CN105085658B - Interleukin 29 mutant and polyethylene glycol derivative - Google Patents

Abstract

The invention relates to an interleukin 29 mutant, wherein the 167 th aspartic acid of the interleukin 29 is mutated into serine to obtain a novel mutant interleukin 29, and the mutant interleukin 29 has better stability relative to that before mutation, and the invention also relates to the application of the mutant and polyethylene glycol derivatives thereof.

Description

Interleukin 29 mutant and polyethylene glycol derivative

Technical Field

The invention relates to an interleukin 29 mutant, a polyethylene glycol derivative thereof, a preparation method thereof and application of a polyethylene glycol conjugate containing the interleukin 29 mutant or the mutant in the aspects of preventing or treating viral diseases, tumors and the like. Background

Interferons are an important family of cytokines, and have broad-spectrum antiviral, anti-cell-proliferation and immunomodulatory effects.

To date, 6 forms of interferon have been identified, which fall into three major groups. The so-called "type I" interferons include interferon alpha, interferon beta, interferon omega, interferon delta, interferon tau. Currently, a subset of interferons gamma and alpha are the only type II interferons. Type III interferons are a recently discovered family of cytokines, including interferons λ 1, λ 2 and λ 3, also known as IL-28A, IL-28B and IL-29

IL-28A, IL-28B and IL-29 comprise a recently discovered new family of proteins that share sequence homology with type I interferons and gene sequence homology with IL-10. This new family is described in detail in commonly owned PCT application WO02/086087 and Shepard et al, Nature Immunol.4:63-68,2003, which are incorporated herein by reference in their entirety. Functionally, IL-28 and IL-29 are similar to type I interferons and both induce an antiviral state in cells, unlike type I interferons, which do not exhibit antiproliferative activity against certain B cell lines.

The wild-type IL-29 (interferon lambda1) gene encodes a 200 amino acid polypeptide, the mature amino acid sequence of which is shown in SEQ ID NO:1, and the corresponding polynucleotide encoding the IL-29 polypeptide regions, domains, motifs, residues and sequences described herein is shown in SEQ ID NO: 2. The helix of IL-29 is predicted as follows: helix a is defined by amino acid residues 30(Ser) to 44 (Leu); helix B is defined by amino acid residues 57(Asn) to 65 (Val); helix C is defined by amino acid residues 70(Val) to 85 (Ala); helix D is defined by amino acid residues 92(Lys) to 111 (Gln); helix E is defined by amino acid residues 118(Thr) to 139 (Lys); and helix F is defined by amino acid residues 144(Gly) to 170 (Leu).

Given that the IL-29 molecule has 5 cysteine residues (PCT application WO02/086087WO02/02627), further analysis of IL-29 based on multiple alignments predicts that the cysteines at amino acid residues 49 and 145, and 112 and 171, will form intramolecular disulfide bonds, and that the cysteine at position 15 is free and can form intermolecular disulfide bonds.

Whether type I interferon, type II interferon or type III interferon, as protein drugs, due to poor stability, high plasma clearance rate, short half-life in vivo, easy generation of antigen antibody, etc., in clinical treatment is very limited. The gene engineering technology makes it possible to synthesize human recombinant protein in large scale, and the engineered protein has altered wild protein sequence to obtain recombinant protein with relatively high stability and high specific activity and lowered immunogenicity.

Despite this, the disadvantages of rapid plasma clearance and low bioavailability, which have been the result: frequent injections of interferon are required to achieve effective plasma therapeutic concentrations; moreover, each injection results in large fluctuations in blood drug levels, leading to peaks and troughs in drug concentration. This may increase the cost of treatment as well as the inconvenience of administration and the risk of adverse reactions. Therefore, various drug delivery techniques have been attempted to improve the therapeutic effect of protein drugs.

The bioavailability of protein drugs is generally limited by plasma half-life and is sensitive to protease degradation, and the technology that prevents the application of polyethylene glycol modified proteins in clinical therapy is a new technology developed in recent years for improving the in vivo pharmacokinetic properties of protein drugs. It is characterized by that the activated polyethylene glycol molecule (PEG) is bonded on the surface of protein molecule, so that it can affect the space structure of protein, and finally can result in the change of various biochemical properties of protein, such as: increased chemical stability, increased resistance to proteolysis, diminished immunogenicity and toxicity, increased in vivo half-life, decreased plasma clearance, and the like.

