CN103484553A - Species-specific PCR method for rapidly identifying ten sea cucumber species - Google Patents

Species-specific PCR method for rapidly identifying ten sea cucumber species Download PDF

Info

Publication number
CN103484553A
CN103484553A CN201310473375.5A CN201310473375A CN103484553A CN 103484553 A CN103484553 A CN 103484553A CN 201310473375 A CN201310473375 A CN 201310473375A CN 103484553 A CN103484553 A CN 103484553A
Authority
CN
China
Prior art keywords
holothuria
sea cucumber
species
kinds
reverse primer
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN201310473375.5A
Other languages
Chinese (zh)
Inventor
文菁
曾玲
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
ZHANJIANG NORMAL UNIVERSITY
Original Assignee
ZHANJIANG NORMAL UNIVERSITY
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by ZHANJIANG NORMAL UNIVERSITY filed Critical ZHANJIANG NORMAL UNIVERSITY
Priority to CN201310473375.5A priority Critical patent/CN103484553A/en
Publication of CN103484553A publication Critical patent/CN103484553A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to a species-specific PCR method for rapidly identifying ten sea cucumber species, and belongs to the molecular biology field. The method comprises the following steps: respectively designing species-specific primers of the ten species of sea cucumber through sequence alignment by treating mitochondrial 16SrRNA gene of the ten species of sea cucumber as target gene, extracting sea cucumber mitochondrial gene, carrying out specific PCR amplification detection, determining the sea cucumber species comprising Actinopygamauritiana, Stichopusnaso, Cucumariafrondosa, Holothuriaedulis, Holothuriaatra, Holothuriaflavomaculata, Holothuriamammata, Holothuriabacilla, Holothurianotabilis and Holothuriamoebii according to the existence or inexistence of a PCR amplification band, carrying out specific PCR amplification to respectively obtain 274bp, 276bp, 264bp, 275bp, 270bp, 273bp, 274bp, 276bp, 276bp and 270bp specific fragments.

