CN101613742A - A kind of mitten crab multielement high flux genetic marker system and genetic analysis method - Google Patents
A kind of mitten crab multielement high flux genetic marker system and genetic analysis method Download PDFInfo
- Publication number
- CN101613742A CN101613742A CN200910020751A CN200910020751A CN101613742A CN 101613742 A CN101613742 A CN 101613742A CN 200910020751 A CN200910020751 A CN 200910020751A CN 200910020751 A CN200910020751 A CN 200910020751A CN 101613742 A CN101613742 A CN 101613742A
- Authority
- CN
- China
- Prior art keywords
- genetic
- est
- high flux
- ssr
- mitten crab
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 230000002068 genetic effect Effects 0.000 title claims abstract description 52
- 239000003550 marker Substances 0.000 title claims abstract description 34
- 230000004907 flux Effects 0.000 title claims abstract description 24
- 238000000034 method Methods 0.000 title claims abstract description 24
- 238000012252 genetic analysis Methods 0.000 title claims abstract description 18
- 108091092878 Microsatellite Proteins 0.000 claims abstract description 22
- 230000003321 amplification Effects 0.000 claims abstract description 22
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 22
- 239000003147 molecular marker Substances 0.000 claims abstract description 16
- 230000008774 maternal effect Effects 0.000 claims abstract description 10
- 101150001086 COB gene Proteins 0.000 claims abstract description 9
- 101150053771 MT-CYB gene Proteins 0.000 claims abstract description 9
- 101150006264 ctb-1 gene Proteins 0.000 claims abstract description 9
- 101150088166 mt:Cyt-b gene Proteins 0.000 claims abstract description 9
- 238000012214 genetic breeding Methods 0.000 claims abstract description 8
- 230000004069 differentiation Effects 0.000 claims abstract description 6
- 238000009399 inbreeding Methods 0.000 claims abstract description 6
- 230000002438 mitochondrial effect Effects 0.000 claims abstract description 5
- 230000008569 process Effects 0.000 claims abstract description 5
- 238000010276 construction Methods 0.000 claims abstract description 4
- 108020004414 DNA Proteins 0.000 description 35
- 238000013461 design Methods 0.000 description 30
- 238000004458 analytical method Methods 0.000 description 7
- 238000009395 breeding Methods 0.000 description 7
- 230000001488 breeding effect Effects 0.000 description 6
- 108090000623 proteins and genes Proteins 0.000 description 6
- 238000012408 PCR amplification Methods 0.000 description 4
- 230000008859 change Effects 0.000 description 4
- 239000012634 fragment Substances 0.000 description 4
- 241000238557 Decapoda Species 0.000 description 2
- 108020005196 Mitochondrial DNA Proteins 0.000 description 2
- 238000000137 annealing Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 239000000463 material Substances 0.000 description 2
- 201000004569 Blindness Diseases 0.000 description 1
- 241000282985 Cervus Species 0.000 description 1
- 241001465754 Metazoa Species 0.000 description 1
- 230000008901 benefit Effects 0.000 description 1
- 238000001514 detection method Methods 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000009396 hybridization Methods 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 230000008775 paternal effect Effects 0.000 description 1
- 238000002264 polyacrylamide gel electrophoresis Methods 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 230000008521 reorganization Effects 0.000 description 1
- 230000003252 repetitive effect Effects 0.000 description 1
- 238000004088 simulation Methods 0.000 description 1
- 241000894007 species Species 0.000 description 1
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to aquatic products genetic breeding field, is a kind of mitten crab multielement high flux genetic marker system and genetic analysis method specifically.The multielement high flux genetic marker system is plastosome sequence information system and microsatellite molecular marker system, and wherein the microsatellite molecular marker system is made up of the system 1 of 7 EST-SSR marks and the system 2 of 6 EST-SSR marks; Method: use mitochondrial three couples of primer amplification COI, the information of the sequence of Cytb and CR is as molecule marker, same female parent separates according to genetic construction and genetic diversity with the offspring that different female parents are produced in the family with raising together with, use the EST-SSR microsatellite molecular marker again, carry out the differentiation of male parent with distinguishing maternal offspring according to genetic distance and genetic diversity, thereby finish the genealogical identification in the mitten crab genetic breeding process and confirm inbreeding coefficient.The present invention uses the sibship between the multielement high flux genetic marker system differentiation filial generation on the basis that effectively utilizes species genetic information, effectively avoid inbreeding depression simultaneously.
Description
Technical field
The present invention relates to aquatic products genetic breeding field, is a kind of mitten crab multielement high flux genetic marker system and genetic analysis method specifically.
