CN102532299B - Interferon alpha mutant and polyethylene glycol derivative thereof - Google Patents
Interferon alpha mutant and polyethylene glycol derivative thereof Download PDFInfo
- Publication number
- CN102532299B CN102532299B CN 201210043375 CN201210043375A CN102532299B CN 102532299 B CN102532299 B CN 102532299B CN 201210043375 CN201210043375 CN 201210043375 CN 201210043375 A CN201210043375 A CN 201210043375A CN 102532299 B CN102532299 B CN 102532299B
- Authority
- CN
- China
- Prior art keywords
- interferon alfacon
- mutant
- interferon
- polyethyleneglycol
- peg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention belongs to the field of biomedicine, and relates to a compound interferon cysteine mutant, a polyethylene glycol derivative thereof, a preparation method and a pharmaceutical composition of the polyethylene glycol derivative, and application of the compound interferon cysteine mutant and the polyethylene glycol derivative to preparation of medicines for treating viral diseases. The compound interferon cysteine mutant is obtained by mutating an amino acid at the 109th position or the 110th position, which is counted from the N end of the amino acid sequence of the compound interferon, into a cysteine; the polyethylene glycol derivative of the compound interferon cysteine mutant is obtained by connecting the compound interferon cysteine mutant and a polyethylene glycol modifier; and the molecular weight of the polyethylene glycol modifier is between 5KDa and 40KDa. The compound interferon cysteine mutant and the polyethylene glycol derivative thereof have higher bioactivity, better pharmacological effects, higher stability and more reliable safety.
Description
Technical field
The present invention is general relates to interferon alpha mutant, its polyethyleneglycol derivative, the latter's preparation method, pharmaceutical composition and both purposes in the medicine of preparation treatment virus disease, relate to Interferon alfacon-1 cysteine mutant, its polyethyleneglycol derivative especially, the latter's preparation method, pharmaceutical composition and both purposes in the medicine of preparation treatment virus disease.
Background technology
Interferon, rabbit (interferon, IFN) be a kind of cytokine class medicine with broad-spectrum disease resistance toxic action that is produced by animal body at first, produce according to it that position is different with the mechanism of action can be divided into big type such as α, β, γ, λ, and every kind big type can be divided into some little hypotypes, in the same big type between different hypotype on primary structure difference very little, very approaching on the above higher structure of secondary.In several big types, the α type is most widely used a kind of, and this kind of Interferon, rabbit of clinical application at present mainly comprises interferon alpha 2a, interferon alpha 2 b, interferon alpha 1b, Interferon alfacon-1 etc.Wherein Interferon alfacon-1 (consensus interferon or integrated interferon) is after known alpha-interferon is carried out sequence alignment, the highest amino acid of the frequency of occurrences is assigned to corresponding position separately, and the artificial design alpha-interferon of the alpha-non-natural amino acid sequence that obtains after indivedual positions are made amendment, the molecule that comprises the multiple amino acids sequence, but homology height to each other, their biologic activity is more than 10 times of natural alpha-interferon.
Though various alpha-interferons are being brought into play curative effect more and more widely in the process of current treatment viral infection disease, but himself poor stability, short characteristics of transformation period have also limited its further clinical application, have brought some troubles for patient's medication.Given this reason, fundamental research and the product development of a lot of long-acting interferons aspect have been carried out both at home and abroad, comprise interferon molecule self transformed, researched and developed the fusion rotein that comprises the interferon molecule aminoacid sequence, interferon molecule is carried out chemically modified, selects the appropriate drug delivery system to optimize to carry in the body of interferon molecule with drug effect performance process etc. that wherein the listing of polyethylene glycol modified interferon (Interferon, rabbit that belongs to chemically modified) is the maximum success that obtains in this field.
Polyoxyethylene glycol (polyethelene glycol, PEG) be a kind of linear polymer, because parents' characteristic of its excellent biological compatibility and not only hydrophilic but also close ester, being able to show one's talent from numerous chemical modifiers becomes the modifier of present research and most widely used protein and peptide drugs.Through the years of researches exploitation, the interferon alpha product of existing two PEG modification successfully goes on the market at present, be respectively the interferon alpha 2a (commodity are called " Pai Luoxin ") of the PEG modification of the interferon alpha 2 b modified of the PEG of U.S.'s Schering Plough (Schering-Plough) company (now being purchased by MSD Corp.) (commodity " wear happy can " by name) and Switzerland Luo Shi (Roche) company, respectively at calendar year 2001 and 2002 in U.S. listing, entered the inland of China in 2003 simultaneously and sell.The interferon alpha 2 b of modifying about the PEG of Schering Plough company is formed to some extent its prescription in Chinese patent application CN00808452.1 and is described; The interferon alpha 2a that the PEG of Roche Holding Ag modifies then has a detailed description in Chinese patent CN97113049.3.In addition, the interferon alpha product that also has more PEG to modify is is researched and developed, and is the Interferon alfacon-1 that the PEG of Intermune company exploitation modifies near the listing stage wherein.
Making a general survey of the development of PEG modified interferon α technology, mainly is the development that is accompanied by the PEG modification technique.Early stage research and development is mainly around non-specific site PEG modification technique, the modified derivative instability that selected PEG modifier purity is low, molecular weight is little (generally below 10KDa) and distribution range is wide, decorating site kind and quantity many and form causes modified outcome to form that heterogeneity, purity relatively low (about 85%), quality control are difficult for realizing, long-acting is not obvious and still have certain toxic side effect.The interferon alpha 2 b product that the PEG of above-mentioned Schering Plough company modifies just belongs to this type.Specificity site PEG modification technique has appearred in the development that is accompanied by the PEG modifier, because the purity of selected PEG modifier has obtained large increase, molecular weight can reach significantly constriction of the above and distribution range of 20KDa, and the improvement of modifying mechanism reduces decorating site kind and quantity, the modified derivative stability that forms improves, thereby makes the shortcoming of above-mentioned non-specific site PEG modification technique obtain improving significantly.
Specificity site PEG modification technique can be divided into three types again, and a kind of is to modify the target protein molecule with the PEG modifier with branched structure, reaches the purpose that reduces decorating site quantity by the stronger space steric effect of branched structure PEG modifier.The interferon alpha 2a product that the PEG of above-mentioned Roche Holding Ag modifies just belongs to this type.But because this so-called " specificity site " modification technique is from modifying the amino acid that can not accomplish only to modify single kind on the mechanism, can not accomplish only to modify the amino acid in single site, so the kind of decorating site and number are still numerous, as Chinese patent CN200380103341.1 the isomer that interferon alpha 2a (the PEG modified interferon α 2a product " Pai Luoxin " that comprises Roche Holding Ag) that branched structure PEG modifies has 12 decorating sites is disclosed.
Second kind is the amino acid whose free alpha-amino group of modifying protein molecule N-terminal, principle is that the free epsilon-amino of Methionin is compared and had lower pKa value in other site of free alpha-amino group and protein of protein N end amino acid, can with amido modified dose modification reaction take place under lower pH.But because the specificity of this pH selective reaction is not too high, even the modification reaction on the free epsilon-amino that Methionin still can take place under the lower pH, and modification may be covered the avtive spot of protein molecule, cause the modified outcome activity to reduce greatly, therefore this modification technique also is restricted in actual applications.
