CN105255880A

CN105255880A - Sea urchin species specificity detection primer and application

Info

Publication number: CN105255880A
Application number: CN201510787607.3A
Authority: CN
Inventors: 万超; 刘淑艳; 宋大贺; 王刚
Original assignee: Individual
Current assignee: Individual
Priority date: 2015-11-17
Filing date: 2015-11-17
Publication date: 2016-01-20

Abstract

The invention belongs to the technical field of biology and particularly relates to a sea urchin species specificity detection primer and application. The sequences of the sea urchin species specificity detection primer are 5'-tagtaaaatagcacacgccg-3'(upstream) and 5'-tcagacaaataagggaagacg-3'(downstream). According to the application of the sea urchin species specificity detection primer, the sea urchin species specificity detection primer is adopted for PCR amplification of sea urchin CoxI genes, a 160 bp specificity electrophoresis band can be produced through agarose gel electrophoresis after PCR amplification, and accordingly specificity identification is conducted on sea urchin components. The sea urchin species specificity detection primer is reasonable in design, good in specificity and high in detection sensitivity, is used for detecting sea urchin species, can accurately identify sea urchin components through PCR analysis and has very good specificity.

Description

A kind of sea urchin species specificity detects primer and application

Technical field

The invention belongs to biological technical field, particularly a kind of sea urchin species specificity detects primer and application.

Background technology

Sea urchin belongs to Echinodermata, Echinoidea.Contain the physiologically active substances such as a large amount of protein, amino acid, highly unsaturated fatty acids, carbohydrate because of its sexual gland, sea urchin not only has higher edibleness, also has fabulous pharmaceutical use, especially has good prevention effect to cardiovascular disorder.Price is relatively high relative to other fishery products, and consumption is very big, and up to thousands of tons of, domestic vacancy need be filled up from a large amount of sea urchin of ground import such as the U.S., Korea S every year by China.Undertaken judging to be the traditional method to sea urchin identification by morphological feature, but the plasticity-of these morphological features is strong, greatly affected by environment, there is artificial subjective tendency, and there are abundant nearly edge species, morphological differences between sibling species is trickle, so traditional morphological feature recognition methods exists the problem identifying difficulty and identification error.

DNA technique qualification animal species is adopted to be that in species identification method, hot topic is also molecular engineering with fastest developing speed the most.The Mitochondrial DNA of tachytely also in matrilinear inheritance is the desirable research object of population genetics and evolutionary genetics.The sequence similarity of sea urchin and other nearly source species is between 85-94%, and Cox I gene order has larger difference, and at present, the Molecular Detection of shell-fish mainly concentrates on this sequence.The detection method delivered comprises regular-PCR method and real time fluorescent PCR method etc., these methods or there is cross reaction, or very high to equipment requirements, still do not have a kind of easy PCR method the gene of sea urchin and other shell-fish gene can be distinguished completely at present.

Summary of the invention

The object of the invention is to overcome above-mentioned not enough problem, provide a kind of sea urchin species specificity to detect primer and application method.The present invention can detect the minim DNA from animal sample, and distinguish gene and other shell-fish gene of sea urchin completely, detection sensitivity is high, and method is quick, easy to operate.

The technical scheme that the present invention is adopted for achieving the above object is: a kind of sea urchin species specificity detects primer, it is characterized in that: its sequence is:

Upstream primer: 5 '-tagtaaaatagcacacgccg-3 ';

Downstream primer: 5 '-tcagacaaataagggaagacg-3 '.

Described sea urchin species specificity detects an application for primer, it is characterized in that: utilize described sea urchin species specificity to detect primer and carry out sea urchin species PCR specific detection.

Further, described sea urchin species PCR method for detecting specificity is: adopt sea urchin species specificity to detect Cox I gene of primer PCR amplification sea urchin, the specificity electrophoretic band of a 160bp size can be produced after pcr amplification through agarose gel electrophoresis, thus sea urchin composition is carried out specificity identification.

Further, 25 μ L reaction systems of Cox I gene of described pcr amplification sea urchin are as following table 1:

The reaction system of Cox I gene of table 1.PCR amplification sea urchin

Further, the reaction parameter of Cox I gene of described pcr amplification sea urchin is as following table 2:

The reaction parameter of Cox I gene of table 2.PCR amplification sea urchin

Specific primer design of the present invention is reasonable, and detect for sea urchin species, specificity is good, and detection sensitivity is high.Present method is adopted to detect the display of sea urchin animal component result, sea urchin species specificity is adopted to detect Cox I gene of primer PCR amplification sea urchin, the specificity electrophoretic band of a 160bp size can be produced through agarose gel electrophoresis after pcr amplification, sea urchin composition can be carried out precise Identification, there is good specificity.

Accompanying drawing explanation

Fig. 1 is 5 kinds of primer PCR result figure, in figure: M.DL2000marker, 1.P1P2 primer amplification result, 2.P3P4 primer amplification result, 3.P5P6 primer amplification result, 4.P7P8 primer amplification result, 5.P9P10 primer amplification result, 6. negative control, 7. blank.

Fig. 2 is the PCR specific detection result figure of sea urchin and other marine animals, in figure: M.mark, and 1. Anthocidaris crassispina, 2. horsedung sea urchin, 3. summer smooth scallop, 4. mussel, 5. Pacific oyster, 6. stalwart blood clam, 7. negative control, 8. blank.

Fig. 3 is sensitivity analysis result figure, in figure: M.DL2000marker, 1.10ng/ μ L amplification, 2.5ng/ μ L amplification, 3.1ng/ μ L amplification, 4.0.5ng/ μ L amplification, 5.0.1ng/ μ L amplification, 6. negative control, 7. blank.