Background technology
Along with development of biology, molecule marker is also being brought in constant renewal in, and the mark that is widely used at present in the marine zoogenetics analysis is plastosome sequence and microsatellite marker.Plastosome sequence (mtDNA) has characteristics such as fast, non-reorganization variation of rate of evolution and matrilinear inheritance as the extranuclear inheritance material, and identical sequence information shows that sample source is in same female parent.The mtDNA fragment that is commonly used for the inbred genetic analysis has Cytb, COI and CR.Little satellite (SSRs) is the tandem repetitive sequence that is made of 2-6 base that exists in eucaryon and prokaryotic gene group, has height polymorphism and codominance characteristics.Microsatellite marker can provide parents' genetic information, especially is applied in to disclose between individuality and the gene exchange between colony, infer in parental right relation and the hybridization analysis of phenomenon, can more fully reflect the genetic affinity between colony.The genome microsatellite marker often is used to that preciousness in imminent danger watches for animals and assessment of the genetic diversity of marine economy species and genealogical identification.Though accumulated a large amount of mitten crab sequence information (individual surplus announcing 7000 among the international shared database GenBank), but these information also also really are not applied in the analysis of required pedigree identification of genetic breeding and genetic affinity by the exploitation of system.
Summary of the invention
The object of the present invention is to provide a kind of multielement high flux genetic marker of mitten crab fast and effectively and genetic analysis method.
For achieving the above object, the technical solution used in the present invention is:
A kind of mitten crab multielement high flux genetic marker system: described multielement high flux genetic marker system is plastosome sequence information system and microsatellite molecular marker system, and wherein the microsatellite molecular marker system is made up of the system 1 of 7 EST-SSR marks and the system 2 of 6 EST-SSR marks;
System 1 is made up of 7 EST-SSR marks, and 7 pairs of primers of 7 EST-SSR marks of amplification are respectively NE5 (F:CGTGAATGCTGTAGTGTAAT; R:CACCAGAAATAATGAGGTTT);
NE12(F：ATGACATTGATGCCTGACG；R：TGCCTTTATTGACCGAGAC)；
NE16(F：TTTCACATCCTCCACAGACA；R：GCCACAAGTACACCCAATCA)；
NE27(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE46(F：ACTGCTGTTGTTGGTGGTC；R：CCTTAATCCGTTGCGTCA)；
NE48(F：AAAGGTCAGTTAATTTCTTGAT；R：TCTAGTGAAATGACATATTGGT)；
NE49(F：AGACCGCTGTTATGCTCCT；R：ATGGGAATGAAGGTTATGTATG)；
System 2 is made up of 6 EST-SSR marks, and 6 pairs of primers of 6 EST-SSR marks of amplification are respectively NE1 (F:CATTCCAAGTCTTGACCCC; R:CAGAGCCACAACACTAACG);
NE18(F：TATTCAACATTTCAACAACGAT；R：GACGAGCGAAGAACTGGA)；
NE23(F：AGAGGCAAATGCGATAAAGA；R：CACGACAGACTTACCAGCAC)；
NE25(F：AGGAGGTGCGTAAGAGTGA；R：TTTCCTTCCATCCTGAGTC)；
NE26(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE36(F：ATGTGGACTGCGGGAGA；R：GTGGTGGTAGGTTCGTCTGT)。
The genetic analysis method of mitten crab multielement high flux genetic marker system: at first, use mitochondrial three couples of primer amplification COI, the information of the sequence of Cytb and CR is as molecule marker, same female parent separates according to genetic construction and genetic diversity with the offspring that different female parents are produced in the family with raising together with, and then utilization EST-SSR microsatellite molecular marker, carry out the differentiation of male parent with distinguishing maternal offspring according to genetic distance and genetic diversity, thereby finish the genealogical identification in the mitten crab genetic breeding process and confirm inbreeding coefficient.Described amplification COI, three pairs of primers of Cytb and CR sequence be respectively LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA),
F1 (CATGCCTGAATAGTAGGAGT) and R1 (GTGCTCCAATTCAGGTCAAT), F2 (GACCGTTGAGACTACTACTATAATA) and R2 (TCCGTTGCATGTAAGTATATAGTAG).