Summary of The Invention

There are a number of amino acids available for mutation on IFN-. lambda.1, but changes in the amino acid sequence should take into account that the folding and steric structure of IFN-. lambda.1 is not affected and that at least mutants which retain activity comparable to that of the wild-type IFN-. lambda.1 are obtained. The invention aims to provide a novel mutant IFN-lambda1 obtained by mutating 167 th amino acid, wherein Asp at the 167 th position is mutated into Ser, and compared with the wild type IFN-lambda1, the mutant has stronger activity and better stability.

The invention provides a method for preparing soluble IFN-lambda1 mutant, which comprises the steps of firstly constructing and designing IFN-lambda1 mutant primer, constructing to obtain mutant gene, inserting the obtained gene into an expression vector, transferring the obtained vector into host escherichia coli to obtain corresponding expression engineering bacteria, and then performing fermentation and induced expression, inclusion body denaturation and renaturation to obtain the soluble IFN-lambda1 mutant.

The desired protein is recovered and purified from the soluble cytoplasmic fraction, the soluble periplasmic fraction, the soluble fraction of the culture medium and the inclusion bodies using any method for recovering and purifying protein from the culture medium, the cytoplasm, the periplasmic fraction and the inclusion bodies which is known or readily determinable by one of skill in the art including, but not limited to, centrifugation, filtration, dialysis, chromatography (including size exclusion chromatography) and the like. Suitable methods for recovering and purifying the desired protein will depend in part on the nature of the protein and the intended use.

The technical scheme adopted for realizing the method is to utilize protein engineering technology to carry out the reaction on the amino acid sequence shown in SEQ ID NO:1, carrying out site-directed mutagenesis on the amino acid sequence shown in the specification, and mutating Asp at a 167 th position into Ser, wherein the specific method comprises the following steps:

1) obtaining a recombinant gene for coding a target protein by using an in vitro site-directed mutagenesis technology;

2) inserting the recombinant gene into an expression vector to obtain a recombinant plasmid capable of encoding recombinant protein, wherein the expression vector comprises but is not limited to pET-23 b;

3) transforming the recombinant plasmid into an escherichia coli competent cell to obtain an engineering bacterium capable of stably expressing the target protein, wherein the escherichia coli competent cell comprises but is not limited to BL21(DE 3);

4) the engineering bacteria express the target protein in an inclusion body form. The expression product exists in the form of inclusion body, the expression amount accounts for more than 40% of the total protein of the thallus, and the purification of the recombinant protein sequentially adopts three purification processes of Blue dye affinity chromatography, copper ion affinity chromatography and CM weak cation exchange chromatography, so that the high-purity recombinant target protein IFN-lambda1 mutant can be obtained.

The invention aims to provide the polyethylene glycol derivative of the IFN-lambda1 mutant and the preparation method thereof, wherein a polyethylene glycol (PEG) reagent reacts with free cysteine residues in the IFN-lambda1 through thiol reaction to obtain a specific conjugate, and PEG is subjected to fixed-point modification on the free cysteine in the obtained product to obtain the PEG-IFN-lambda 1 mutant. Compared with the non-PEGylated IFN-lambda1, the obtained PEG-IFN-lambda 1 has improved stability and reduced immunogenicity.

In general, the PEGylated protein method is similar to, and slightly modified by, the methods described in WO9412219(Cox and McDermott) and WO9422466(Cox and Russell), both of which are incorporated herein by reference. Contacting the polypeptide or protein containing free cysteine with an excess of "thiolated PEG" (typically PEG: protein or polypeptide in molar ratios of 1:1, 5:1, 10:1, and 50:1) under stirring to effect reaction, preferably at a temperature of 4 ℃ to 37 ℃; the preferred pH range may be from 6.5 to 9.5, but more preferably 7.5 to 8.5. PEGylation of proteins can be detected using SDS-PAGE to determine molecular weight changes, and the lowest amount of PEG that produces a large amount of mono-PEGylated product without producing di-PEGylated product is generally considered optimal (80% conversion to mono-PEGylated product is generally considered better).