Description

The Species specific PCR method of 10 kinds of sea cucumber kinds of a kind of Rapid identification
Technical field
The present invention relates to identify in a kind of molecular biology the method for sea cucumber kind, particularly relate to the Species specific PCR method of 10 kinds of sea cucumber kinds of a kind of Rapid identification, belong to technical field of molecular biology.
Background technology
Sea cucumber, belong to Holothuroidea (Holothurioidea), is the sea mollusk of living in seashore to 8000 meter, and according to the history of existing more than 600,000,000 year of the present, it is food that sea cucumber be take seabed algae and planktonic organism.The sea cucumber whole body covers with corn, is widely distributed in each ocean, the world.China's Coastline of South China Sea kind is more, approximately have more than 20 plant sea cucumbers can be edible, the same ginseng of sea cucumber, bird's nest, shark's fin are equally celebrated for their achievements, are one of the world's eight large treasures.Sea cucumber is not only precious food, is also famous and precious medicinal material.According to putting down in writing in supplementary Amplifications of the Compendium of Materia Medica: sea cucumber, sweet-salty, kidney tonifying, beneficial marrow, take the photograph urine, and impotence is treated in establishing-Yang, its benefit warm in nature, sufficient enemy's ginseng, therefore named sea cucumber.Modern study shows, sea cucumber has the memory of raising, delays the sexual gland aging, prevents arteriosclerosis, diabetes and the effect such as antitumor.
Over thousand, sea cucumber is considered as delicious food and healthcare products by the Asia people.Sea cucumber nutrient is worth high, and high protein, lower fat, be rich in amino acid, lipid acid and trace element.The whole world is fished for various sea cucumbers and is transported Asia to, according to statistics, and Asian-Pacific area sea cucumber amount of fishing maximum, be about annual 20000 ~ 40000 tons, Northern Hemisphere Temperate Region in China is about 9000 ton/years, and Africa and the Indian Ocean Area are about 2000-2500 ton/year, and Galle when Latin American is less than 1000 ton/years.Different sea cucumber kind price variances are larger, yet many sea cucumber economic specieses lack Identification of Species clearly in the trade process.General Holothurian machining process can be through peelling off internal organ, boiling, then dry and make dry product, this process makes the original morphological feature of fresh and alive sea cucumbers by havoc, therefore, use traditional morphological method to identify that the sea cucumber kind becomes very difficult, be badly in need of setting up other effective methods market sea cucumber kind is carried out to Rapid identification.
With respect to protein, DNA has more superior thermostability, particularly Mitochondrial DNA.Contain 1600-6000 Mitochondrial DNA in average each zooblast, quantitative advantage can make up the DNA degradation caused in the food hot procedure, therefore is suitable as very much the template of pcr amplification.In addition, plastosome 16S rRNA gene is very conservative in planting, and is suitable as very much the molecule marker that species are identified.The existing report that uses the DNA methods such as PCR-RFLP, BLAST, FINS, DNA-barcode, multiplex PCR and real-time quantitative PCR to identify species.But the method stepss such as PCR-RFLP, BLAST, FINS and DNA-barcode are more, need enzyme to cut or sequencing analysis, take time and effort, cost is also higher.Multiple PCR method, owing in disposable PCR process, adding primer more, makes false positive or false negative probability increase, and generally is only applicable to the evaluation of a few species, such as 3 ~ 4 kinds.Although real time quantitative PCR method is very fast, cost is higher.