Described EST-SSR microsatellite molecular marker is made up of system 1 and system 2;
7 pairs of primers of 7 EST-SSR marks of amplification are respectively NE5 (F:CGTGAATGCTGTAGTGTAAT; R:CACCAGAAATAATGAGGTTT);
NE12(F：ATGACATTGATGCCTGACG；R：TGCCTTTATTGACCGAGAC)；
NE16(F：TTTCACATCCTCCACAGACA；R：GCCACAAGTACACCCAATCA)；
NE27(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE46(F：ACTGCTGTTGTTGGTGGTC；R：CCTTAATCCGTTGCGTCA)；
NE48(F：AAAGGTCAGTTAATTTCTTGAT；R：TCTAGTGAAATGACATATTGGT)；
NE49(F：AGACCGCTGTTATGCTCCT；R：ATGGGAATGAAGGTTATGTATG)；
System 2 is made up of 6 EST-SSR marks, and 6 pairs of primers of 6 EST-SSR marks of amplification are respectively NE1 (F:CATTCCAAGTCTTGACCCC; R:CAGAGCCACAACACTAACG);
NE18(F：TATTCAACATTTCAACAACGAT；R：GACGAGCGAAGAACTGGA)；
NE23(F：AGAGGCAAATGCGATAAAGA；R：CACGACAGACTTACCAGCAC)；
NE25(F：AGGAGGTGCGTAAGAGTGA；R：TTTCCTTCCATCCTGAGTC)；
NE26(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE36(F：ATGTGGACTGCGGGAGA；R：GTGGTGGTAGGTTCGTCTGT)。
All primer directions are 5 '-3 ' direction.The method of described mitten crab multielement high flux genetic marker system genetic analysis can detect hundreds and thousands of samples simultaneously.
The advantage that the present invention had:
1. the genetic background of breeding is clear, has avoided the blindness of traditional breeding method.The present invention utilizes plastosome sequence and little satellite as molecule marker, resolved the genetic diversity of the mitten crab colony that China for many generations cultures, the genetic affinity between group's individuality is selected in clear and definite breeding underlying group, breeding, makes the selection of breeding material have stronger purpose.
2. the combination of plastosome sequence of the present invention and microsatellite molecular marker had both avoided only using the shortcoming that the plastosome sequence can't clear and definite paternal information, had also reduced and had only used the loaded down with trivial details of microsatellite marker, helped confirming fast that institute study the pedigree generation of individuality.
3. the present invention uses the real-time monitoring of multielement high flux genetic marker system to the breeding population genetic diversity, can effectively avoid the inbreeding depression in the genetic breeding process, ensures the science and the sustainability of breeding.
Description of drawings
Fig. 1 is genetic analysis mitten crab multielement high flux genetic marker system of the present invention (the allelotrope number of each mark of digitized representation wherein, the title of mark shown in the transverse axis, an allelic size shown in the longitudinal axis.)。
(wherein under parents' information condition of unknown, use the Simulation function of software Cervus Version2.0, the accuracy rate of distinguishing 400 familys is 100% for utilization the inventive method analog detection figure for Fig. 2 a and Fig. 2 b; By the definite maternal back of plastosome information, under the situation of parent's ten-four, the accuracy rate of distinguishing 1000 familys is 100%.)。
(its four familys, 10 individualities of each family are respectively 1-10 to Fig. 3,11-20,21-30,31-40 for utilization family of the present invention is identified figure.The utilization the art of this patent detects, and utilization software populations1.2.30 adopts the DAS method to calculate genetic distance, and UPGMA schemes to show that accuracy is 100%.)。
Embodiment
Embodiment
1) mitten crab multielement high flux genetic marker system is plastosome sequence information system and microsatellite molecular marker system, and wherein microsatellite molecular marker is to form (referring to Fig. 1) by the system 1 of 7 EST-SSR marks and the system 2 of 6 EST-SSR marks;
System 1 is made up of 7 EST-SSR marks, and 7 pairs of primers of 7 EST-SSR marks of amplification are respectively NE5 (F:CGTGAATGCTGTAGTGTAAT; R:CACCAGAAATAATGAGGTTT);
NE12(F：ATGACATTGATGCCTGACG；R：TGCCTTTATTGACCGAGAC)；
NE16(F：TTTCACATCCTCCACAGACA；R：GCCACAAGTACACCCAATCA)；
NE27(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE46(F：ACTGCTGTTGTTGGTGGTC；R：CCTTAATCCGTTGCGTCA)；
NE48(F：AAAGGTCAGTTAATTTCTTGAT；R：TCTAGTGAAATGACATATTGGT)；
NE49(F：AGACCGCTGTTATGCTCCT；R：ATGGGAATGAAGGTTATGTATG)；
System 2 is made up of 6 EST-SSR marks, and 6 pairs of primers of 6 EST-SSR marks of amplification are respectively NE1 (F:CATTCCAAGTCTTGACCCC; R:CAGAGCCACAACACTAACG);
NE18(F：TATTCAACATTTCAACAACGAT；R：GACGAGCGAAGAACTGGA)；
NE23(F：AGAGGCAAATGCGATAAAGA；R：CACGACAGACTTACCAGCAC)；
NE25(F：AGGAGGTGCGTAAGAGTGA；R：TTTCCTTCCATCCTGAGTC)；
NE26(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE36(F：ATGTGGACTGCGGGAGA；R：GTGGTGGTAGGTTCGTCTGT)。
Above primer is referring to sequence table.