The "PEG moiety" of the cysteine of the invention to form a "pegylated" protein includes any suitable polymer, for example, a linear or branched polyol. The preferred polyol is polyethylene glycol, which is a synthetic polymer of ethylene oxide units that can be varied to obtain PEGylated protein variants with apparent molecular weights in the range of about 3,000-70,000Da by size exclusion chromatography. The size of the PEG moiety directly affects its circulatory half-life. Thus, protein variants with different circulating half-lives can be engineered for specific therapeutic applications or preferred dosage regimens by varying the size or structure of the PEG moiety.

As used herein, "thiolating reactive pegylating agent" refers to any PEG derivative that reacts with the thiol group of a cysteine residue, these reactive PEG end groups for modification of the cysteine residue, including but not limited to, dithio-p-pyridine, vinyl sulfone, maleimide, iodoacetamide. The PEG end group has specificity corresponding to the free sulfydryl, and realizes mono-PEGylation. But the reaction takes place without damaging the protein. Pegylating agents used in their mono-methoxylated form, wherein only one end can be coupled.

The term "monopegylated" is defined as a protein modified by covalent attachment of a single PEG moiety to a specific site of the protein. The "monopegylation" method may use any method known to those skilled in the art, including, but not limited to, the methods listed in the examples of the present invention.

In the present invention, the preferred thiolating agent is mPEG-dithio-p-pyridine (mPEG-OPSS) or mPEG-maleimide (mPEG-MAL). Notably, the reaction of the two PEGylating agents with IFN- λ is site-specific, being free at IFN- λ 1¹⁵Cys and other naturally occurring Cys residue sites are not reactive with thiol-reactive PEGylating agents due to the propensity to form intramolecular disulfide bonds.

In the present invention, there is also provided a method for purifying the PEG-IFN-. lambda.1 conjugates obtained by the present invention, typically by purifying the PEGylated protein conjugate from non-PEGylated protein and unreacted PEG, such as by dialysis, ultrafiltration, size exclusion chromatography, ion exchange chromatography, affinity chromatography, reverse phase chromatography or hydrophobic chromatography, although other purification methods, such as two-phase organic extraction or salt precipitation, may also be used.

Experiments can be performed to confirm that the PEG moiety is attached to the protein at the correct site, and this can be done by chemical cleavage or proteolytic digestion of the protein, purification of the PEG polypeptide (which has a larger molecular weight) by size exclusion, ion exchange or reverse phase chromatography, followed by amino acid sequencing. During amino acid sequencing, PEG-conjugated amino acids appeared as blanks.

The term "chromatographic method" or "chromatography" refers to any technique used to separate components of a mixture by applying the mixture to a solvent (mobile phase) flowing through a packing (stationary phase), the separation principle of which is based on the different physical properties of the stationary and mobile phases.

It is still another object of the present invention to provide a use of the IFN- λ 1 mutant and its polyethylene glycol conjugate for preparing a pharmaceutical composition for treating or preventing viral diseases or tumors, wherein the virus is any virus against which IFN can be treated, such as hepatitis virus, papilloma virus, herpes simplex virus, HIV, epstein barr virus, coronavirus and/or influenza virus, etc., preferably hepatitis virus, such as HBV or HCV; bacterial infections, and cancer (e.g., myeloma, lymphoma, liver cancer, breast cancer, melanoma, leukemia, etc.). As shown in the examples of the present invention, the PEG-IFN-lambda conjugate of the present invention can be used for treating hepatoma cells HepG2 and myocarditis virus EMCV

For therapeutic use, the skilled artisan can readily determine the appropriate dosage, frequency of administration, and route of administration. Factors for making such determinations include, but are not limited to, the nature of the protein used, the condition to be treated, the potential patient compliance, the age, weight, and individual response of the patient, etc.