Summary of the invention
The object of the invention is to set up a kind of Species specific PCR method of 10 kinds of sea cucumber kinds of evaluation quick, accurate, with low cost, and it can overcome the shortcoming of above-mentioned additive method, realizes effectively identifying fast of sea cucumber kind.
The Species specific PCR method of 10 kinds of sea cucumber kinds of a kind of Rapid identification, first the sea cucumber dry product is carried out the extraction of DNA profiling, then the specific fragment of sea cucumber plastosome 16S rRNA gene carried out to pcr amplification, finally the pcr amplification result is carried out to electrophoresis detection, the corresponding sea cucumber kind of being of species specificity purpose band is arranged, species specificity purpose stripe size is divided into 274 bp, 276 bp, 264 bp, 275 bp, 270 bp, 273 bp, 274 bp, 276 bp, 276 bp and 270 bp, specifically comprises the steps:
(1) extraction of DNA profiling: the 1. sea cucumber muscle of clip 10 about mg, distilled water flushing is clean, and filter paper blots; 2. use the marine animal genome DNA extracting reagent kit of TIANGEN Biotech (Beijing) Co., Ltd., extract DNA as template, be placed in-20 ℃ standby;
(2) with the specific fragment of Species specific PCR amplification 16S rRNA gene;
(3) PCR product electrophoresis detection is identified: 1. with 1 * TBE, configure 1.2% sepharose solution, heating is dissolved fully, be cooled to 50-60 ℃, add 1 μ l GoldView nucleic acid dye, mix, pour in the glue groove, insert comb, after gel solidifies fully, take out comb, gel is submerged containing in the electrophoretic buffer of 1 * TBE, 5 μ l PCR products and 1 μ l 6 * loding buffer are mixed, add successively in well, 5 μ l DL2000 bp Marker are added in blank well, voltage 160 V, electrophoresis 30 min; 2. take out gel, be placed in ultraviolet gel imaging system observations, can judge the sea cucumber kind according to having or not of pcr amplification band, corresponding sea cucumber kind is respectively actinopyga mauritiana, stichopus naso, cucumaria frondosa, holothuria edulis, holothuria atra, holothuria flavomaculata, holothuria mammata, holothuria bacilla, holothuria notabiliswith holothuria moebii; 10 * Ex Taq buffer, Ex Taq archaeal dna polymerase, the precious biotechnology (Dalian) of 6 * loding buffer, DL2000 bp Marker(company limited), primer, dNTP(give birth to work biotechnology (Shanghai) limited-liability company);
40 above-mentioned circulations refer under 95 ℃ of conditions of temperature carries out 30 s, carries out 1 min under 50 ℃, at 72 ℃, carries out 1 min;
The Species specific PCR amplified reaction is totally 50 μ l, comprising: 38.5 μ l water; 5 μ l 10 * Ex Taq buffer, containing 20 mM Mg 2+; The dNTP of 1 μ l 10 mM; The forward primer 16Sar of 2 μ l 10 μ M; 2 μ l 10 μ M reverse primers; 1 μ l DNA profiling; 0.5 μ l Ex Taq archaeal dna polymerase; The forward primer 16Sar:5 ' used-CGCCTGTTTATCAAAAACAT-3 '; The species specificity reverse primer is respectively: actinopyga mauritianareverse primer 16Smau-t:5 '-CGAGTTAGGTTAGAAAATTTCC-3 ', stichopus nasoreverse primer 16Snas-t:5 '-GGGTATACTTAGTTTTCAGG-3 ', cucumaria frondosareverse primer 16Sfro-t:5 '-GTCTTATGTTCTTTAGGAAGT-3 ', holothuria edulisreverse primer 16Sedu-t:5 '-ATCTAGTAAATGGGGGTGT-3 ', holothuria atrareverse primer 16Satr-t:5 '-AATGGGTAATATTATTCAC-3 ', holothuria flavomaculatareverse primer 16Sfla-t:5 '-GACTGCGAGGTAGTTTGTT-3 ', holothuria mammatareverse primer 16Smam-t:5 '-TGCCTGAAAGGGTAAGGCC-3 ', holothuria bacillareverse primer 16Sbac-t:5 '-TTAGAGAAAGGTAAGTAA-3 ', holothuria notabilisreverse primer 16Snot-t:5 '-TGGGGTTAGTTTTCTAGGT-3 ', holothuria moebiireverse primer 16Smoe-t:5 '-AAAAAGGAGGAAGCTCACC-3 ';