2) method of mitten crab multielement high flux genetic marker system genetic analysis: at first, use mitochondrial three couples of primer amplification COI, the information of the sequence of Cytb and CR is as molecule marker, same female parent separates according to genetic construction and genetic diversity with the offspring that different female parents are produced in the family with raising together with, and then utilization EST-SSR microsatellite molecular marker, carry out the differentiation of male parent with distinguishing maternal offspring according to genetic distance and genetic diversity, thereby finish the genealogical identification in the mitten crab genetic breeding process and confirm inbreeding coefficient.
(1) the mitochondrial three couples of primer amplification COI of utilization, the information of the sequence of Cytb and CR:
A. extract the DNA of mitten crab sample;
B. the DNA with step a is a template, with primer LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA) amplification COI fragment, with primers F 1 (CATGCCTGAATAGTAGGAGT) and R1 (GTGCTCCAATTCAGGTCAAT) amplification Cytb fragment, with primers F 2 (GACCGTTGAGACTACTACTATAATA) and R2 (TCCGTTGCATGTAAGTATATAGTAG) amplification CR fragment.Above-mentioned pcr amplification product reclaims, also order-checking of purifying.The pcr amplification condition is: 95 ℃ of sex change 2 minutes, 32-35 circulation comprise that 95 ℃ of sex change 30 seconds, 54-56 ℃ annealing extended 60 seconds for 45 seconds, 72 ℃, and last 72 ℃ were extended 5 minutes.
(2) utilization EST-SSR microsatellite molecular marker
C. the DNA with step a is a template, uses primer NE5 (F:CGTGAATGCTGTAGTGTAAT respectively; R:CACCAGAAATAATGAGGTTT); NE12 (F:ATGACATTGATGCCTGACG; R:TGCCTTTATTGACCGAGAC); NE16 (F:TTTCACATCCTCCACAGACA; R:GCCACAAGTACACCCAATCA); NE27 (F:ACGGGAAATGGAACAGAT; R:TCCTTCCATCCTGAGTCC); NE46 (F:ACTGCTGTTGTTGGTGGTC; R:CCTTAATCCGTTGCGTCA); NE48 (F:AAAGGTCAGTTAATTTCTTGAT; R:TCTAGTGAAATGACATATTGGT); NE49 (F:AGACCGCTGTTATGCTCCT; R:ATGGGAATGAAGGTTATGTATG) whole microsatellite markers of amplification system 1 amount to 7.Use primer NE1 (F:CATTCCAAGTCTTGACCCC respectively; R:CAGAGCCACAACACTAACG); NE18 (F:TATTCAACATTTCAACAACGAT; R:GACGAGCGAAGAACTGGA); NE23 (F:AGAGGCAAATGCGATAAAGA; R:CACGACAGACTTACCAGCAC); NE25 (F:AGGAGGTGCGTAAGAGTGA; R:TTTCCTTCCATCCTGAGTC); NE26 (F:ACGGGAAATGGAACAGAT; R:TCCTTCCATCCTGAGTCC); NE36 (F:ATGTGGACTGCGGGAGA; R:GTGGTGGTAGGTTCGTCTGT) whole microsatellite markers of amplification system 2 amount to 6.The pcr amplification condition is: 95 ℃ of sex change 2 minutes, 28-32 circulation comprise that 95 ℃ of sex change 30 seconds, 54-58 ℃ annealing extended 60 seconds for 45 seconds, 72 ℃, and last 72 ℃ were extended 5 minutes.
Above-mentioned pcr amplification product through 8% polyacrylamide gel electrophoresis analysis, and is used CervusVersion2.0 software and carried out data processing.