The PEG-IFN- λ 1 conjugates or polyol-IFN- λ 1 conjugate-containing compositions of the invention are combined with suitable pharmaceutical carriers or excipients for use in the treatment of various conditions, and the particular carrier used in these pharmaceutical compositions may take a variety of forms depending on the type of administration desired. Suitable routes of administration include, but are not limited to, enteral (e.g., oral), topical, suppository, inhalation, and parenteral, preferably parenteral, such as subcutaneous, intramuscular, or intravenous injection.

In preparing the compositions in oral liquid dosage forms (e.g., suspensions, tinctures, colloids, or solutions), typical pharmaceutical media can be employed, such as water, glycols, glycerol, oils, alcohols, flavoring agents, preservatives, coloring agents, and the like. Similarly, when preparing oral solid dosage forms (e.g., tablets, capsules, etc.), agents such as starches, sugars, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like may be employed.

The pharmaceutical composition for parenteral administration may be prepared in the form of an injection comprising the active ingredient and a suitable carrier. For parenteral administration, the carrier will usually comprise sterile water for injection, and may also comprise some other suitable co-solvent or preservative component, and injectable suspensions may also be prepared, in which case suitable liquid carriers, suspending agents and the like will be employed. Carriers for parenteral administration are well known in the art and include, water, saline solutions, ringer's solution, and/or dextrose, which may contain minor amounts of excipients to maintain stability and isotonicity of the medicament, and such solutions may be prepared in accordance with conventional procedures.

For topical administration, the PEG-IFN- λ 1 conjugates of the invention may be formulated with a mild aqueous base, such as an ointment or cream, with an ointment base such as petrolatum, lanolin, and water-in-oil emulsions such as Eucerin^TMAvailable from Beiersdorf (Cincinnati, Ohio); cold cream (USP); purpose Cream^TMAvailable from Johnson&Johnson (New Brunswick, New Jersey) and the like.

The PEG-IFN- λ 1 conjugates of the invention are typically administered in unit dosage form, and the compounds of the invention are typically administered in daily, weekly, and monthly doses ranging from about 0.01 μ g/kg body weight to about 50mg/kg body weight, preferably from about 0.1 μ g/kg body weight to about 25mg/kg body weight, more preferably from about 1 μ g/kg body weight to about 5mg/kg body weight. The dosage may be between 10. mu.g and 1mg per day, more preferably between 20. mu.g and 200. mu.g, for an average body weight of 75 kg. For modified PEG-IFN- λ, the dosing period can be extended, for example, a weekly, or biweekly dosing regimen. For example, the weekly dose per person may be from 10 μ g to about 500 μ g, in certain specific embodiments, the weekly dose per person may be from about 50 μ g to about 250 μ g, and in certain other embodiments, the weekly dose per person may be from about 100 to about 200 μ g. As will be apparent to those skilled in the art, the particular amount of a pharmaceutical composition according to the present invention depends on several factors, including but not limited to, the desired biological activity, the state of the patient, and tolerance to the drug, etc.

Drawings

FIG. 1: shows SDS-PAGE patterns of the induced expression of the engineered mycoprotein of the interferon lambda1D167S mutant. Lane 1 is protein molecular weight Marker; lane 2 induced expression for 0 h; lane 3 induced expression for 1 h; lane 4 induced expression for 2 h; lane 5 induced expression for 3 h;

FIG. 2: SDS-PAGE patterns of the purified interferon lambda1D167S mutant and the PEG-modified interferon lambda1D167S mutant are shown. Lane 1 is protein molecular weight Marker; lane 2 is the purified interferon lambda1D167S mutant protein; lane 3 shows the purified PEG-modified interferon lambda1D167S mutant protein.

Detailed Description

Example 1: expression engineering bacteria construction and sequence confirmation of interferon lambda1D167S mutant

Extracting plasmid of interferon lambda1 as template, mutating 167 th aspartic acid (GAC) to serine (TCT), and performing first round PCR including two reaction systems

The primers of the reaction system are as follows:

an upstream primer: 5'-CCATATGGGTCCGGTGCCGACCTCGAAACCG-3' the flow of the air in the air conditioner,

a downstream primer:

5’-CCTCGAGTTATTATTAGGTCGATTCCGGGTGGGTCGAGGTACGCAGGCACAGATTG CCGTC-3’；

the PCR conditions were: pre-denaturation at 94 deg.C for 5min, denaturation at 94 deg.C for 30s, annealing at 53 deg.C for 30s, extension at 72 deg.C for 1min, circulating for 30 times, and extension at 72 deg.C for 5 min.