Embodiment

Below in conjunction with drawings and Examples, the present invention is described in detail, but the present invention is not limited to specific embodiment.

The sea urchin species specificity utilized in the present embodiment detects primer, and its sequence is:

5 '-tagtaaaatagcacacgccg-3 ' (upstream);

5 '-tcagacaaataagggaagacg-3 ' (downstream).

Described sea urchin species specificity detects an application for primer, and namely utilize described sea urchin species specificity to detect primer and carry out sea urchin species PCR specific detection, concrete steps are as follows:

1. sea urchin species specificity detects primer synthesis: detect primer 5 at precious biotech firm synthesis sea urchin species specificity right, its sequence (see table 3):

The primer sequence of Cox I gene of table 3.PCR amplification sea urchin:

2. the extraction of sea urchin DNA: adopting DNA extraction kit (being purchased from precious biotech firm) to extract sea urchin template DNA, is 100ng by the concentration of micro-spectrophotometer Detection and Extraction sea urchin template DNA.

Cox I gene of 3.PCR amplification sea urchin: prepare 25 μ LPCR reaction systems as following table 4:

The reaction system of Cox I gene of table 4.PCR amplification sea urchin

When using this sea urchin species specificity to detect primer, the reaction parameter of PCR is set as following table 5:

The reaction parameter of Cox I gene of table 5.PCR amplification sea urchin

4. agarose gel electrophoresis detects: with P1P2, after Cox I gene of 5 pairs of Auele Specific Primer pcr amplification sea urchins such as P3P4, P5P6, P7P8, P9P10, detect with 2% agarose gel electrophoresis, result display (as shown in Figure 1), can produce the specificity electrophoretic band of 160bp, 120bp, 107bp, 190bp, 104bp size respectively after agarose gel electrophoresis detects.Carry out specific PCR amplification using P1P2 as upstream and downstream primer, electrophoretic effects is best, and pcr amplification is most effective, therefore chooses the specificity amplification primer of P1P2 as amplification system.

When the Species composition utilizing described sea urchin species specificity detection primer to carry out sea urchin detects in real time, present method is adopted to detect the display of sea urchin animal component result, employing sea urchin species specificity detection primer PCR augmentation detection Anthocidaris crassispina, horsedung sea urchin, summer raze the samples such as scallop, mussel, Pacific oyster, stalwart blood clam, through agarose gel electrophoresis after pcr amplification, as shown in Figure 2, sea urchin sample produces the specificity electrophoretic band of a 160bp size, other samples are without electrophoretic band, sea urchin composition can be carried out precise Identification, there is good specificity.

DNA extraction kit is adopted to extract the template DNA of each testing sample, extracted template DNA gradient dilution is detected respectively with micro-spectrophotometer, be prepared into 10ng/ μ L, 5ng/ μ L, 1ng/ μ L, 0.5ng/ μ L, 0.1ng/ μ L5 concentration gradient sample, pcr amplification is carried out respectively according to reaction system described in above-mentioned steps 3 and reaction parameter, after detect with 2% agarose gel electrophoresis, to determine the detection sensitivity of this standard method, result as shown in Figure 3, the size produced is that the specificity electrophoretic band of 160bp is sea urchin, all can specific amplified as DNA concentration >=1ng/ μ L, namely the detection sensitivity of this standard method is 1ng/ μ L.This method can be identified the composition of sea urchin accurately, has good sensitivity.

Above content is the further description done the present invention in conjunction with optimal technical scheme, can not assert that the concrete enforcement of invention is only limitted to these explanations.Concerning general technical staff of the technical field of the invention, under the prerequisite not departing from design of the present invention, simple deduction and replacement can also be made, all should be considered as protection scope of the present invention.

SEQUENCELISTING

<110> ten thousand is super

Liu is refined gorgeous

Song, great He

King, just

<120> sea urchin species specificity detects primer and application

<130>20151027

<160>2

<170>PatentInversion3.3

<210>1

<211>20

<212>DNA

<213>Artificial

<220>

<223> designs according to sequence-specific, as the upstream primer of sea urchin species PCR specific detection

<220>

<221>ArtificialSequence

<222>(1)..(20)

<400>1

tagtaaaatagcacacgccg20

<210>2

<211>21

<212>DNA

<213>Artificial

<220>

<223> designs according to sequence-specific, as the downstream primer of sea urchin species PCR specific detection

<220>

<221>ArtificialSequence

<222>(1)..(21)

<400>2

tcagacaaataagggaagacg21

Claims

1. sea urchin species specificity detects a primer, it is characterized in that: its sequence is:

Upstream primer: 5 '-tagtaaaatagcacacgccg-3 ';

Downstream primer: 5 '-tcagacaaataagggaagacg-3 '.

2. sea urchin species specificity according to claim 1 detects an application for primer, it is characterized in that: utilize described sea urchin species specificity to detect primer and carry out sea urchin species PCR specific detection.

3. sea urchin species specificity according to claim 2 detects the application of primer, it is characterized in that: described sea urchin species PCR method for detecting specificity is: adopt sea urchin species specificity to detect Cox I gene of primer PCR amplification sea urchin, the specificity electrophoretic band of a 160bp size can be produced after pcr amplification through agarose gel electrophoresis, thus sea urchin composition is carried out specificity identification.

4. sea urchin species specificity according to claim 3 detects the application of primer, it is characterized in that: the reaction system of Cox I gene of described pcr amplification sea urchin is as following table 1:

The reaction system of Cox I gene of table 1.PCR amplification sea urchin

。

5. detect the application of primer according to the arbitrary described sea urchin species specificity of claim 3 or 4, it is characterized in that: the reaction parameter of Cox I gene of described pcr amplification sea urchin is as following table 2:

The reaction parameter of Cox I gene of table 2.PCR amplification sea urchin

。