Application examples 1
The model analysis function of operation Cervus obtains using patented technology of the present invention, and the number of family and the relation between the family discriminating success ratio are raised together with in differentiation, see Fig. 2.From Fig. 2 a, shown in the red line, use patent of the present invention fully,, use EST-SSR Mk system 1 and system 2 can successfully distinguish 1000 familys (accuracy rate 100%) again by the definite maternal back of plastosome information, under the situation of parent's ten-four; From Fig. 2 a shown in the black line, if do not use earlier plastosome information determine maternal, under parents' information unknown situation, use EST-SSR Mk system 1 and system 2 and only can distinguish 400 familys (accuracy rate 100%); From Fig. 2 b, shown in the red line,, use EST-SSR Mk system 1 or system 2 separately and can successfully distinguish 100 familys (accuracy rate 100%) by the definite maternal back of plastosome information, under the situation of parent's ten-four; From figure shown in the black line, if do not use earlier plastosome information determine maternal, under parents' information unknown situation, use EST-SSR Mk system 1 or system 2 separately and can successfully distinguish 10 familys (accuracy rate 100%).
Application examples 2
The sample of four familys is taken from Sheyang County, Jiangsu Province prosperous aquatic products limited liability company on October 10th, 2008, each family all is the family full-sibs one female, that a hero is produced.From each family, get 10 young crab individualities at random, number clear and definite its sibship respectively and form sample I.From another cultured population, select 4 female crabs and 4 male crabs to number the back respectively at random and form sample II as the candidate parent jointly with 4 couples of real parents.Sibship the unknown when raising together with the analysis of family between supposition sample I, the II, sample I is used the art of this patent with sample II carry out genetic analysis, be specially the plastosome information of measuring earlier all samples, clear and definite maternal information and separately with different mothers' individuality; Use the genotype that EST-SSR system 1 and system 2 detect all samples again, clear and definite male parent information, and according to 40 Id data among the sample I, go out genetic distance between the individuality with the Populations computed in software, according to genetic distance between individuality 40 individualities of four familys are gathered into four classes respectively with the method for UPGMA, the individuality of same family is all gathered into a class separately, the result of analysis and record number comparison, accuracy 100% (Fig. 3).
Sequence table .txt
SEQUENCE?LISTING
＜110〉Institute of Oceanology of the Chinese Academy of Sciences
＜120〉a kind of mitten crab multielement high flux genetic marker system and genetic analysis method
<130>
<160>32
<170>PatentIn?version?3.1
<210>1
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(20)
<223>
<400>1
cgtgaatgct?gtagtgtaat 20
<210>2
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(20)
<223>
<400>2
caccagaaat?aatgaggttt 20
<210>3
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>3
atgacattga?tgcctgacg 19
<210>4
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>4
tgcctttatt?gaccgagac 19
<210>5
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(20)
<223>
<400>5
tttcacatcc?tccacagaca 20
<210>6
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(20)
<223>
<400>6
gccacaagta?cacccaatca 20
<210>7
<211>18
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(18)
<223>
<400>7
acgggaaatg?gaacagat 18
<210>8
<211>18
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(18)
<223>
<400>8
acgggaaatg?gaacagat 18
<210>9
<211>18
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(18)
<223>
<400>9
tccttccatc?ctgagtcc 18
<210>10
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>10
actgctgttg?ttggtggtc 19
<210>11
<211>22
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(22)
<223>
<400>11
aaaggtcagt?taatttcttg?at 22
<210>12
<211>22
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(22)
<223>
<400>12
tctagtgaaa?tgacatattg?gt 22
<210>13
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>13
agaccgctgt?tatgctcct 19
<210>14
<211>22
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(22)
<223>
<400>14
atgggaatga?aggttatgta?tg 22
<210>15