The third is with the sulfydryl on the sulfydryl modification agent modifying protein molecule halfcystine, because the halfcystine quantity in the protein molecule seldom, and the sulfydryl on most halfcystines is used to form intramolecularly or intermolecular disulfide bond, have only few free sulfhydryl groups can supply to modify, so the specificity of this modification reaction is very high.Disclose the interferon alpha 1b that a kind of sulfydryl PEG modifier is modified as Chinese patent application CN200510076676.X, utilized and had only the characteristics of a free sulfhydryl group with sulfydryl PEG modifier it to be modified in the interferon alpha 1b molecule.But the actual greatest problem of using of expanding of this kind technology is not have free cysteine residues in the natural protein molecule basically, can be difficult to obtain because of the pure product of protein that the stability that very significantly influences protein molecule and purge process (forming intramolecularly or intermolecular disulfide bond easily) are used in modification even have also, make modification can't realize (because in case form intramolecularly or intermolecular disulfide bond just do not have can be for the free cysteine of modifying); And the halfcystine of selecting natural site is modified the avtive spot that may cover protein molecule equally, causes the modified outcome activity to reduce greatly.The interferon alpha 1b that above-mentioned PEG modifies is just also lower because of activity residual rate after the lower biological activity of interferon alpha 1b self and the modification, thereby makes final PEG modified outcome activity lower, and practical application effect remains to be proved.
Interferon alpha kind hypotype is numerous in addition, have many sites can supply to change to produce the plain α product of active higher mutation disturbance in the sequence, disclosing a kind of activity as US Patent No. 4695623, US4897471, US5372808 is the Interferon alfacon-1 molecule of native sequences interferon alpha more than 10 times.So also can utilize these characteristics of interferon alpha to select the plain α of the low mutation disturbance of active height, good stability and toxicity to carry out PEG modifies, with drug effect, medicine generation and the security that improves or improve modified outcome, the Interferon alfacon-1 that the PEG of aforementioned Intermune company modifies just belongs to this type, and and for example Chinese patent application CN02159951.3 also discloses the Interferon alfacon-1 that a kind of branched structure PEG modifier is modified.But this kind of single utilization technology still can not solve the problem that modified outcome is formed that heterogeneity, purity difference, quality control are difficult for realizing, long-acting is not obvious and still had certain toxic side effect.
Summary of the invention
Primary and foremost purpose of the present invention provides a kind of cysteine mutant of Interferon alfacon-1, do not have the free cysteine residues can be undesirable for the free cysteine residues site that specificity site sulfydryl PEG modifier is modified or institute has or suddenly change in the existing interferon alpha to solve, cause the protein molecule instability, activity is low, separation and purification is difficult and be unfavorable for the problem of specificity site PEG modifier modification.
For realizing this purpose, in the embodiment on basis, the cysteine mutant of Interferon alfacon-1 of the present invention is halfcystine with holding the 109th of meter or the 110th amino acid mutation from N in the Interferon alfacon-1 aminoacid sequence, has the aminoacid sequence shown in the SEQ ID No.1-2 respectively.
The present invention select with in the Interferon alfacon-1 aminoacid sequence from the 109th of N end meter or the 110th 's amino acid mutation be halfcystine based on molecular computer space structure before and after the sudden change predict the outcome, known interferon alpha and receptors bind principle and known interferon alpha 2a and the space structure of interferon alpha 2 b.
In order to obtain the Interferon alfacon-1 cysteine mutant, need successively express the fermentation of structure, genetic engineering bacterium or genetically engineered cell of the genetic engineering bacterium of Interferon alfacon-1 cysteine mutant molecule or genetically engineered cell and the purifying of tunning, preferably express the purifying of structure, fermentation and tunning of the colibacillus engineering of Interferon alfacon-1 cysteine mutant molecule.
In the building process of genetic engineering bacterium or genetically engineered cell, at first need to obtain and increase and express the gene of Interferon alfacon-1 cysteine mutant, the method that adopts preferably well known to a person skilled in the art the PCR method, and is more preferably the known overlapping extension PCR method of those skilled in the art.After the gene of Interferon alfacon-1 cysteine mutants is expressed in acquisition in a large number, select suitable carrier, make up recombinant vectors thereby the gene of using the method that well known to a person skilled in the art the structure recombinant vectors will express the Interferon alfacon-1 cysteine mutant changes described carrier over to.Described carrier and recombinant vectors preferred plasmid carrier, this plasmid vector should have the single restriction enzyme site separately of one or more groups pair enzyme, and suitable corresponding host bacterium or the host cell of being changed over to.
At first prepare competent host bacterium or host cell then, recycling electroporation, PEG method etc. well known to a person skilled in the art that method changes recombinant vectors over to genetic engineering bacterium or the genetically engineered cell of host bacterium or constructing host cell expression Interferon alfacon-1 cysteine mutant.Described host bacterium or the preferred intestinal bacteria of host cell, pichia spp and Chinese hamster ovary celI, and more preferably intestinal bacteria.
The fermentation of engineering bacteria or engineering cell should be selected the conditions such as substratum composition, pH, temperature, air flow, incubation time and feed supplement operation of suitable its growth.Fermentation for colibacillus engineering, preferred LB substratum, temperature control in the culturing process is between 30-37 ℃, pH control (is selected pH regulator agent control pH in case of necessity between 6.0-8.0, described pH regulator agent includes but not limited to NaOH, ammoniacal liquor and various organic nitrogen source, preferred ammoniacal liquor), air flow should satisfy growth needs and the product of thalline or cell and express synthetic needs, incubation time is relevant with the mode of feed supplement operation, and incubation time is between 6-48 hour under the situation of the feed supplement operational condition of taking to suit.
If Interferon alfacon-1 cysteine mutant albumen is expressed in engineering bacteria or the engineering cell, need carry out break process to discharge Interferon alfacon-1 cysteine mutant albumen wherein to thalline or the cell of fermentation culture results.And for the engineering bacteria of protokaryons such as intestinal bacteria, more need break process to discharge the Interferon alfacon-1 cysteine mutant albumen with the inclusion body formal representation.Breaking method commonly used is including, but not limited to ultrasonic disruption, ball mill fragmentation, N,O-Diacetylmuramidase processing etc.
For the Interferon alfacon-1 cysteine mutant albumen with the inclusion body formal representation, need carry out washing operation to the thick inclusion body that break process obtains to remove foreign proteins such as a small amount of tropina of wherein containing, membranin as far as possible.The damping fluid that uses in the washing process is including, but not limited to Tris-HCl, PB, and the pH value of washing process should be controlled between 7.0-9.0.In order to dissolve more insoluble hydrophobic protein impurity, can in lavation buffer solution, add a certain amount of salt, that commonly used is NaCl, concentration range is between 0.05-0.5mol/L; For the stronger membranin of solubilizing hydrophobic, can in lavation buffer solution, add certain amount of surfactant, this type of tensio-active agent commonly used comprises but is not limited to tween-80, sodium laurylsulfonate (SDS), TritonX-100 that concentration is between 0.01-5%.
Because thalline or cell can discharge some proteolytic ferments in shattering process, thereby might degrade the Interferon alfacon-1 cysteine mutant, therefore need add the activity that some materials suppress these proteolytic ferments in shattering process and in the washing process after the fragmentation, the most direct method is to add proteinase inhibitor, as trypsin inhibitor, round-about way also can add metal ion chelation agent, as EDTA because metal ion chelation agent can chelating these proteolytic ferments performance hydrolytic actiones institutes must dependence metal ion.
The inclusion body sex change dissolving that washing obtains can be used the urea of 7-10mol/L or the Guanidinium hydrochloride of 5-8mol/L, also need to add sulfhydryl reagent in case of necessity and render a service with the dissolving that improves denaturing agent, described sulfhydryl reagent is including, but not limited to mercaptoethanol, dithiothreitol (DTT).The mass/volume of inclusion body/denaturing agent of adopting of dissolving can be between 1: 3 to 1: 50 than (g/ml), and is preferably between 1: 5 to 1: 30, best between 1: 7 to 1: 20.The sex change dissolution time should be more than 2 hours.