The PCR reaction parameter is: 95 ℃ of temperature, times 30 s; Then through 40 circulations, last 72 ℃ of 4 min.
The present invention has the following advantages:
(1) Species specific PCR is identified the sea cucumber kind, has solved traditional form method and has identified difficult situation for the processing sea cucumber range of product;
(2) the inventive method only need be carried out conventional PCR and electrophoresis step, without further carrying out the steps such as enzyme is cut, order-checking, have fast saving time, characteristics with low cost;
(3) the inventive method has higher specificity, accuracy and repeatability, only can amplify a specific PCR band to corresponding Instinctive cultivar, in all the other 20 kinds of sea cucumbers, not there will be band;
(4) the inventive method can be used for the evaluation of 10 kinds of sea cucumbers.
The accompanying drawing explanation
Fig. 1 is the specificity experimental result that specific PCR is identified 10 kinds of sea cucumbers: a is 16Sar/16Smau-t primer pair; B is 16Sar/16Snas-t primer pair; C is 16Sar/16Sfro-t primer pair; D is 16Sar/16Sedu-t primer pair; E is 16Sar/16Satr-t primer pair; F is 16Sar/16Sfla-t primer pair; G is 16Sar/16Smam-t primer pair; H is 16Sar/16Sbac-t primer pair; I is 16Sar/16Snot-t primer pair; J is 16Sar/16Smoe-t primer pair; M is TAKARA DL2000 bp Marker; 1 is actinopyga mauritiana; 2 are stichopus naso; 3 are cucumaria frondosa; 4 are holothuria edulis; 5 are holothuria atra; 6 are holothuria flavomaculata; 7 are holothuria mammata; 8 are holothuria bacilla; 9 are holothuria notabilis; 10 are holothuria moebii; 11 are apostichopus japonicus; 12 are stichopus hermanni; 13 are stichopus chloronotus; 14 are thelenota ananas; 15 are thelenota anax; 16 are isostichopus badionotus; 17 are bohadschia argus; 18 are holothuria fuscopunctata; 19 are holothuria leucospilota; 20 are holothuria scabra; 21 are actinopyga echinites; N is water;
Fig. 2 is the repeated experiment result that specific PCR is identified 10 kinds of sea cucumbers: a is 16Sar/16Smau-t primer pair, and 1-10 is actinopyga mauritiana; B is 16Sar/16Snas-t primer pair, and 1-10 is stichopus naso; C is 16Sar/16Sfro-t primer pair, and 1-10 is cucumaria frondosa; D is 16Sar/16Sedu-t primer pair, and 1-10 is holothuria edulis; E is 16Sar/16Satr-t primer pair, and 1-10 is holothuria atra; F is 16Sar/16Sfla-t primer pair, and 1-10 is holothuria flavomaculata; G is 16Sar/16Smam-t primer pair, and 1-10 is holothuria mammata; H is 16Sar/16Sbac-t primer pair, and 1-10 is holothuria bacilla; I is 16Sar/16Snot-t primer pair, and 1-10 is holothuria notabilis; J is 16Sar/16Smoe-t primer pair, and 1-10 is holothuria moebii; M is TAKARA DL2000 bp Marker; N is water.
Embodiment
Below by example, the present invention is described in further details, these examples only are used for illustrating the present invention, do not limit the scope of the invention.
Embodiment
The evaluation of dry Stichopus japonicus kind
(1) extraction of DNA profiling: the 1. sea cucumber muscle of clip 10 about mg, distilled water flushing is clean, and filter paper blots.2. use the marine animal genome DNA extracting reagent kit of TIANGEN Biotech (Beijing) Co., Ltd., the by specification step is extracted DNA as template, be placed in-20 ℃ standby.