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>15
cattccaagt?cttgacccc 19
<210>16
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>16
cagagccaca?acactaacg 19
<210>17
<211>22
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(22)
<223>
<400>17
tattcaacat?ttcaacaacg?at 22
<210>18
<211>18
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(18)
<223>
<400>18
gacgagcgaa?gaactgga 18
<210>19
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(20)
<223>
<400>19
agaggcaaat?gcgataaaga 20
<210>20
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(20)
<223>
<400>20
cacgacagac?ttaccagcac 20
<210>21
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>21
aggaggtgcg?taagagtga 19
<210>22
<211>19
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(19)
<223>
<400>22
tttccttcca?tcctgagtc 19
<210>23
<211>18
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(18)
<223>
<400>23
acgggaaatg?gaacagat 18
<210>24
<211>18
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(18)
<223>
<400>24
tccttccatc?ctgagtcc 18
<210>25
<211>17
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(17)
<223>
<400>25
atgtggactg?cgggaga 17
<210>26
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>satellite
<222>(1)..(20)
<223>
<400>26
gtggtggtag?gttcgtctgt 20
<210>27
<211>25
<212>DNA
<213>avertebrate
<220>
<221>gene
<222>(1)..(25)
<223>
<400>27
ggtcaacaaa?tcataaagat?attgg 25
<210>28
<211>26
<212>DNA
<213>avertebrate
<220>
<221>gene
<222>(1)..(26)
<223>
<400>28
taaacttcag?ggtgaccaaa?aaatca 26
<210>29
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>gene
<222>(1)..(20)
<223>
<400>29
catgcctgaa?tagtaggagt 20
<210>30
<211>20
<212>DNA
＜213〉artificial design
<220>
<221>gene
<222>(1)..(20)
<223>
<400>30
gtgctccaat?tcaggtcaat 20
<210>31
<211>25
<212>DNA
＜213〉artificial design
<220>
<221>D-loop
<222>(1)..(25)
<223>
<400>31
gaccgttgag?actactacta?taata 25
<210>32
<211>25
<212>DNA
＜213〉artificial design
<220>
<221>D-loop
<222>(1)..(25)
<223>
<400>32
tccgttgcat?gtaagtatat?agtag 25
Claims (6)
1. mitten crab multielement high flux genetic marker system, it is characterized in that: described multielement high flux genetic marker system is plastosome sequence information system and microsatellite molecular marker system, and wherein the microsatellite molecular marker system is made up of the system 1 of 7 EST-SSR marks and the system 2 of 6 EST-SSR marks;
System 1 is made up of 7 EST-SSR marks, and 7 pairs of primers of 7 EST-SSR marks of amplification are respectively NE5 (F:CGTGAATGCTGTAGTGTAAT; R:CACCAGAAATAATGAGGTTT);
NE12(F：ATGACATTGATGCCTGACG；R：TGCCTTTATTGACCGAGAC)；
NE16(F：TTTCACATCCTCCACAGACA；R：GCCACAAGTACACCCAATCA)；
NE27(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE46(F：ACTGCTGTTGTTGGTGGTC；R：CCTTAATCCGTTGCGTCA)；
NE48(F：AAAGGTCAGTTAATTTCTTGAT；R：TCTAGTGAAATGACATATTGGT)；
NE49(F：AGACCGCTGTTATGCTCCT；R：ATGGGAATGAAGGTTATGTATG)；
System 2 is made up of 6 EST-SSR marks, and 6 pairs of primers of 6 EST-SSR marks of amplification are respectively NE1 (F:CATTCCAAGTCTTGACCCC; R:CAGAGCCACAACACTAACG);
NE18(F：TATTCAACATTTCAACAACGAT；R：GACGAGCGAAGAACTGGA)；
NE23(F：AGAGGCAAATGCGATAAAGA；R：CACGACAGACTTACCAGCAC)；
NE25(F：AGGAGGTGCGTAAGAGTGA；R：TTTCCTTCCATCCTGAGTC)；
NE26(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE36(F：ATGTGGACTGCGGGAGA；R：GTGGTGGTAGGTTCGTCTGT)。
2. genetic analysis method by the described mitten crab multielement high flux of claim 1 genetic marker system, it is characterized in that: at first, use mitochondrial three couples of primer amplification COI, the information of the sequence of Cytb and CR is as molecule marker, same female parent separates according to genetic construction and genetic diversity with the offspring that different female parents are produced in the family with raising together with, and then utilization EST-SSR microsatellite molecular marker, carry out the differentiation of male parent with distinguishing maternal offspring according to genetic distance and genetic diversity, thereby finish the genealogical identification in the mitten crab genetic breeding process and confirm inbreeding coefficient.
3. press the genetic analysis method of the described mitten crab multielement high flux of claim 2 genetic marker system, it is characterized in that: described amplification COI, three pairs of primers of Cytb and CR sequence be respectively LCO1490 (GGTCAACAAATCATAAAGATATTGG) and HCO2198 (TAAACTTCAGGGTGACCAAAAAATCA),
F1 (CATGCCTGAATAGTAGGAGT) and R1 (GTGCTCCAATTCAGGTCAAT), F2 (GACCGTTGAGACTACTACTATAATA) and R2 (TCCGTTGCATGTAAGTATATAGTAG).