Renaturing inclusion bodies can adopt dilution refolding method, dialysis renaturation method or on-column refolding method.The dilution refolding method be by a step or multistep dilution with renaturation solution with the concentration dilution of denaturing agent below 0.5mol/L, so that protein molecule renaturation gradually under the situation of breaking away from the denaturing agent influence; The dialysis renaturation method is with 10 times of renaturation solutions with upper volume sex change liquid to be dialysed so that the concentration of denaturing agent is reduced to below the 0.5mol/L, plays the effect of renaturation equally; The on-column refolding method is that sex change liquid is directly gone up ion-exchange, hydrophobic molecule exclusion (gel) chromatographic column, carries out separation and purification and the renaturation of gradient elution to realize target protein simultaneously with the elute soln that contains continuous reduction denaturing agent concentration then.
The essentially consist of renaturation solution is the buffered soln of pH between 5.0-10.0, to guarantee the required basic alkaline environment of renaturation, can satisfy the buffered soln of this requirement including, but not limited to Tris-HCl, sodium borate buffer liquid.In order to prevent that the renaturation excessive velocities forms the disulfide linkage mispairing in the renaturation process, need in renaturation solution, add some oxidized forms and the reduced form sulfhydryl reagent redox equilibrium system material to forming, as the redox equilibrium system of Sleep-promoting factor B and reduced glutathion composition.Simultaneously for prevent the renaturation excessive velocities cause protein folding not exclusively, the disulfide linkage mispairing, can in the renaturation solution of above-mentioned essentially consist, add some other materials, as arginine, EDTA, metal ion and various molecular chaperones materials etc.The selection of these materials and dosage have a lot of reports in the prior art, repeat no more here.
The renaturation solution that above-mentioned dilution refolding method and dialysis renaturation method obtain, and the centrifugal supernatant that contains the Interferon alfacon-1 cysteine mutant that soluble form expresses that directly obtains by fragmentation, and the centrifugal supernatant of fermentation culture of the Interferon alfacon-1 cysteine mutant of expressing with soluble form, all need carry out further chromatographic separation and purification.Utilize Interferon alfacon-1 cysteine mutant molecule and the impurity molecule difference on affine character, charge property, hydrophobic property, molecular weight size can successively select one or more the combination in ion affinity chromatography, exchange chromatography, hydrophobic chromatography, the gel separation chromatogram to carry out purifying.In order better to reach centrifugation, before chromatographic separation and purification, can treat parting liquid and carry out concentration, the method that can select is anti-molten behind the organic solvent deposit, anti-molten after saltouing, polyoxyethylene glycol concentrates, ultrafiltration and chromatography etc.
The Interferon alfacon-1 cysteine mutant molecule that chromatographic separation and purification obtains can be with well known to a person skilled in the art that the SDS-PAGE electrophoresis adds the coomassie brilliant blue staining method or high performance liquid chromatography is determined purity; Determine molecular weight with mass spectroscopy; " interferon activity assay method " and " protein determination " partly stipulated with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " appendix, the interferon activity that obtains with mensuration is determined the specific activity of Interferon alfacon-1 cysteine mutant divided by protein concn.
Wherein high performance liquid chromatography purity detecting method can adopt reversed-phased high performace liquid chromatographic or size-exclusion high performance liquid chromatography, but preferred size-exclusion high performance liquid chromatography, because this kind method is more convenient, accurate, quick.The number of theoretical plate that requires chromatographic column when adopting the size-exclusion high performance liquid chromatography is greater than 10000, and applied sample amount is between 5-100 μ l, and between the preferred 10-50 μ l, the chromatographic separation time is 3 times of main peak appearance time.
Study on the stability is Interferon alfacon-1 cysteine mutant solution that chromatographic separation and purification is obtained under 20-45 ℃ environment long-term storage 3-6 month, regularly the variation of outward appearance is observed in sampling in this process, and detects the variation of major quality controlling indexs such as purity, activity.
The Interferon alfacon-1 cysteine mutant molecule that chromatographic separation and purification obtains also need carry out animal drugs for test evaluation and animal acute toxicity test evaluation.
In a kind of embodiment preferred, Interferon alfacon-1 cysteine mutant of the present invention is halfcystine with the 109th amino acid mutation from N end meter in the Interferon alfacon-1 aminoacid sequence, and it has the aminoacid sequence shown in the SEQ ID No.1.
In a kind of embodiment preferred, Interferon alfacon-1 cysteine mutant of the present invention is halfcystine with the 110th amino acid mutation from N end meter in the Interferon alfacon-1 aminoacid sequence, and it has the aminoacid sequence shown in the SEQ ID No.2.
Second purpose of the present invention provides the polyethyleneglycol modified derivative of aforesaid Interferon alfacon-1 cysteine mutant, to solve that existing interferon alpha polyethyleneglycol derivative is formed heterogeneity, purity actives is low, quality control is difficult for realizing or long-acting is not obvious and to still have problem such as certain toxic side effect.
For realizing this purpose, in the embodiment on basis, polyethyleneglycol derivative of the present invention is connected with polyethyleneglycol modified dose by described Interferon alfacon-1 cysteine mutant and obtains, and described polyethyleneglycol modified dose molecular weight is between 5KDa-40KDa.
In a kind of embodiment preferred, described polyethyleneglycol modified dose is polyethyleneglycol modified dose of sulfydryl, is selected from a kind of in maleimide PEG modifier, ethene sulfuryl PEG modifier, iodo-acid amide PEG modifier or the adjacent pyridyl disulfide PEG modifier.
For obtaining the influence that PEG modification reaction that described polyethyleneglycol derivative carries out mainly is subjected to the factors such as kind, temperature, protein concn, pH, protein/modifier quality/mol ratio, stirring velocity, additive and modification reaction time of modifier.
Be used for the PEG modifier of specificity site sulfydryl modification according to different the mainly contain maleimide PEG modifier (mPEG-maleimides of PEG activating group with modification reaction mechanism, mPEG-MAL), ethene sulfuryl PEG modifier (mPEG-vinylsulfone, mPEG-VS), iodo-acid amide PEG modifier (mPEG-iodoacetamide, mPEG-IA) with adjacent pyridyl disulfide PEG modifier (mPEG-orthopyridyl disulfide, mPEG-OPSS), structure respectively following (mainly provide the structure of activating group as example arrangement, but activating group be not limited to a mPEG be connected).
Maleimide PEG modifier:
Ethene sulfuryl PEG modifier:
Iodo-acid amide PEG modifier:
Adjacent pyridyl disulfide PEG modifier:
The mechanism that the above two modify sulfydryl is and two key addition reactions take place sulfydryl, and both mechanism of modifying sulfydryl of back are and sulfydryl generation disulfide linkage replacement(metathesis)reaction.Wherein preferably use mPEG-MAL, because it has speed of response faster, even under acidic conditions, also can carry out modification reaction.The molecular weight of PEG modifier can be between 5KDa-40KDa, but because low-molecular-weight PEG modifier is not obvious to the effect that prolongs the interferon alpha transformation period, it is serious that its biological activity is descended, and the molecular weight of therefore preferred PEG modifier is between 10KDa-20KDa.
Improve the speed that temperature can improve modification reaction in the modification, but also can accelerate hydrolysis or the oxidation rate of modifier simultaneously, also be unfavorable for the stable of Interferon alfacon-1 cysteine mutant, therefore suitable modification reaction temperature is 2-40 ℃, preferred modification reaction temperature is 2-25 ℃, and optimum modification reaction temperature is 2-10 ℃.
Improve the speed that protein concn can improve modification reaction in the modification, but be unfavorable for the stable of protein, therefore the concentration of suitable Interferon alfacon-1 cysteine mutant is 2-20mg/ml, and preferred concentration is 1-10mg/ml, and optimum concentration is 2-5mg/ml.
In order to reach this protein concn, need concentrate the Interferon alfacon-1 cysteine mutant, also can be transformed into pH and buffering solution required simultaneously.That concentration method commonly used includes but not limited to is anti-molten behind the organic solvent deposit, anti-molten after saltouing, ultrafiltration, polyoxyethylene glycol concentrate, chromatographic separation etc.