(2) specific fragment of Species specific PCR amplification 16S rRNA gene: 1. reaction is totally 50 μ l, comprising: 38.5 μ l water; 5 μ l 10 * Ex Taq buffer are (containing 20 mM Mg 2+); 1 μ l dNTP (10 mM); 2 μ l forward primer 16Sar(10 μ M); 2 μ l reverse primers (10 μ M); 1 μ l DNA profiling; 0.5 μ l Ex Taq archaeal dna polymerase; The forward primer 16Sar:5 ' used-CGCCTGTTTATCAAAAACAT-3 '; The species specificity reverse primer is respectively: actinopyga mauritianareverse primer 16Smau-t:5 '-CGAGTTAGGTTAGAAAATTTCC-3 ', stichopus nasoreverse primer 16Snas-t:5 '-GGGTATACTTAGTTTTCAGG-3 ', cucumaria frondosareverse primer 16Sfro-t:5 '-GTCTTATGTTCTTTAGGAAGT-3 ', holothuria edulisreverse primer 16Sedu-t:5 '-ATCTAGTAAATGGGGGTGT-3 ', holothuria atrareverse primer 16Satr-t:5 '-AATGGGTAATATTATTCAC-3 ', holothuria flavomaculatareverse primer 16Sfla-t:5 '-GACTGCGAGGTAGTTTGTT-3 ', holothuria mammatareverse primer 16Smam-t:5 '-TGCCTGAAAGGGTAAGGCC-3 ', holothuria bacillareverse primer 16Sbac-t:5 '-TTAGAGAAAGGTAAGTAA-3 ', holothuria notabilisreverse primer 16Snot-t:5 '-TGGGGTTAGTTTTCTAGGT-3 ', holothuria moebiireverse primer 16Smoe-t:5 '-AAAAAGGAGGAAGCTCACC-3 '.2. the PCR reaction parameter is: first 95 ℃ of 30 s; Then through 40 circulations (95 ℃ of 30 s, 50 ℃ of 1 min, 72 ℃ of 1 min); Last 72 ℃ of 4 min.
(3) PCR product electrophoresis detection is identified: 1. with 1 * TBE, configure 1.2% sepharose solution, heating is dissolved fully, be cooled to 50-60 ℃, add 1 μ l GoldView nucleic acid dye, mix, pour in the glue groove, insert comb, after gel solidifies fully, take out comb, gel is submerged containing in the electrophoretic buffer of 1 * TBE, 5 μ l PCR products and 1 μ l 6 * loding buffer are mixed, add successively in well, 5 μ l DL2000 bp Marker are added in blank well, voltage 160 V, electrophoresis 30 min.2. take out gel, be placed in ultraviolet gel imaging system observations, can judge the sea cucumber kind according to having or not of pcr amplification band. actinopyga mauritiana, stichopus naso, cucumaria frondosa, holothuria edulis, holothuria atra, holothuria flavomaculata, holothuria mammata, holothuria bacilla, holothuria notabiliswith holothuria moebii, through the Species specific PCR amplification, obtain respectively the specific fragment of 274 bp, 276 bp, 264 bp, 275 bp, 270 bp, 273 bp, 274 bp, 276 bp, 276 bp and 270 bp.
Sea cucumber involved in the present invention is purchased from market, through BLAST order-checking comparison method, identifies, determines that its kind is respectively: actinopyga mauritiana, stichopus naso, cucumaria frondosa, holothuria edulis, holothuria atra, holothuria flavomaculata, holothuria mammata, holothuria bacilla, holothuria notabiliswith holothuria moebii.
The present invention's main agents used is: marine animal genome DNA extracting reagent kit (TIANGEN Biotech (Beijing) Co., Ltd.), 10 * Ex Taq buffer, Ex Taq archaeal dna polymerase, the precious biotechnology (Dalian) of 6 * loding buffer, DL2000 bp Marker(company limited), primer, dNTP(give birth to work biotechnology (Shanghai) limited-liability company), agarose (Biowest).
The present invention's key instrument used is: 5424 whizzers (Eppendorf), T-100 PCR instrument (Bio-Rad), EPS-300 electrophoresis apparatus (Shanghai Tian Neng Science and Technology Ltd.), ChemiDoc XRS+ gel imaging system (Bio-Rad).
The present invention is according to the specificity of 10 kinds of sea cucumber 16S rRNA genes, and 10 specific reverse primers have been synthesized in design respectively, and primer information is in Table 1.
Table 1 Auele Specific Primer information
The sea cucumber kind The primer title Primer sequence (5 ' → 3 ') The amplified production size
? 16Sar CGCCTGTTTATCAAAAACAT ?
Actinopyga auritiana 16Smau-t CGAGTTAGGTTAGAAAATTTCC 274 bp
Stichopus naso 16Snas-t GGGTATACTTAGTTTTCAGG 276 bp
Cucumaria frondosa 16Sfro-t GTCTTATGTTCTTTAGGAAGT 264 bp