4. by the genetic analysis method of the described mitten crab multielement high flux of claim 2 genetic marker system, it is characterized in that: described EST-SSR microsatellite molecular marker is made up of system 1 and system 2;
7 pairs of primers of 7 EST-SSR marks of amplification are respectively NE5 (F:CGTGAATGCTGTAGTGTAAT; R:CACCAGAAATAATGAGGTTT);
NE12(F：ATGACATTGATGCCTGACG；R：TGCCTTTATTGACCGAGAC)；
NE16(F：TTTCACATCCTCCACAGACA；R：GCCACAAGTACACCCAATCA)；
NE27(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE46(F：ACTGCTGTTGTTGGTGGTC；R：CCTTAATCCGTTGCGTCA)；
NE48(F：AAAGGTCAGTTAATTTCTTGAT；R：TCTAGTGAAATGACATATTGGT)；
NE49(F：AGACCGCTGTTATGCTCCT；R：ATGGGAATGAAGGTTATGTATG)；
System 2 is made up of 6 EST-SSR marks, 6 pairs of primers of 6 EST-SSR marks of amplification
Be respectively NE1 (F:CATTCCAAGTCTTGACCCC; R:CAGAGCCACAACACTAACG);
NE18(F：TATTCAACATTTCAACAACGAT；R：GACGAGCGAAGAACTGGA)；
NE23(F：AGAGGCAAATGCGATAAAGA；R：CACGACAGACTTACCAGCAC)；
NE25(F：AGGAGGTGCGTAAGAGTGA；R：TTTCCTTCCATCCTGAGTC)；
NE26(F：ACGGGAAATGGAACAGAT；R：TCCTTCCATCCTGAGTCC)；
NE36(F：ATGTGGACTGCGGGAGA；R：GTGGTGGTAGGTTCGTCTGT)。
5. by the genetic analysis method of the described mitten crab multielement high flux of claim 2 genetic marker system, it is characterized in that: all primer directions are 5-3 ' direction.
6. by the genetic analysis method of the described mitten crab multielement high flux of claim 2 genetic marker system, it is characterized in that: the method for described mitten crab multielement high flux genetic marker system genetic analysis can detect hundreds and thousands of samples simultaneously.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910020751.9A CN101613742B (en) | 2009-04-24 | 2009-04-24 | Multielement high flux genetic marking system and genetic analyzing method of Chinese mitten crabs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN200910020751.9A CN101613742B (en) | 2009-04-24 | 2009-04-24 | Multielement high flux genetic marking system and genetic analyzing method of Chinese mitten crabs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101613742A true CN101613742A (en) | 2009-12-30 |
| CN101613742B CN101613742B (en) | 2014-12-24 |
Family
ID=41493628
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN200910020751.9A Expired - Fee Related CN101613742B (en) | 2009-04-24 | 2009-04-24 | Multielement high flux genetic marking system and genetic analyzing method of Chinese mitten crabs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101613742B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942432A (en) * | 2010-08-12 | 2011-01-12 | 中国海洋大学 | Method for screening tegillarca granosa mitochondria COI gene amplification primers |
| CN101942433A (en) * | 2010-08-12 | 2011-01-12 | 中国海洋大学 | Screening method of Muricidae mitochondrion COI gene amplification primer |
| CN102776181A (en) * | 2012-06-07 | 2012-11-14 | 中国海洋大学 | Amplification primer of corbiculidae shellfish mitochondria COI (Cytochrome Oxidase I) gene |
| CN103667272A (en) * | 2013-12-04 | 2014-03-26 | 天津市水生动物疫病预防控制中心 | Eriocheir-sinensis-growth-trait-related EST (expressed sequence tag)-SSR (simple sequence repeat) molecular marker and application thereof |
| CN105255880A (en) * | 2015-11-17 | 2016-01-20 | 万超 | Sea urchin species specificity detection primer and application |
| CN107287313A (en) * | 2017-07-07 | 2017-10-24 | 中国科学院南海海洋研究所 | It is a kind of to hybridize hippocampus and its identification primer and authentication method of parent |
-
2009
- 2009-04-24 CN CN200910020751.9A patent/CN101613742B/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| GOPURENKO D ET AL: "Regional patterns of genetic structure among Australian populations of the mud crab,Scylla serrata (Crustacea: Decapoda): evidence from mitochondrial DNA", 《MARINE AND FRESHWATER RESEARCH》 * |
| ROMAN J ET AL: "A global invader at home: population structure of the green crab, Carcinus maenas, in Europe", 《MOLECULAR ECOLOGY》 * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101942432A (en) * | 2010-08-12 | 2011-01-12 | 中国海洋大学 | Method for screening tegillarca granosa mitochondria COI gene amplification primers |
| CN101942433A (en) * | 2010-08-12 | 2011-01-12 | 中国海洋大学 | Screening method of Muricidae mitochondrion COI gene amplification primer |
| CN101942433B (en) * | 2010-08-12 | 2012-09-05 | 中国海洋大学 | Amplification primer of muricidae mitochondrion COI gene |
| CN101942432B (en) * | 2010-08-12 | 2012-11-07 | 中国海洋大学 | Tegillarca granosa mitochondria COI gene amplification primers |