The pH that needs in the modification is relevant with the mechanism of modification reaction, pH when mPEG-MAL modifies as mentioned before can hang down, even can arrive acid range, and the pH of mPEG-VS when modifying must be medium-sized or alkaline, but the weakly alkaline environment of 7.0-9.0 relatively more suitable modification reaction all in general.Modification reaction speed was slower when the pH of modification was lower than this pH scope; Though and modification reaction speed is fast when being higher than this pH scope, Interferon alfacon-1 cysteine mutant instability easily forms intermolecular disulfide bond and significantly reduces the total amount of modifiable Interferon alfacon-1 cysteine mutant molecule.
Raising or reduction protein/modifier quality or mol ratio all can improve speed of response in the modification.From the angle that improves PEG modifier utilization ratio consider the to increase input amount of Interferon alfacon-1 cysteine mutant of reaction, from the angle that improves Interferon alfacon-1 cysteine mutant transformation efficiency consider then should the to increase input amount of PEG modifier of reaction, specifically how to handle and to look particular case and determine that (utilization ratio of paying the utmost attention to modifier is still paid the utmost attention to the utilization ratio of protein, the cost ratio that depends on both to a great extent), but Shi Yi ratio should be 1 generally speaking: 8-8: between 1, preferred ratio is 1: 4-4: between 1, optimum ratio is 1: 2-2: between 1.
Increase to stir the speed that can improve modification reaction in the modification, especially for the slower modification reaction of speed of response on modifying mechanism.But too fast stirring is unfavorable to stablizing of protein, simultaneously also can't further accelerate the speed of modification reaction, therefore suitable modification reaction stirring velocity is between 0-40 rev/min, and preferred speed is between 1-20 rev/min, and optimum speed is between 2-10 rev/min.
Add some material in the modification or in protein buffer solution, exist some material also can influence the speed of modification reaction, as add the tensio-active agent of some type or in protein buffer solution, have NaCl with high concentration, but specifically influence rule owing to adding and existing substance classes numerous, can select concentration range wide, so can not be discussed, need particular problem specifically to study without exception.
The time of modification reaction is all relevant with above-mentioned each influence factor, in general prolonging the modification reaction time all can improve the modification reaction yield, but the time can become not obvious above this rule after a certain threshold value, and also can be unfavorable to stablizing of Interferon alfacon-1 cysteine mutant, can reduce the economic benefit of reaction process, therefore the suitable modification reaction time, the preferred time, the optimum time was between 1-12 hour between 0.5-24 hour between 0.5-48 hour.
Contain the Interferon alfacon-1 cysteine mutant of the PEG modifier that has neither part nor lot in modification reaction, not adorned Interferon alfacon-1 cysteine mutant, unit point modification and the Interferon alfacon-1 cysteine mutant that a small amount of multidigit point is modified in principle in the modification reaction mixture of modification reaction termination back, must remove the Interferon alfacon-1 cysteine mutant composition in addition that unit point PEG modifies by follow-up separation and purification process.
Utilize the Interferon alfacon-1 cysteine mutant molecule of target unit point PEG modification and impurity molecule has notable difference at molecular weight characteristics, can adopt gel chromatography (gel filtration chromatography, GFC) or molecular-exclusion chromatography (size exclusion chromatography, SEC) they are separated, the filler that can adopt includes but not limited to Sephacryl S-100, Sephacryl S-200, Sephadex G-25, Sephadex G-50, Sephadex G-75, Superdex 75, TSKgel HW-50, TSKgel HW-55 etc.
Because what the sulfydryl modification agent was modified is the halfcystine site of protein, can make protein lose the electronegative group that dissociates after the modification, and other charged group that might masking protein matter, and connect the more big modifier of molecular weight or connect the back effect of modifier molecule of more number more obvious.Therefore can utilize the change of modifying front and back this charge property of protein molecule that Interferon alfacon-1 cysteine mutant molecule and the impurity that target unit point PEG modifies is carried out ion-exchange chromatography (ion exchange chromatography, IEC) separate, the filler that can adopt includes but not limited to DEAE Sepharose FF, Q Sepharose FF, CM Sepharose FF, SP Sepharose FF, DEAE Sepharose CL-6B, Source 15, Source 30, TSKgel CM-650, TSKgel DEAE-650, TSKgel QAE-550, TSKgel SP-650, TSKgel CM-5PW, TSKgel DEAE-5PW etc.In this purge process, because PEG modifier neutral, so in last sample process, can not be adsorbed.
Because PEG is the molecule of a not only hydrophilic but also close ester, for the close ester performance that can improve protein molecule behind the modifying protein molecule, and molecular weight is more big, how this more raising of molecule number that connects be more obvious, therefore can utilize the change of modifying front and back this hydrophobic performance of protein molecule that Interferon alfacon-1 cysteine mutant molecule and the impurity that target unit point PEG modifies is carried out hydrophobic interaction chromatography (hydrophobic interaction chromatography, HIC) separate, the filler that can adopt includes but not limited to Phenyl Sepharose 6FF, Butyl Sepharose 4FF, Source 15PHE, Source 15ETH, TSKgel Ether-5PW, TSKgel Phenyl-5PW etc.
Polyethyleneglycol modified dose of modified derivative of Interferon alfacon-1 cysteine mutant sulfydryl that purifying obtains also needs to carry out evaluations such as purity, molecular weight, biologic activity, stability, medicine generation, security, the Interferon alfacon-1 cysteine mutant of the same described unmodified of method.
In a kind of embodiment that is more preferably, molecular weight of the present invention polyethyleneglycol modified dose is between 10KDa-20KDa.
The 3rd purpose of the present invention provides the preparation method of above-mentioned Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative, comprises the steps:
1) the concentrated described Interferon alfacon-1 cysteine mutant solution of preparation, make its concentration reach 2.0-20mg/ml, and make the residing buffer solution system of described Interferon alfacon-1 cysteine mutant be converted to the suitable buffer solution system that carries out polyethyleneglycol modified reaction;
2) the above-mentioned Interferon alfacon-1 cysteine mutant solution that concentrates that obtains is contacted with polyethyleneglycol modified dose carry out modification reaction;
3) mixture that obtains behind the modification reaction is carried out chromatographic separation and purification, removing polyethyleneglycol modified dose of wherein having neither part nor lot in modification reaction and to have neither part nor lot in the described Interferon alfacon-1 cysteine mutant of modification reaction, and remove the Interferon alfacon-1 cysteine mutant sulfydryl polyethyleneglycol derivative that is connected with a plurality of peg molecules.
The 4th purpose of the present invention provides the pharmaceutical composition of above-mentioned Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative.
In the embodiment on basis, contain the described Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative for the treatment of significant quantity and safe dose in the composition of the present invention, and pharmaceutically acceptable carrier of sufficient quantity.
Last purpose of the present invention provides above-mentioned Interferon alfacon-1 cysteine mutant and the purposes of polyethyleneglycol derivative in the medicine of preparation treatment virus disease thereof.
Interferon alfacon-1 cysteine mutant of the present invention and polyethyleneglycol derivative thereof have identical target indication with the Interferon alfacon-1 of not sudden change, because Interferon, rabbit is to the extensive restraining effect of virus replication, so they are all effective in cure to nearly all disease of viral infection, especially aspect treatment hepatitis B and/or hepatitis C, have quite than the natural interferon alpha molecule or better in the body or external drug effect.
The term that uses among the present invention " interferon-alpha " or " interferon alpha " comprise the natural anti-virus active substance that human body or animal body are produced by white corpuscle under extraneous pathogenicity bo material incentive, also comprise select by gene engineering method that suitable expression vector expresses with the identical recombinant molecule of above-mentioned native sequences, the molecule that also comprises the artificial design of the integrated above-mentioned natural interferon alpha conserved sequence of selecting by gene engineering method that suitable expression vector expresses, i.e. Interferon alfacon-1 molecule.