Holothuria edulis 16Sedu-t ATCTAGTAAATGGGGGTGT 275 bp
Holothuria atra 16Satr-t AATGGGTAATATTATTCAC 270 bp
Holothuria flavomaculata 16Sfla-t GACTGCGAGGTAGTTTGTT 273 bp
Holothuria mammata 16Smam-t TGCCTGAAAGGGTAAGGCC 274 bp
Holothuria bacilla 16Sbac-t TTAGAGAAAGGTAAGTAA 276 bp
Holothuria notabilis 16Snot-t TGGGGTTAGTTTTCTAGGT 276 bp
Holothuria moebii 16Smoe-t AAAAAGGAGGAAGCTCACC 270 bp
Species specific PCR is identified the specificity experiment of 10 kinds of sea cucumbers
21 kinds of sea cucumbers are carried out to 10 pcr amplifications, verify the specificity of 10 pairs of primers.Each reaction is totally 50 μ l, comprising: 38.5 μ l water; 5 μ l 10 * Ex Taq buffer are (containing 20 mM Mg 2+); 1 μ l dNTP (10 mM); 2 μ l forward primer 16Sar(10 μ M); 2 μ l reverse primers (10 μ M); 1 μ l DNA profiling; 0.5 μ l Ex Taq archaeal dna polymerase.The PCR reaction parameter is: first 95 ℃ of 30 s; Then through 40 circulations (95 ℃ of 30 s, 50 ℃ of 1 min, 72 ℃ of 1 min); Last 72 ℃ of 4 min.The PCR product is through 1.2% agarose gel electrophoresis 30 min, voltage 160 V.Be placed in ultraviolet gel imaging system observations and take pictures.Experimental result is as Fig. 1, and result shows: 10 pairs of Auele Specific Primers of design all can amplify to the purpose sea cucumber specific fragment of a respective length, and to other sea cucumbers all without non-specific amplification (false positive), illustrate that the specificity of this inventive method is better.
Species specific PCR is identified the repeated experiment of 10 kinds of sea cucumbers
Every kind of sea cucumber is chosen 10 individualities at random, adopts respectively Species specific PCR to be increased, and what reaction parameter of PCR reaction system, as experimental example 1, is verified the repeatability of Species specific PCR.Experimental result is as Fig. 2, result shows: 10 pairs of Auele Specific Primers of design all can amplify to the purpose sea cucumber specific fragment of a respective length, the amplification of 10 sea cucumber individualities is obviously difference not, the phenomenon do not gone out without specific amplification (false negative), illustrate that the repeatability of this inventive method is better.
Sequence table
<110 > Zhanjiang Normal University
<120 > the Species specific PCR method of 10 kinds of sea cucumber kinds of a kind of Rapid identification
<210>?1
<211>?20
<212>?DNA
<213 > artificial sequence
<223 > 16SrRNA gene
<400>?1
CGCCTGTTTATCAAAAACAT
<210>?2
<211>?22
<212>?DNA
<213 > artificial sequence
<223 > Actinopyga mauritiana 16SrRNA gene
<400>?2
CGAGTTAGGTTAGAAAATTTCC
<210>?3
<211>?20
<212>?DNA
<213 > artificial sequence
<223 > Stichopus naso 16SrRNA gene
<400>?3
GGGTATACTTAGTTTTCAGG
<210>?4
<211>?21
<212>?DNA
<213 > artificial sequence
<223 > Cucumaria frondosa 16SrRNA gene
<400>?4
GTCTTATGTTCTTTAGGAAGT
<210>?5
<211>?19
<212>?DNA
<213 > artificial sequence
<223 > Holothuria edulis 16SrRNA gene
<400>?5
ATCTAGTAAATGGGGGTGT
<210>?6
<211>?19
<212>?DNA
<213 > artificial sequence
<223 > Holothuria atra 16SrRNA gene
<400>?6
AATGGGTAATATTATTCAC
<210>?7
<211>?19
<212>?DNA
<213 > artificial sequence
<223 > Holothuria flavomaculata 16SrRNA gene
<400>?7
GACTGCGAGGTAGTTTGTT
<210>?8
<211>?19
<212>?DNA
<213 > artificial sequence
<223 > Holothuria mammata 16SrRNA gene
<400>?8
TGCCTGAAAGGGTAAGGCC
<210>?9
<211>?18
<212>?DNA
<213 > artificial sequence
<223 > Holothuria bacilla 16SrRNA gene
<400>?9
TTAGAGAAAGGTAAGTAA
<210>?10
<211>?19
<212>?DNA
<213 > artificial sequence
<223 > Holothuria notabilis 16SrRNA gene
<400>?10
TGGGGTTAGTTTTCTAGGT
<210>?11
<211>?19
<212>?DNA
<213 > artificial sequence
<223 > Holothuria moebii 16SrRNA gene
<400>?11
AAAAAGGAGGAAGCTCACC