| CN102776181A (en) * | 2012-06-07 | 2012-11-14 | 中国海洋大学 | Amplification primer of corbiculidae shellfish mitochondria COI (Cytochrome Oxidase I) gene |
| CN102776181B (en) * | 2012-06-07 | 2014-05-21 | 中国海洋大学 | Amplification primer of corbiculidae shellfish mitochondria COI (Cytochrome Oxidase I) gene |
| CN103667272A (en) * | 2013-12-04 | 2014-03-26 | 天津市水生动物疫病预防控制中心 | Eriocheir-sinensis-growth-trait-related EST (expressed sequence tag)-SSR (simple sequence repeat) molecular marker and application thereof |
| CN103667272B (en) * | 2013-12-04 | 2015-08-12 | 天津市水生动物疫病预防控制中心 | The EST-SSR molecule marker relevant to mitten crab growth traits and application |
| CN105255880A (en) * | 2015-11-17 | 2016-01-20 | 万超 | Sea urchin species specificity detection primer and application |
| CN107287313A (en) * | 2017-07-07 | 2017-10-24 | 中国科学院南海海洋研究所 | It is a kind of to hybridize hippocampus and its identification primer and authentication method of parent |
| CN107287313B (en) * | 2017-07-07 | 2018-11-20 | 中国科学院南海海洋研究所 | A kind of identification primer and identification method hybridizing hippocampus and its parent |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101613742B (en) | 2014-12-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2019101778A4 (en) | Method for constructing rice molecular marker map based on Kompetitive Allele Specific PCR and application in breeding Using the same | |
| Field et al. | Patterns of hybridization and asymmetrical gene flow in hybrid zones of the rare Eucalyptus aggregata and common E. rubida | |
| Bhattarai et al. | In silico development and characterization of tri-nucleotide simple sequence repeat markers in hazelnut (Corylus avellana L.) | |
| CN110042172B (en) | Rapid identification primer and method for citrus hybrids based on SNP markers | |
| CN101613742A (en) | A kind of mitten crab multielement high flux genetic marker system and genetic analysis method | |
| Tong et al. | Construction of high-density linkage maps of Populus deltoides× P. simonii using restriction-site associated DNA sequencing | |
| Liu et al. | Extensive hybridization and introgression between Melastoma candidum and M. sanguineum | |
| KR102206211B1 (en) | Genetic marker for parentage and thereof in Limanda yokohamae | |
| Holtz et al. | Genotyping by sequencing using specific allelic capture to build a high-density genetic map of durum wheat | |
| CN104988142A (en) | Novel cucumber SNP molecular marker | |
| Nunziata et al. | Single nucleotide polymorphisms as practical molecular tools to support European chestnut agrobiodiversity management | |
| Hersch-Green et al. | Genetic analysis of admixture and patterns of introgression in foundation cottonwood trees (Salicaceae) in southwestern Colorado, USA | |
| CN102321752B (en) | Fluorescence labeled detection kit for simultaneously analyzing 17 gene loci of canine genomic DNA, detection method and application thereof | |
| CN113249509B (en) | Identification primer and identification method for interspecific hybrid progeny of populus jaborandi and populus microphylla | |
| CN111662953B (en) | Technical system capable of identifying disease-resistant genes by inoculating pathogens in different plant disease systems | |
| CN101565744B (en) | Polynary high-throughput genetic marking system and genetic analysis method for blue crabs | |
| CN116590453B (en) | SNP molecular marker related to dwarf trait of lotus plant and application thereof | |
| CN108411024A (en) | One molecular marker SNP 6 isolated with cucumber-pickled cucumber Introgressed line mildew-resistance gene | |
| KR20180055075A (en) | Single nucleotide polymorphism marker for selecting bacterial wilt-resistant or sensitive pepper cultivar and uses thereof | |
| CN110373489B (en) | KASP marker related to wheat grain protein content and application thereof | |
| CN108060247B (en) | Haplotype related to upland cotton No. 8 chromosome fiber strength | |
| CN107447020B (en) | Molecular label for individual identification of sika deer, identification method and application | |
| CN103484457B (en) | Profit Shandong microsatellite loci molecular marker primer pair and application thereof | |
| Fletcher et al. | AFLAP: Assembly-Free Linkage Analysis Pipeline using k-mers from whole genome sequencing data | |
| Susek et al. | Cytomolecular insight into Lupinus genomes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141224 |