The term that uses among the present invention " Interferon alfacon-1 " (consensus interferon or integrated interferon) only refers to have the Interferon alfacon-1 of aminoacid sequence shown in the SEQ ID No.3 in the application documents except specification sheets background technology part, this Interferon alfacon-1 has a detailed description (being called as " New-type alpha-interferon mutant " therein, corresponding to the sequence 3 in the sequence table) in Chinese patent application CN02159950.5.
The term that uses among the present invention " polyethyleneglycol modified dose ", also be that " PEG modifier " refers to the mono methoxy polyethylene glycol modifier, also namely with a hydroxyl of methoxyl group sealing peg molecule one end, and activate the activated polyethylene glycol of gained behind the hydroxyl of the other end with suitable activation method.Because the reactive behavior of hydroxyl self is very low, so the reactive behavior of the peg molecule behind overactivation is greatly improved, just can be called as " polyethyleneglycol modified dose ".About the mechanism of the selection of activating group, activation and polyethyleneglycol modified dose modification reaction mechanism of activation gained a lot of bibliographical informations are arranged in the prior art, as U.S. Nektar company (former Shearwater company) apply for and obtained the authorization many pieces relevant polyethyleneglycol modified dose patent." polyethyleneglycol modified dose of sulfydryl " of the present invention is to have neither part nor lot in polyethyleneglycol modified dose of the free sulfhydryl groups that forms disulfide linkage in the narrow spectrum modifying protein molecule, can obtain or pass through known activating mechanism activation preparation, especially mPEG-MAL and mPEG-VS by the commercial channel can be from external Nektar company's purchase or from the domestic company's purchase that comprises the professional activated PEG modifier of Jiankai Science and Technology Co., Ltd., Beijing, Beijing Kaizheng Biotech Engineering Development Co., Ltd..
The term that uses among the present invention " polyethyleneglycol modified " refers to polyethyleneglycol modified agent molecule is arrived with the protein molecule chemical coupling.Polyethyleneglycol modified dose the group that participates in linked reaction is its activating group of introducing in reactivation process, the group of protein mainly is amino group, mercapto groups, carboxylic group or the oh group that wherein dissociates, preferably amino group or mercapto groups.
Embodiment
By following embodiment enforcement of the present invention is described further, but embodiments of the present invention are not limited to following embodiment.
Embodiment 1: the expression engineering bacteria of Interferon alfacon-1 109 site cysteine mutants makes up with sequence to be confirmed
Extract the plasmid of Interferon alfacon-1 as template, first run PCR comprises two reaction systems.
Reaction system 1 primer is:
P1：ATGTGTGACCTGCCGCAGAC，
P4：CTATTAGTCTTTACGACGCAG，
The dna sequence dna of 109 sites and upstream thereof increases.
Reaction system 2 primers are:
P2：GTTCATCAGCGGGCATTCTTCAAC，
P3：CCGCTGATGAACGTTGACTG，
The dna sequence dna in 109 sites and downstream thereof increases.
Reaction conditions is: 95 ℃, and 4 minutes, 95 ℃, 1 minute, 56 ℃ then, 2 minutes, 72 ℃, totally 30 circulations in 2 minutes.
Second to take turns PCR be template with the product of first round PCR, is that primer carries out pcr amplification with P1, P2.Reaction conditions is: 95 ℃, and 4 minutes, 95 ℃, 1 minute, 56 ℃ then, 2 minutes, 72 ℃, totally 30 circulations in 2 minutes.
Second takes turns the PCR product through agarose electrophoretic analysis, selects the dna fragmentation about 720bp, and with Nde I/EcoR I double digestion, electrophoresis reclaims the target DNA fragment about 500bp.
The pET-23b plasmid vector with Nde I/EcoR I double digestion, is connected through the agarose electrophoresis recovery and with above-mentioned second target DNA fragment of taking turns the PCR recovery.The ligation condition is: 2 * Rapid buffer 4-5 μ l, T4DNALagase 1 μ l, purpose fragment 1-2 μ l, carrier 3 μ l, 4 ℃ of connections of spending the night.
Preparation e. coli jm109 or DH5 α competent cell transform above-mentioned connection product, coating ammonia benzyl flat board, 37 ℃ of incubated overnight.
Picking list bacterium colony is as template, increases with primer P1, the P2 of above-mentioned design, and product detects through agarose electrophoresis, and specific band appears in positive colony about 720bp; Get positive colony and cultivate in a small amount, extract plasmid Nde I/EcoR I double digestion.Specific band occurring about 3kb and about 500bp, conform to the expectation situation respectively, the construction of recombinant plasmid success tentatively is described.For further confirming its sequence, with the T7 universal primer ABI377 sequenator is carried out full-automatic sequencing.
Embodiment 2: fermentation, purifying and the detection of Interferon alfacon-1 109 site cysteine mutants
To make up with the method for embodiment 1 and obtain colibacillus engineering, (every liter with peptone 10g, yeast powder 5g, NaCl 10g preparation in the LB substratum that contains penbritin to select single colony inoculation after being coated with dull and stereotyped activation, regulating pH is 7.0), 37 ℃, 220 rev/mins shaking table shake-flask culture are to OD
600nmBe 0.6-0.8.Be inoculated in the LB substratum of 50L with 5% volume inoculum size then and in the 80L fermentor tank, carry out fermentation culture (every liter contains 0.1% penbritin), culture temperature is 37 ℃, regulate pH between 6.5-7.5 with ammoniacal liquor in the culturing process, control oxygen dissolving value between 3-5% with rotating speed.At OD
600nmReach 1.0 backs and add IPTG 10g in 1: 5000 ratio of mass volume ratio and continued inducing culture 3 hours, the inducing culture temperature is 35 ℃, and in this process in the fermentor tank the suitable LB substratum of adding.The inducing culture time to after put 5000 rev/mins of jar room temperatures and collected thalline in centrifugal 20 minutes, the gained thalline with above-mentioned TE damping fluid washed twice to remove the major impurity in the fermented liquid.
Get thalline 40g that above-mentioned processing obtains with 1: 15 mass volume ratio add the above-mentioned TE damping fluid of 600ml and then by volume 100: 1 ratio of mass ratio add N,O-Diacetylmuramidase and handle more than 4 hours, 6000 rev/mins of broken liquid chamber temperature of gained were abandoned supernatant in centrifugal 20 minutes, precipitation adds TE damping fluid (the 50mmol/L Tris-HCl that contains surfactant SDS with 1: 10 mass volume ratio, 5mmol/L EDTA, 0.3%SDS, pH8.0) after centrifugal twice of the washing again with the TE damping fluid washing that does not contain tensio-active agent three times to remove the SDS that introduces in the impurity introduced in the supernatant of broken back and the washing process respectively.
Gained 10g inclusion body adds 150ml with 1: 15 mass volume ratio and contained behind the 8mol/L urea of 5mmol/L mercaptoethanol under appropriate agitation condition denaturing treatment 4 hours, treat that inclusion body dissolves 8000 rev/mins of the room temperatures in back fully and abandoned precipitation in centrifugal 20 minutes, supernatant carries out renaturation with the on-column refolding method in room temperature to be handled.Concrete grammar is: use 50mol/L Tris-HCl, 5mmol/L EDTA, 4M urea, 3-5 column volume of pH8.0 eluant solution earlier behind the DEAE Sepharose FF post on the sex change liquid; Use 50mol/L Tris-HCl again, 5mmol/L EDTA, 2M urea, 3-5 column volume of pH8.0 solution washing; Use 50mol/L Tris-HCl again, 5mmol/L EDTA, 1M urea, 3-5 column volume of pH8.0 solution washing; Use 50mol/L Tris-HCl damping fluid again, 3mmol/L Sleep-promoting factor B, 1mmol/L reduced glutathion, 5mmol/L EDTA, 50mmol/L arginine, pH 8.0 a solution washing 5-8 column volume; Using 50mmol/L Tris-HCl, to contain the 50mmol/L Tris-HCl of 0.3mol/L NaCl, the pH8.0 eluant solution is collected elution peak behind 3-5 column volume of pH8.0 solution flushing.The above-mentioned linear rate of flow of going up in sample, flushing and the elution process should be controlled between 50-200cm/h.