The pET-23b vector and the PCR amplification product were digested with Nde I/Xho I, and reacted at 37 ℃ for 1 hour, and the linearized vector and the target fragment (about 600bp) were recovered. And (3) connecting the PCR product and the enzyme-digested fragment of the vector by using T4DNA ligase: 10 XT 4DNA Ligase Buffer5 uL, PCR double digestion recovery product 15 uL, plasmid double digestion recovery product 30 uL, T4DNAligase2 uL, ddH2O to 50 uL, 16 ℃ overnight.

The ligation reaction solution was directly transformed into BL21(DE3) -competent cells, the ligation product was transformed, ampicillin plates were coated, and overnight culture was carried out at 37 ℃.

And selecting a single colony as a template, amplifying the primers P1 and P2 designed above, detecting by agarose gel electrophoresis, and primarily explaining that the recombinant plasmid is successfully constructed when a band appears on the positive clone at about 600bp and is consistent with an expected condition. To further confirm their sequence, fully automated sequence determination was performed with the T7 universal primer by an ABI377 sequencer.

Example 2: expression and purification of interferon lambda1D167S mutant

Inoculating the engineering bacteria into LB culture medium containing ampicillin at a ratio of 1:100, performing shake culture at 37 deg.C until OD600 of the bacteria solution is 0.4-0.6, adding 0.5mM IPTG for induction, culturing for 4 hr, and collecting the bacteria. When Escherichia coli BL21(DE3) is used as a host, IFN-lambda expressed in the host accounts for about 30-50% of the total protein of the cells, and is mainly present in the form of inclusion bodies.

The fermented cells were washed 3 times with TE solution (m: V ═ 1:10), and then subjected to high-pressure homogenization and disruption under the following conditions: homogenizing under 35 MPa. After homogenizing, microscopic examination shows the bacteria breaking rate. When the cell disruption rate is about 95% (about 2-3 times), centrifuging at 8000rpm for 15min, and collecting disrupted cell precipitate (SDS-PAGE shown in FIG. 1). The disrupted cell pellet was placed in a beaker, and an inclusion body washing solution (10mM Tris-HCl +1mM EDTA + 0.5% Triton-X100, pH6.5, m: V: 1:10) was added thereto, and the mixture was stirred in a magnetic stirrer for 30 minutes and washed 3 to 5 times. Inclusion bodies were lysed with inclusion body lysates (7M guanidine hydrochloride +50mM Tris-HCl + 10mM DTT, ph6.5, M: V ═ 1:10), stirred at room temperature overnight. The cleaved protein was slowly added to a renaturation solution (100mM Tris-HCl, 0.5M Arginine, 0.5% PEG3350(M: V), 2mM GSH:0.5mM GSSG, pH8.5) to a final protein concentration of 0.2mg/ml, and stirred at room temperature overnight.

