2mol/L NaCl, pH8.0 eluant solution object modifier, finally with the not adorned interferon mutant of 25mmol/L Tris-HCl pH8.0 eluant solution containing 0.5mol/L NaCl.

The linear rate of flow of loading in above-mentioned concentrated, modified outcome sepn process, flushing, wash-out all should be controlled between 50-200cm/h.

The Millipore ultra-filtration centrifuge tube that it is 3000Da with molecular weight cut-off that wash-out is collected containing the elution peak of object modifier changes solution-treated, 25mmol/L acetic acid-the sodium-acetate that buffered soln is converted to contain 0.2mol/L NaCl, pH4.5 solution, the liquor capacity after conversion is front basic identical with conversion.

The purity that adds coomassie brilliant blue staining method and size-exclusion HPLC method and detect respectively the polyethyleneglycol derivative that above-mentioned separation and purification the conversion buffered liquid of ultrafiltration obtains with SDS-PAGE electrophoresis, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 39453.20.Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 1.1 × 10 ⁸iU/mg, activity is left 14.67%.

Use the same method and can prepare the mPEG-MAL(molecular weight 20KDa of Interferon alfacon-1 77 site cysteine mutants, strand) derivative, add coomassie brilliant blue staining method and size-exclusion HPLC method detects respectively its purity with SDS-PAGE electrophoresis, result is all more than 97%.Detecting its molecular weight by MALDI-TOF mass spectroscopy is 39340.61.Determine that with " the interferon activity assay method " and " protein determination " of " Pharmacopoeia of People's Republic of China 2010 editions (three) " regulation its specific activity is 9.3 × 10 ⁷iU/mg, activity is left 13.68%.

Embodiment 8: 25 ℃ of stability test results of Interferon alfacon-1 75-77 site cysteine mutant mPEG-MAL modified outcome

Table 4 Interferon alfacon-1 75 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) 25 ℃ of stability test results of modified outcome

Table 5 Interferon alfacon-1 75 site cysteine mutant mPEG-MAL(molecular weight 10KDa, strand) 25 ℃ of stability test results of modified outcome

Table 6 Interferon alfacon-1 76 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) 25 ℃ of stability test results of modified outcome

Table 7 Interferon alfacon-1 77 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) 25 ℃ of stability test results of modified outcome

Embodiment 9: the pharmacokinetics test of Interferon alfacon-1 75-77 site cysteine mutant and mPEG-MAL modified outcome thereof

48 of the SD rats of getting body weight and be 300g left and right, are divided into 8 groups, and 6 every group, male and female half and half.Group 1 is to group 8 subcutaneous single injection Interferon alfacon-1 75 site cysteine mutants respectively, Interferon alfacon-1 76 site cysteine mutants, Interferon alfacon-1 77 site cysteine mutants, Interferon alfacon-1, Interferon alfacon-1 75 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 75 site cysteine mutant mPEG-MAL(molecular weight 10KDa, strand) mono-modified product, Interferon alfacon-1 76 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 77 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, respectively at 0, 0.2, 0.5, 0.75, 1, 2, 4, 8, 12, 24, 48, 72, 96, within 168 hours, blood is got on eyeground, after centrifugal collection serum, measure wherein interferon biological activity.Obtain the main pharmacokinetic parameter as shown in following table 8 and table 9 by measurement result mean value calculation.

The main pharmacokinetic parameter that after table 8 SD rat single subcutaneous injection Interferon alfacon-1 cysteine mutant or Interferon alfacon-1, measuring and calculating obtains

The main pharmacokinetic parameter that after table 9 SD rat single subcutaneous injection Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative, measuring and calculating obtains

Embodiment 10: the acute toxicity test in mice of Interferon alfacon-1 75-77 site cysteine mutant mPEG-MAL modified outcome

60 of the mouse of getting body weight and be 20g left and right, are divided into 5 groups, 12 every group.Group 1 is to group 5 subcutaneous single injection Interferon alfacon-1, Interferon alfacon-1 75 site cysteine mutant mPEG-MAL(molecular weight 20KDa respectively, strand) mono-modified product, Interferon alfacon-1 75 site cysteine mutant mPEG-MAL(molecular weight 10KDa, strand) mono-modified product, Interferon alfacon-1 76 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 77 site cysteine mutant mPEG-MAL(molecular weight 20KDa, strand).Continuous Observation 14 days after injection, except group 1 has other groups 4 dead mouses not show any abnormalities performance, show mouse to the maximum tolerated dose of Interferon alfacon-1 75-77 site cysteine mutant mPEG-MAL modified outcome all more than 6.4mg/Kg, be equivalent to 3840 times of people's quantity.Interferon alfacon-1 75-77 site cysteine mutant mPEG-MAL modified outcome obviously improves compared with the security of Interferon alfacon-1.

Claims

1. consensus interferon mutant, is characterized in that in Interferon alfacon-1 aminoacid sequence, being halfcystine from the amino acid mutation of the 77th of N end meter, and aminoacid sequence is as shown in SEQ ID No.3.

2. the polyethyleneglycol derivative of a consensus interferon mutant claimed in claim 1, it is characterized in that described polyethyleneglycol derivative is connected and obtains with polyethyleneglycol modified dose by described consensus interferon mutant, the described molecular weight of polyethyleneglycol modified dose is between 5KDa-40KDa.

3. a polyethyleneglycol derivative claimed in claim 2, polyethyleneglycol modified dose described in it is characterized in that is mercapto-polyglycol modifier, is selected from the one in maleimide PEG modifier, ethene sulfuryl PEG modifier, iodo-acid amide PEG modifier or adjacent pyridyl disulfide PEG modifier.

4. a polyethyleneglycol derivative claimed in claim 2, is characterized in that the described molecular weight of polyethyleneglycol modified dose is between 10KDa-20KDa.

5. a preparation method for the polyethyleneglycol derivative described in one of claim 2-4, comprises the steps:

1) the concentrated described consensus interferon mutant solution of preparation, makes its concentration reach 2.0-20mg/ml, and makes the described residing buffer solution system of consensus interferon mutant be converted to the suitable buffer solution system that carries out polyethyleneglycol modified reaction;

2) concentrated consensus interferon mutant solution obtained above is contacted and carries out modification reaction with described polyethyleneglycol modified dose;

3) mixture obtaining after modification reaction is carried out to chromatographic separation and purification, to remove polyethyleneglycol modified dose of wherein having neither part nor lot in modification reaction and the described consensus interferon mutant that has neither part nor lot in modification reaction, and remove the Interferon alfacon-1 polyethyleneglycol derivative that is connected with multiple peg molecules.

6. a pharmaceutical composition for the polyethyleneglycol derivative described in one of claim 2-4, is characterized in that containing treatment significant quantity and the described polyethyleneglycol derivative of safe dose and pharmaceutically acceptable carrier of sufficient quantity.

7. described consensus interferon mutant or the purposes of its polyethyleneglycol derivative in the medicine of preparation treatment virus disease of one of claim 1-4.