DEAE Sepharose FF elution peak mixes with 50% ammonium sulfate (quality volumetric concentration) by 2: 3 volume ratio, regulating pH is that go up with the 50mmol/L Tris-HCl that contains 20% ammonium sulfate 8.0 backs, Phenyl Sepharose 6FF (Low sub) chromatographic column of pH8.0 solution equilibria, using the 50mmol/LTris-HCl that contains 20% ammonium sulfate, use 50mmol/L Tris-HCl behind 3-5 volume of pH8.0 solution flushing post, the pH8.0 eluant solution is collected target peak.The above-mentioned linear rate of flow of going up in sample, flushing and the elution process should be controlled between 50-200cm/h.Wash-out is collected target peak and is used for preserving if be not used in follow-up polyethyleneglycol modified reaction, be that the Millipore ultra-filtration centrifuge tube of 3000Da changes solution-treated with molecular weight cut-off then, buffered soln is converted to contain 25mmol/L acetic acid-sodium-acetate of 0.5mol/LNaCl, pH4.5 solution, the liquor capacity after the conversion is preceding basic identical with conversion.
Add the purity that coomassie brilliant blue staining method and size-exclusion HPLC method detect the Interferon alfacon-1 109 site cysteine mutants that above-mentioned Phenyl Sepharose 6FF (Low sub) chromatographic column separation and purification and the conversion buffered liquid of ultrafiltration obtains respectively with the SDS-PAGE electrophoresis, the result is all more than 97%.Detecting its molecular weight with the MALDI-TOF mass spectroscopy is 19412.18 (reduced states), with the theoretical value deviation be 0.43 (theoretical value is 19411.75 under the reduced state)." interferon activity assay method " and " protein determination " with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " regulation determines that its specific activity is 7.4 * 10
8IU/mg, the activity that contrasts the Interferon alfacon-1 that do not suddenly change is 5.2 * 10
8IU/mg.
Embodiment 3: fermentation, purifying and the detection of Interferon alfacon-1 110 site cysteine mutants
With making up the colibacillus engineering bacterial classification that obtains expressing Interferon alfacon-1 110 site cysteine mutants with the identical method of embodiment 1 principle, carry out actication of culture and shake-flask culture by the method for embodiment 2 then.The LB of volume inoculum size inoculation 50L with 4% cultivates and carry out fermentation culture after in the 80L fermentor tank, condition such as embodiment 3, but the inducing culture temperature is 36 ℃.The inducing culture time to after put 5000 rev/mins of jar room temperatures and collected thalline in centrifugal 20 minutes, the gained thalline with above-mentioned TE damping fluid washed twice to remove the major impurity in the fermented liquid.
Get thalline 40g that above-mentioned processing obtains and add the above-mentioned TE damping fluid of 600ml with the ball mill break process more than 2 hours with 1: 15 mass volume ratio, 6000 rev/mins of broken liquid chamber temperature of gained were abandoned supernatant in centrifugal 20 minutes, precipitation adds TE damping fluid (the 50mmol/L Tris-HCl that contains tensio-active agent TritonX-100 with 1: 10 mass volume ratio, 5mmol/L EDTA, 0.5%TritonX-100, pH8.0) after centrifugal twice of the washing again with the TE damping fluid washing that does not contain tensio-active agent three times to remove the SDS that introduces in the impurity introduced in the supernatant of broken back and the washing process respectively.
Gained 10g inclusion body adds 150ml with 1: 15 mass volume ratio and contained behind the 8mol/L urea of 5mmol/LDTT under appropriate agitation condition denaturing treatment 4 hours, treat that inclusion body dissolves 8000 rev/mins of the room temperatures in back fully and abandoned precipitation in centrifugal 20 minutes, the supernatant priority is to the 25mmol/L Tris-HCl of 10 times of volumes, 4mol/L urea, pH8.0 solution, 25mmol/L Tris-HCl, 2mol/L urea, pH8.0 solution, 25mmol/L Tris-HCl, 1mol/L urea, pH8.0 solution and 25mmol/L Tris-HCl, pH8.0 solution carries out dialysis treatment, gained sees through 2mol/L acetic acid-sodium-acetate that liquid adds 1/20 volume, again to the 25mmol/L acetic acid-sodium-acetate of 100 times of volumes, the pH4.5 damping fluid carried out dialysis treatment more than 12 hours after the pH4.5 damping fluid.
See through on the liquid with 25mmol/L acetic acid-sodium-acetate, the CM Sepharose FF chromatographic column of pH4.5 damping fluid balance.Continue 1-3 column volume of flushing chromatographic column with level pad earlier after the completion of the sample, using the 25mmol/L acetic acid-sodium-acetate that contains 0.1-0.15mol/LNaCl then, the pH4.5 buffer solution elution is used the 25mmol/L acetic acid-sodium-acetate that contains 0.5mol/L NaCl after removing the major impurity peak, and the pH4.5 buffer solution elution is collected target peak.The above-mentioned linear rate of flow of going up in sample, flushing and the elution process should be controlled between 50-200cm/h.
Add the purity that coomassie brilliant blue staining method and size-exclusion HPLC method detect the Interferon alfacon-1 110 site cysteine mutants that the separation and purification of above-mentioned CM Sepharose FF chromatographic column obtains respectively with the SDS-PAGE electrophoresis, the result is all more than 97%.Detecting its molecular weight with the MALDI-TOF mass spectroscopy is 19415.34 (reduced states), with the theoretical value deviation be-0.41 (theoretical value is 19415.75 under the reduced state)." interferon activity assay method " and " protein determination " with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " regulation determines that its specific activity is 6.8 * 10
8IU/mg, the activity that contrasts the Interferon alfacon-1 that do not suddenly change is 5.2 * 10
8IU/mg.
Embodiment 4: 25 ℃ of stability test results of Interferon alfacon-1 109,110 site cysteine mutants
25 ℃ of stability test results of table 1 Interferon alfacon-1 109 site cysteine mutants
25 ℃ of stability test results of table 2 Interferon alfacon-1 110 site cysteine mutants
Embodiment 5: mPEG-MAL modification, product purification and the detection of Interferon alfacon-1 109 site cysteine mutants
The buffered soln of the Interferon alfacon-1 109 site cysteine mutants that obtain with Phenyl Sepharose 6FF (Low sub) filled column separation and purification is 25mmol/L Tris-HCl, pH8.0 solution, meet with mPEG-MAL and modify required pH, but concentration has only 0.2mg/ml, do not reach the requirement of modification reaction, therefore need carry out concentration to it at modification reaction, the way of taking is chromatography.To use the 25mmol/L Tris-HCl of the NaCl that contains 0.5mol/L behind the DEAE SepharoseFF filled column on this mutant solution, pH8.0 solution carries out wash-out and obtains the concentrated mutant solution that concentration reaches 3.0mg/ml.
1) molecular weight is that the modification reaction of the mPEG-MAL of 20KDa separates, detects with modified outcome
Get the mutant solution 50ml after above-mentioned concentrate, adding the 300mg molecular-weight average by 1: 2 mass ratio is Jiankai Science and Technology Co., Ltd., Beijing's commercial mPEG-MAL strand modifier of 20KDa, puts cold compartment of refrigerator speed with 10 rev/mins on horizontal shaking table and jolts reaction 18 hours.