The renaturation solution is centrifuged for 5min at 8000rpm, and the supernatant is collected. Using an ultrafiltration cup, the membrane pore size was 30kDa, the ultrafiltration membrane was equilibrated with solution A (20mM PB pH7.0), and 1L of the supernatant was concentrated 10-fold. The concentrated solution was added with 2 times of buffer solution to continue ultrafiltration, and finally 50ml of sample solution was collected. Loading the concentrated solution onto a Blue Sepharose FF chromatographic column fully balanced with solution A, washing with solution A of two column volumes, eluting with solution B (20mM PB +2M NaCl pH7.0), and collecting the eluate components; packing the Chelating Sepharose Fast Flow on a column, loading 0.1mol CuSO4 on the column, and equilibrating Buffer A (50mmol/L Tris (pH0.5) +50mmol/L NaCL +0.1mmol/L CuSO4) until the detector baseline is stable. The filtrate obtained by blue Sepharose FF chromatography was diluted 5-fold with Buffer A and applied. 5 column volumes were equilibrated with Buffer A, Buffer B (50mmol/L Tris (pH7.5) +0.5mol/L NaCL), respectively, until the baseline plateaued. Buffer C (50mmol/L Gly (pH3.0) +0.3mol/L NaCL). Buffer D (50mmol/L EDTA (pH8.0) column regeneration, the Chelating Sepharose Fast Flow affinity chromatography elution peak components are loaded on the C liquid (25mmol/L sodium acetate Buffer pH4.5) well balanced CM Sepharose FF cation exchange chromatography column, with D liquid (25mmol/L sodium acetate Buffer +0.3mol/L NaCl pH4.5) washing, elution peak components are collected, after the above purification process, the IFN-lambda1 mutant obtained finally has a purity of more than 95% (see figure 2).

Example 3: PEG coupling of interferon lambda1D167S mutants

The purified IFN-lambda protein was mixed with mPEG-MAL having a molecular weight of 20kDa in a molar ratio of 1/10-1/5, and the mixture was reacted at 4 ℃ for 10 hours in 25mM Tris-HCl buffer, followed by adjusting the pH of the reaction system to 5.0 or less with an acetic acid solution to terminate the reaction. SDS-PAGE detects the degree of coupling of the reaction.

Example 4: purification of interferon lambda1D167S mutant derivatives

The modified product was purified by SP Sepharose HP, the equilibration solution was 25mM sodium acetate Buffer (pH5.5) and the eluent was 25mM sodium acetate Buffer, containing 1M NaCl, pH5.5, and was eluted linearly from 0-100% Buffer B (Buffer B shown in example 2). The purpose of the chromatography is to remove the multi-modified protein and the unmodified protein, and the purity of the finally obtained single PEG modified IFN-lambda1 mutant is more than 95%.

Example 5: the in vitro cell biological activities of IFN-lambda1, IFN-lambda1 polyethylene glycol derivatives, mutant IFN-lambda1 and mutant IFN-lambda1 polyethylene glycol derivatives were determined by reporter gene method.

HEK293-ISRE-Luc cells were grown adherently in complete medium. Passage is carried out according to the ratio of 1: 4, 2-3 times per week, and the seeds grow in complete culture solution. Removing culture medium from cultured cells, washing with PBS for 1 time, digesting, collecting cells, and preparing cell suspension containing 3.5 × 105-4.5 × 105 cells per 1ml with determination culture medium. The prepared standard solution and test solution are transferred into a 96-well plate which can be used for cell culture and reading of a chemiluminescence enzyme-labeled instrument, 100 mu l of the prepared standard solution and test solution is added into each well, and then the cell suspension is inoculated into the same 96-well plate, wherein each well is 100 mu l. Culturing at 37 deg.C and 5% carbon dioxide for 19-23 hr. Carefully sucking up the supernatant in a 96-well plate, adding cell lysate and luciferase substrate according to the instructions of a luciferase detection kit, measuring by using a chemiluminescence enzyme-linked immunosorbent assay, recording the ED50 value, and recording the measurement result.

Example 6: results of 25 ℃ stability tests on modified products of interferon Lambda1, interferon Lambda1 mutant, and interferon Lambda1mPEG-MAL, interferon Lambda1 mutant mPEG-MAL

The interferon Lambda1, interferon Lambda1 mutant, and interferon Lambda1mPEG-MAL modified products, and interferon Lambda1 mutant mPEG-MAL modified products were dialyzed into 25mM acetic acid buffer solution containing 2mM ZnCl2 and 100mM NaCl. The protein purity is respectively detected by SDS-PAGE electrophoresis and a molecular exclusion HPLC method, the stability of the interferon Lambda mutant is obviously enhanced, the purity results of the polyethylene glycol interferon Lambda1 mutant are all more than 97 percent, and the activity is not greatly changed.