Claims (5)

1. the Species specific PCR method of 10 kinds of sea cucumber kinds of a Rapid identification, it is characterized in that: first the sea cucumber dry product is carried out the extraction of DNA profiling, then the specific fragment of the plastosome 16S rRNA gene of sea cucumber carried out to pcr amplification, finally the pcr amplification result is carried out to electrophoresis detection, the corresponding sea cucumber kind of being of species specificity purpose band is arranged, and species specificity purpose stripe size is divided into 274 bp, 276 bp, 264 bp, 275 bp, 270 bp, 273 bp, 274 bp, 276 bp, 276 bp and 270 bp.
2. the Species specific PCR method of 10 kinds of sea cucumber kinds of a kind of Rapid identification according to claim 1, is characterized in that: specifically comprise the steps:
(1) extraction of DNA profiling: the 1. sea cucumber muscle of clip 8-10 mg, distilled water flushing is clean, and filter paper blots; 2. use the marine animal genome DNA extracting reagent kit, extract DNA as template, be placed in-20 ℃ standby;
(2) with the specific fragment of the plastosome 16S rRNA gene of Species specific PCR amplification sea cucumber;
(3) PCR product electrophoresis detection is identified: 1. with 1 * TBE, configure 1.2% sepharose solution, heating is dissolved fully, be cooled to 50-60 ℃, add 1 μ l GoldView nucleic acid dye, mix, pour in the glue groove, insert comb, after gel solidifies fully, take out comb, gel is submerged containing in the electrophoretic buffer of 1 * TBE, 5 μ l PCR products and 1 μ l 6 * loding buffer are mixed, add successively in well, 5 μ l DL2000 bp Marker are added in blank well, voltage 160 V, electrophoresis 30 min; 2. take out gel, be placed in ultraviolet gel imaging system observations, can judge the sea cucumber kind according to having or not of pcr amplification band, corresponding sea cucumber kind is respectively actinopyga mauritiana, stichopus naso, cucumaria frondosa, holothuria edulis, holothuria atra, holothuria flavomaculata, holothuria mammata, holothuria bacilla, holothuria notabiliswith holothuria moebii.
3. the Species specific PCR method of 10 kinds of sea cucumber kinds of a kind of Rapid identification according to claim 1 and 2, it is characterized in that: described PCR reaction parameter is: 95 ℃ of temperature, times 30 s; Then through 40 circulations, last 72 ℃ of 4 min.
4. the Species specific PCR method of 10 kinds of sea cucumber kinds of a kind of Rapid identification according to claim 1 and 2, it is characterized in that: the Species specific PCR amplified reaction is totally 50 μ l, comprising: 38.5 μ l water; 5 μ l 10 * Ex Taq buffer, containing 20 mM Mg 2+; The dNTP of 1 μ l 10 mM; The forward primer 16Sar of 2 μ l 10 μ M; 2 μ l 10 μ M reverse primers; 1 μ l DNA profiling; 0.5 μ l Ex Taq archaeal dna polymerase; The forward primer 16Sar:5 ' used-CGCCTGTTTATCAAAAACAT-3 '; The species specificity reverse primer is respectively: actinopyga mauritianareverse primer 16Smau-t:5 '-CGAGTTAGGTTAGAAAATTTCC-3 ', stichopus nasoreverse primer 16Snas-t:5 '-GGGTATACTTAGTTTTCAGG-3 ', cucumaria frondosareverse primer 16Sfro-t:5 '-GTCTTATGTTCTTTAGGAAGT-3 ', holothuria edulisreverse primer 16Sedu-t:5 '-ATCTAGTAAATGGGGGTGT-3 ', holothuria atrareverse primer 16Satr-t:5 '-AATGGGTAATATTATTCAC-3 ', holothuria flavomaculatareverse primer 16Sfla-t:5 '-GACTGCGAGGTAGTTTGTT-3 ', holothuria mammatareverse primer 16Smam-t:5 '-TGCCTGAAAGGGTAAGGCC-3 ', holothuria bacillareverse primer 16Sbac-t:5 '-TTAGAGAAAGGTAAGTAA-3 ', holothuria notabilisreverse primer 16Snot-t:5 '-TGGGGTTAGTTTTCTAGGT-3 ', holothuria moebiireverse primer 16Smoe-t:5 '-AAAAAGGAGGAAGCTCACC-3 '.
5. according to the Species specific PCR method of claim 1,10 kinds of sea cucumber kinds of the described a kind of Rapid identification of 2 or 3 any one, it is characterized in that: described 40 circulations refer under 95 ℃ of conditions of temperature carries out 30 s, carry out 1 min under 50 ℃, at 72 ℃, carry out 1 min.
CN201310473375.5A 2013-10-12 2013-10-12 Species-specific PCR method for rapidly identifying ten sea cucumber species Pending CN103484553A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310473375.5A CN103484553A (en) 2013-10-12 2013-10-12 Species-specific PCR method for rapidly identifying ten sea cucumber species