Reaction times, with 1000ml 25mmol/L acetic acid-sodium-acetate, pH4.5 solution dilution reaction solution (20 times of volume dilution) was gone up the CM650S filled column with same damping fluid balance then with termination reaction to the back, and unmodified PEG modifier stream in last sample process is worn.Using the 25mmol/L acetic acid-sodium-acetate that contains 60mmol/L NaCl, use the 25mmol/L acetic acid-sodium-acetate that contains 0.2mol/L NaCl behind the pH4.5 eluant solution modifier impurity, pH4.5 eluant solution purpose modifier, at last with the 25mmol/L acetic acid-sodium-acetate that contains 0.5mol/L NaCl, the not adorned Interferon alfacon-1 cysteine mutant of pH4.5 eluant solution.Last sample in this sepn process, flushing and wash-out linear rate of flow should be controlled between 40-150cm/h.
Add the coomassie brilliant blue staining method with the SDS-PAGE electrophoresis and detect the purity of separating the polyethyleneglycol derivative that obtains respectively with size-exclusion HPLC method, the result is all more than 97%.Detecting its molecular weight with the MALDI-TOF mass spectroscopy is 39434.31." interferon activity assay method " and " protein determination " with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " regulation determines that its specific activity is 8.3 * 10
7IU/mg, activity is left 12.77%.
2) molecular weight is that the modification reaction of the mPEG2-MAL of 40KDa separates, detects with modified outcome
Utilizing the commercial molecular weight in Jiankai Science and Technology Co., Ltd., Beijing is the modifier mPEG2-MAL modification Interferon alfacon-1 109 site cysteine mutants with branch's duplex structure of 40KDa, modification reaction condition, method and the modification reaction of the same 20KDa mPEG-MAL of modification after product separation method and separating of modified outcome.
Add the coomassie brilliant blue staining method with the SDS-PAGE electrophoresis and detect the purity of separating the polyethyleneglycol derivative that obtains respectively with size-exclusion HPLC method, the result is all more than 97%.Detecting its molecular weight with the MALDI-TOF mass spectroscopy is 59613.35." interferon activity assay method " and " protein determination " with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " regulation determines that its specific activity is 6.0 * 10
7IU/mg, activity is left 8.11%.
3) molecular weight is that the modification reaction of the mPEG-MAL of 10KDa separates with modified outcome
Get the mutant solution 50ml after above-mentioned concentrate, adding the 300mg molecular-weight average by 1: 2 mass ratio is the commercial strand mPEG-MAL in the Jiankai Science and Technology Co., Ltd., Beijing modifier of 10KDa, puts cold compartment of refrigerator speed with 10 rev/mins on horizontal shaking table and jolts reaction 18 hours.
Reaction times, with 1000ml 25mmol/L acetic acid-sodium-acetate, pH4.5 solution dilution reaction solution (20 times of volume dilution) was gone up the CM650S filled column with same damping fluid balance then with termination reaction to the back, and unmodified PEG modifier stream in last sample process is worn.Using the 25mmol/L acetic acid-sodium-acetate that contains 75mmol/L NaCl, use the 25mmol/L acetic acid-sodium-acetate that contains 0.2mol/L NaCl behind the pH4.5 eluant solution modifier impurity, pH4.5 eluant solution purpose modifier, at last with the 25mmol/L acetic acid-sodium-acetate that contains 0.5mol/L NaCl, the not adorned Interferon alfacon-1 cysteine mutant of pH4.5 eluant solution.Last sample in this sepn process, flushing and wash-out linear rate of flow should be controlled between 40-150cm/h.
Add the coomassie brilliant blue staining method with the SDS-PAGE electrophoresis and detect the purity of separating the polyethyleneglycol derivative that obtains respectively with size-exclusion HPLC method, the result is all more than 97%.Detecting its molecular weight with the MALDI-TOF mass spectroscopy is 29422.38." interferon activity assay method " and " protein determination " with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " regulation determines that its specific activity is 1.8 * 10
8IU/mg, activity is left 24.32%.
4) molecular weight is that the modification reaction of the mPEG-MAL of 5KDa separates, detects with modified outcome
Modify Interferon alfacon-1 109 site cysteine mutants with the Jiankai Science and Technology Co., Ltd., Beijing of 5KDa commercial mPEG-MAL strand modifier, the modification reaction of modification reaction condition, method and the same 10KDa mPEG-MAL of modification after product separation method separates with modified outcome.
Add the coomassie brilliant blue staining method with the SDS-PAGE electrophoresis and detect the purity of separating the polyethyleneglycol derivative that obtains respectively with size-exclusion HPLC method, the result is all more than 97%.Detecting its molecular weight with the MALDI-TOF mass spectroscopy is 24428.57." interferon activity assay method " and " protein determination " with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " regulation determines that its specific activity is 3.4 * 10
8IU/mg, activity is left 45.95%.
Embodiment 6: mPEG-MAL modification, product purification and the detection of Interferon alfacon-1 110 site cysteine mutants
With mPEG-MAL (the molecular weight 20KDa that can prepare Interferon alfacon-1 110 site cysteine mutants with embodiment 5 identical methods, strand) derivative, add the coomassie brilliant blue staining method and size-exclusion HPLC method detects its purity respectively with the SDS-PAGE electrophoresis, the result is all more than 97%.Detecting its molecular weight with the MALDI-TOF mass spectroscopy is 39428.63." interferon activity assay method " and " protein determination " with " Pharmacopoeia of People's Republic of China 2010 editions (three ones) " regulation determines that its specific activity is 8.6 * 10
7IU/mg, activity is left 12.65%.
Embodiment 7: 25 ℃ of stability test results of Interferon alfacon-1 109,110 site cysteine mutant mPEG-MAL modified outcomes
Table 3 Interferon alfacon-1 109 site cysteine mutant mPEG-MAL (molecular weight 20KDa, strand)
25 ℃ of stability test results of modified outcome
Table 4 Interferon alfacon-1 109 site cysteine mutant mPEG-MAL (molecular weight 10KDa, strand)
25 ℃ of stability test results of modified outcome
Table 5 Interferon alfacon-1 110 site cysteine mutant mPEG-MAL (molecular weight 20KDa, strand)
25 ℃ of stability test results of modified outcome
Embodiment 8: the pharmacokinetics test of Interferon alfacon-1 109,110 site cysteine mutants and mPEG-MAL modified outcome thereof
Get body weight and be 36 of SD rats about 300g, be divided into 6 groups, 6 every group, male and female half and half.Group 1 is to the subcutaneous single injection Interferon alfacon-1 109 site cysteine mutants of group 6 difference, Interferon alfacon-1 110 site cysteine mutants, Interferon alfacon-1, Interferon alfacon-1 109 site cysteine mutant mPEG-MAL (molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 109 site cysteine mutant mPEG-MAL (molecular weight 10KDa, strand) mono-modified product, Interferon alfacon-1 110 site cysteine mutant mPEG-MAL (molecular weight 20KDa, strand) mono-modified product, respectively at 0,0.2,0.5,0.75,1,2,4,8,12,24,48,72,96, blood was got on the eyeground in 168 hours, measured wherein interferon biological activity behind the centrifugal collection serum.Obtain main pharmacokinetic parameter shown in following table 6 and table 7 by the measurement result mean value calculation.