TABLE 1 stability test results of interferon Lambda at 125 deg.C

TABLE 2 interferon Lambda1 mutant stability test results at 25 deg.C

TABLE 3 results of stability test at 25 ℃ for modified product of interferon Lambda1mPEG-MAL

TABLE 4 results of stability test at 25 ℃ for modified products of interferon Lambda1 mutant mPEG-MAL

From the results in the table, it can be seen that the IFN-lambda1 mutant has better activity after being mutated by D167S, and the ED50 value is smaller than that before mutation; the stability test result at 25 ℃ proves that the stability is obviously improved after mutation.

Example 7: pharmacokinetic study in rats

24 female SPF-grade SD rats weighing 270-290 g/rat are randomly divided into 4 groups, namely an interferon Lambda1 group, an interferon Lambda1 mutant group, an interferon Lambda1mPEG-MAL modification product group and an interferon Lambda1 mutant mPEG-MAL modification product group, wherein each group comprises 6 rats. Animals were fasted for 12h before dosing without water deprivation. The drug is administered according to the set dosage and the interferon sample is sterilized by dialysis and filtration. Single subcutaneous injection was administered at a dose of 200 μ g/kg body weight. And (3) collecting blood from tail veins of 0, 5, 15, 30, 60, 120, 240, 720 and 1440min after administration of the interferon Lambda group and the interferon Lambda mutant group, and collecting blood from tail veins of 0, 0.5, 1, 2, 4, 8, 12, 24, 48, 72, 96, 120 and 144h after administration of the interferon Lambda mPEG-MAL modified product group and the interferon Lambda mutant mPEG-MAL modified product group. 1ml of blood is collected at one time, and 0.5ml of blood collection dense points are taken. The collected blood sample is centrifuged at 5000rpm for 8min, and plasma is separated and stored at-70 ℃. Detection was carried out using an ELISA kit of Human IL-29(IFN-lambda1) from eBioscience. The analysis result of the Kinetica software is shown in a table, and the Cmax and the AUC of the mutant are improved to a certain extent under the same condition.

Table 5: pharmacokinetic parameters

Claims (10)

1. An IFN- λ 1 mutant characterized in that the amino acid sequence of said mutant is represented by the amino acid sequence set forth in SEQ ID NO:1 amino acid Asp to Ser.

2. A nucleotide sequence encoding the IFN- λ 1 mutant of claim 1.

3. An expression vector comprising the nucleotide sequence of claim 2.

4. A cultured cell into which has been introduced the expression vector of claim 3, said cell expressing the polypeptide encoded by the DNA segment.

5. A polyethylene glycol derivative of an IFN- λ 1 mutant according to claim 1, wherein the polyethylene glycol modifier is linked to Cys at position 15 of the IFN- λ 1 mutant.

6. The polyethylene glycol derivative of an IFN- λ 1 mutant of claim 5, wherein the polyethylene glycol modifier is a thiol polyethylene glycol modifier, which is a polyol derivative having a functional group selected from the group consisting of a disulfide polypyridine, a vinyl sulfone, a maleimide, and an iodoacetamide.

7. The polyethylene glycol derivative of an IFN- λ 1 mutant of claim 6, wherein the polyethylene glycol modifier has a molecular weight of 10-40 kDa.

8. A process for preparing polyethylene glycol derivatives of IFN-. lambda.1 mutants of any of claims 5, 6 or 7, comprising the steps of: reacting thiol-reactive polyol with the polypeptide, wherein the polypeptide has a single free cysteine residue, and the polyol reagent is covalently bound to the site specificity of the polypeptide to form a covalent thioether bond, thereby obtaining a polyol-polypeptide conjugate, and recovering and purifying the target polyol-polypeptide conjugate.

9. A pharmaceutical composition comprising the IFN- λ 1 mutant of claim 1 or a polyethylene glycol derivative of the IFN- λ 1 mutant of any one of claims 5 to 7, and a pharmaceutically acceptable carrier or excipient.

10. Use of the IFN- λ 1 mutant of claim 1, or a polyethylene glycol derivative of the IFN- λ 1 variant of any one of claims 5 to 7, or the composition of claim 9, for the preparation of a medicament for the treatment of inflammation, viral infection, bacterial infection, and cancer.