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310473375.5A CN103484553A (en) 2013-10-12 2013-10-12 Species-specific PCR method for rapidly identifying ten sea cucumber species

Publications (1)

Publication Number Publication Date
CN103484553A true CN103484553A (en) 2014-01-01

Family

ID=49825143

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310473375.5A Pending CN103484553A (en) 2013-10-12 2013-10-12 Species-specific PCR method for rapidly identifying ten sea cucumber species

Country Status (1)

Country Link
CN (1) CN103484553A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114317777A (en) * 2022-01-14 2022-04-12 中国科学院南海海洋研究所 SSR (simple sequence repeat) marker of holothuria leucospilota, and amplification primer, detection method and application thereof
CN114703290A (en) * 2022-01-25 2022-07-05 中国科学院南海海洋研究所 General amplification primer, amplification method and application of sea cucumber
CN115029448A (en) * 2022-06-10 2022-09-09 华南农业大学 Holothuria scabra SSR marker and amplification primer, detection method and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101942510A (en) * 2010-07-15 2011-01-12 中国海洋大学 Multiple PCR method for rapidly identifying four varieties of sea cucumbers

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101942510A (en) * 2010-07-15 2011-01-12 中国海洋大学 Multiple PCR method for rapidly identifying four varieties of sea cucumbers

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
文菁等: "16种商品海参16S rRNA的PCR-RFLP鉴定方法", 《中国水产科学》 *
文菁等: "采用种间特异性PCR对海参产品的物种鉴定研究", 《水产科学》 *

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN114317777A (en) * 2022-01-14 2022-04-12 中国科学院南海海洋研究所 SSR (simple sequence repeat) marker of holothuria leucospilota, and amplification primer, detection method and application thereof
CN114317777B (en) * 2022-01-14 2023-09-29 中国科学院南海海洋研究所 SSR (simple sequence repeat) marker of Holothuria nobilis selenka as well as amplification primer, detection method and application thereof
CN114703290A (en) * 2022-01-25 2022-07-05 中国科学院南海海洋研究所 General amplification primer, amplification method and application of sea cucumber
CN115029448A (en) * 2022-06-10 2022-09-09 华南农业大学 Holothuria scabra SSR marker and amplification primer, detection method and application thereof

Similar Documents

Publication Publication Date Title
KR101361730B1 (en) DNA Polymorphism Marker for Identification of Cucumis sativus L.
CN102134593B (en) Gender-specific microsatellite marker for Cynoglossus semilaevis and application of same in identification of superfemale Cynoglossus semilaevis
CN105861642A (en) Sturgeon sexuality difference molecular marker and application thereof
CN106520939B (en) A kind of method and its application of madai Germplasm Identification
CN103484553A (en) Species-specific PCR method for rapidly identifying ten sea cucumber species
CN104988135A (en) Method for amplifying Tianjin tip lamprotula F-type mitochondrial genome sequence
CN105368948A (en) Primer for sex identification of Nile tilapia and PCR (polymerase chain reaction) identification method
CN103866004A (en) Molecular marker method for identifying fugu rubripes parentage as well as microsatellite and kit used for molecular marker method
CN105018462A (en) Method for amplifying F-type mitochondrial genome sequence of Lanceolaria gladiola
CN102732630A (en) Method for identifying sashimi of thunnus obesus, thunnus alalunga and thunnus thynnus
CN106282334A (en) A kind of for differentiating cutter long-tailed anchovy and the molecular marker of brachygnathia long-tailed anchovy and application thereof
CN102899321A (en) Method for selecting specific SRAP marking tapes for coilia ectenes genders and gender determination method
CN101984057B (en) Gender difference molecular marker of Tilapia nilotica and application thereof
CN103789441A (en) SSR (Simple Sequence Repeat) molecular marker method for identifying two hippocampus populations
Hidayani et al. 1601 The Morphometric Character and Mitochondrial 16S rRNA Sequence of Portunus pelagicus
CN110564869A (en) Primer, probe and method for identifying naked-cap fish based on 16S rRNA gene
CN110551826A (en) Microsatellite primer, kit and identification method for identifying crocus tridacna, tridacna and first filial generation thereof
Yang et al. DNA barcoding of fishes in Irtysh River China
CN102134600B (en) PCR (Polymerase Chain Reaction) method for sex appraisal of Nipponia nippon
CN104962660A (en) Ruditapes philippinarum species real-time fluorescent PCR (polymerase chain reaction) specific detection system and application thereof
CN105255880A (en) Sea urchin species specificity detection primer and application
KR101361735B1 (en) DNA Polymorphism Marker for Identification of Cucumis sativus L.
KR101361732B1 (en) DNA Polymorphism Marker for Identification of Cucumis sativus L.
CN101864487A (en) Primer for detecting pig fat deposition capability and method and application thereof
KR102083306B1 (en) Genetic markers and methods for identifying species belong to Myxinidae

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20140101