Calculate behind table 6SD rat single subcutaneous injection Interferon alfacon-1 cysteine mutant or the Interferon alfacon-1 and obtain
Main pharmacokinetic parameter
| The PK parameter | Group 1 | Group 2 | Group 3 |
| Dosage | 3.0×10 6IU | 3.0×10 6IU | 3.0×10 6IU |
| t1/2Ka(h) | 0.32 | 0.41 | 0.27 |
| t1/2Ke(h) | 1.81 | 1.93 | 1.62 |
| Tpeak(h) | 1.08 | 1.19 | 0.81 |
| Cpeak(IU/ml) | 24155 | 24903 | 22405 |
| AUC(IU·h/ml) | 105774 | 113684 | 70181 |
Calculate behind the table 7SD rat single subcutaneous injection Interferon alfacon-1 cysteine mutant polyethyleneglycol derivative
The main pharmacokinetic parameter that arrives
| The PK parameter | Group 4 | Group 5 | Group 6 |
| Dosage | 3.0×10 6IU | 3.0×10 6IU | 3.0×10 6IU |
| t1/2Ka(h) | 17.2 | 15.0 | 17.3 |
| t1/2Ke(h) | 21.0 | 18.2 | 20.6 |
| Tpeak(h) | 29.1 | 23.2 | 29.2 |
| Cpeak(IU/ml) | 17083 | 22245 | 17167 |
| AUC(IU·h/ml) | 1258731 | 991325 | 1253466 |
Embodiment 10: the acute toxicity test in mice of Interferon alfacon-1 109,110 site cysteine mutant mPEG-MAL modified outcomes
Get body weight and be 48 of mouse about 20g, be divided into 4 groups, 12 every group.Group 1 is to the subcutaneous single injection Interferon alfacon-1 of group 4 difference, Interferon alfacon-1 109 site cysteine mutant mPEG-MAL (molecular weight 20KDa, strand) mono-modified product, Interferon alfacon-1 109 site cysteine mutant mPEG-MAL (molecular weight 10KDa, strand) mono-modified product, the mono-modified product of Interferon alfacon-1 110 site cysteine mutant mPEG-MAL (molecular weight 20KDa, strand).The injection back was observed 14 days continuously, except having 4 dead mouses other organize, group 1 do not see any unusual performance, show mouse to the maximum tolerated dose of Interferon alfacon-1 109,110 site cysteine mutant mPEG-MAL modified outcomes all more than 6.4mg/Kg, be equivalent to 3840 times of the clinical consumption of people.Interferon alfacon-1 109,110 site cysteine mutant mPEG-MAL modified outcomes obviously improve than the security of Interferon alfacon-1.
Claims (7)
1. the Interferon alfacon-1 mutant is characterized in that with the 109th amino acid mutation from N end meter in the Interferon alfacon-1 aminoacid sequence be halfcystine, and aminoacid sequence is shown in SEQ ID No.1.
2. the polyethyleneglycol derivative of Interferon alfacon-1 mutant according to claim 1, it is characterized in that described polyethyleneglycol derivative is connected with polyethyleneglycol modified dose by described Interferon alfacon-1 mutant obtains, and described polyethyleneglycol modified dose molecular weight is between 5KDa-40KDa.
3. polyethyleneglycol derivative according to claim 2, it is characterized in that described polyethyleneglycol modified dose is polyethyleneglycol modified dose of sulfydryl, be selected from a kind of in maleimide PEG modifier, ethene sulfuryl PEG modifier, iodo-acid amide PEG modifier or the adjacent pyridyl disulfide PEG modifier.
4. polyethyleneglycol derivative according to claim 2 is characterized in that described polyethyleneglycol modified dose molecular weight is between 10KDa-20KDa.
5. according to the preparation method of one of claim 2-4 described polyethyleneglycol derivative, comprise the steps:
1) the concentrated described Interferon alfacon-1 mutant solution of preparation makes its concentration reach 2.0-20mg/ml, and makes the residing buffer solution system of described Interferon alfacon-1 mutant be converted to the suitable buffer solution system that carries out polyethyleneglycol modified reaction;
2) the above-mentioned Interferon alfacon-1 mutant solution that concentrates that obtains is contacted with described polyethyleneglycol modified dose carry out modification reaction;
3) mixture that obtains behind the modification reaction is carried out chromatographic separation and purification, removing polyethyleneglycol modified dose of wherein having neither part nor lot in modification reaction and to have neither part nor lot in the described Interferon alfacon-1 mutant of modification reaction, and remove the Interferon alfacon-1 polyethyleneglycol derivative that is connected with a plurality of peg molecules.
6. according to the pharmaceutical composition of one of claim 2-4 described polyethyleneglycol derivative, it is characterized in that containing treatment significant quantity and the described polyethyleneglycol derivative of safe dose and pharmaceutically acceptable carrier of sufficient quantity.
7. according to the described Interferon alfacon-1 mutant of one of claim 1-4 or its polyethyleneglycol derivative purposes in the medicine of preparation treatment virus disease.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210043375 CN102532299B (en) | 2012-02-23 | 2012-02-23 | Interferon alpha mutant and polyethylene glycol derivative thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210043375 CN102532299B (en) | 2012-02-23 | 2012-02-23 | Interferon alpha mutant and polyethylene glycol derivative thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310196263.XA Division CN103288949B (en) | 2012-02-23 | 2012-02-23 | Interferon alpha mutant and polyethylene glycol derivative thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102532299A CN102532299A (en) | 2012-07-04 |
| CN102532299B true CN102532299B (en) | 2013-07-17 |
Family
ID=46340450
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210043375 Active CN102532299B (en) | 2012-02-23 | 2012-02-23 | Interferon alpha mutant and polyethylene glycol derivative thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102532299B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1511849A (en) * | 2002-12-30 | 2004-07-14 | 北京三元基因工程有限公司 | Novel alpha interferon mutant and its preparing process |
| EP2476428B1 (en) * | 2005-06-29 | 2013-08-21 | Yeda Research and Development Co. Ltd. | Recombinant interferon alpha 2 (IFN alpha 2) mutants |
| CN1970572A (en) * | 2006-12-21 | 2007-05-30 | 北京三元基因工程有限公司 | Interferon alpha mutant and its polyethylene glycol derivative |
| CN101921329B (en) * | 2010-04-19 | 2013-01-23 | 北京三元基因工程有限公司 | Alpha interferon mutant and polyethylene glycol derivative thereof |
-
2012
- 2012-02-23 CN CN 201210043375 patent/CN102532299B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN102532299A (en) | 2012-07-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101547935B (en) | Interferon alpha mutant and its polyethylene glycol derivative | |
| CN101921329B (en) | Alpha interferon mutant and polyethylene glycol derivative thereof | |
| CN101514229B (en) | Human interferon alpha derivative and polyethylene glycol modified substance thereof | |
| CN103923209A (en) | Lambda interferon mutant and polyethylene glycol derivative | |
| CN102286490B (en) | Preparation and renaturation method of chicken interferon gamma | |
| CN101280001B (en) | Preparation of human SDF-1 alpha, human SDF-1 alpha obtained therefrom and use thereof | |
| CN102532300B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN103145826B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN103288947B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN102532299B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN103554246B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN102558337B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN102584981B (en) | Mutant of interferon alpha and polyethylene glycol derivatives of mutant | |
| CN103288948B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN102584980B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN103467592B (en) | Interferon alpha mutant and polyethylene glycol derivate thereof | |
| CN103288949B (en) | Interferon alpha mutant and polyethylene glycol derivative thereof | |
| CN103113465B (en) | Interferon-alpha mutant and polyethylene glycol derivative thereof | |
| CN105085658B (en) | Interleukin 29 mutant and polyethylene glycol derivative | |
| CN101671390A (en) | Human interferon alpha derivatives and preparation and use of pegylated products thereof | |
| CN103641905B (en) | Interferon alpha1b mutant and fusion protein containing interferon alpha1b and human serum albumin | |
| CN109467597B (en) | Novel interferon and preparation method, composition and application thereof | |
| CN105085657A (en) | Interferon mutant and polyethylene glycol derivative | |
| CN102585013B (en) | Fusion protein containing omega interferon and method for preparing same | |
| CN101352573A (en) | Recombinant human granulocyte colony stimulating factor lysine defect body modified by polyethyleneglycol |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP03 | Change of name, title or address |
Address after: 102600 Beijing Jinyuan Industrial Development Zone Daxing District Road No. 1 Building No. 4 Patentee after: BEIJING TRI-PRIME GENE PHARMACEUTICAL CO., LTD. Address before: 102600, Beijing, Daxing District, North Village, Beijing biological engineering and pharmaceutical industry base, nine Fu Tian street, Beijing three yuan Gene Engineering Co., Ltd. Patentee before: Beijing Sanyuan Gene Engineering Co., Ltd. |