CN103468699B - Aeromonas hydrophila is fit and its screening technique and application - Google Patents
Aeromonas hydrophila is fit and its screening technique and application Download PDFInfo
- Publication number
- CN103468699B CN103468699B CN201310365220.XA CN201310365220A CN103468699B CN 103468699 B CN103468699 B CN 103468699B CN 201310365220 A CN201310365220 A CN 201310365220A CN 103468699 B CN103468699 B CN 103468699B
- Authority
- CN
- China
- Prior art keywords
- fit
- aeromonas hydrophila
- ssdna
- hydrophila
- selex
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to Aeromonas hydrophila is fit and its screening technique and application.Offer Aeromonas hydrophila is fit and the fit screening technique of the Aeromonas hydrophila and application.The specific steps of the screening technique that the Aeromonas hydrophila is fit include:The fit ssDNA libraries of Aeromonas hydrophila to be screened are built and synthesized, and designs the corresponding primer of synthesis;The appropriate ssDNA libraries are taken to be combined with Aeromonas hydrophila;The ssDNA for obtaining and being combined with Aeromonas hydrophila is separated, PCT amplifications are carried out by template of the ssDNA, amplified production carries out SELEX screenings until obtaining corresponding fit again.The present invention goes out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, the fit detection that can be widely applied to Aeromonas hydrophila and analysis using SELEX technology screenings.
Description
Technical field
The present invention relates to infective pathogen bacterium --- Aeromonas hydrophila common in aquaculture, more particularly to thermophilic aqueous vapor list
Born of the same parents bacterium is fit and its screening technique and application.
Background technology
Aeromonas hydrophila(Aeromonas hydrophila)In distributed in nature extensively, it is the original of various aquatic animals
Hair property pathogenic bacteria, can produce various virulence factors, and to aquatic livestock, livestock and poultry and the mankind have pathogenic, can cause many animals
Septicemia and the mankind diarrhoea, to mankind's health care belt come threat, while also causing larger economic loss to aquaculture(1.
Beautiful, the Yu Zhouliang of kingfisher, Zhao Baohua, He Hong pavilion Advancement in Study on Aeromonas hydrophila [J] China Veterinary Journal, 2008,42(7):46-
50.).Therefore, polluted for the Aeromonas hydrophila as pollution of waterhead indicator bacteria, its inspecting force still needs to further reinforcement.
The detection of current Aeromonas hydrophila is always a stubborn problem, and traditional chemical pathological examination process is cumbersome, expends the time;
Enzyme linked immunological, multiple PCR technique then high cost(2. several detection methods [J] inlands of Wang Li Fish Aeromonas Hydrophilas
Aquatic products, 2006,(2):22-23.).Therefore, develop a kind of easy to operate, with low cost, quickly and easily Aeromonas hydrophila inspection
Survey method, as those skilled in the art's technical barrier in the urgent need to address.
SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is to refer to
Number enrichment Fas lignand system evolution technology, is nineteen ninety to synthesize the few core of screening in vitro by one kind that the Tuerk and Gold in the U.S. are created
The chemical combination technology that thuja acid is fit(3. the Meng Qing tinkling of pieces of jade, old wound husband .SELEX technologies and its application prospect [J] Tarim University are learned
Report, 2008,20 (3):Liao's generation of 44-48. 4. is strange, Liu Wei, Wang Li .SELEX technologies application study progress [J] Gansu medicine,
2009, (02):96-97.).Due to fit with specific high, storage capacity is big, generated time is short(5. Wang Cong is gorgeous, Sun Wei, Li Jian
State, waits .SELEX technologies application study progress [J] biotechnologys to circulate a notice of, 2006, (S1):232-236.)The advantages of, SELEX
Technology is widely used in the different technical field such as control and prevention of disease, drug screening, clinical diagnosis now, with the continuous wound of technology
Newly with development, gradually generate some new SELEX screening techniques, be such as oriented to SELEX technologies, compound target molecule SELEX technologies,
The research meanses of genomic SELEX innovation(6. the Meng Qing tinkling of pieces of jade, old wound husband .SELEX technologies and its application prospect [J] Tarim Basins
College journal, 2008,20 (3):44-48.).
The content of the invention
The first object of the present invention is that offer Aeromonas hydrophila is fit.
The second object of the present invention is to provide the Aeromonas hydrophila fit screening technique.
The third object of the present invention is the offer Aeromonas hydrophila fit in Aeromonas hydrophila is stated in detection
Using.
The nucleotide sequence that the Aeromonas hydrophila is fit is as shown in the sequence in sequence table No. 1-22.
The screening technique that the Aeromonas hydrophila is fit is by index concentration Fas lignand system evolution technology(That is SELEX is sieved
Choosing)The fit screening of Aeromonas hydrophila is applied to, the specific steps of the SELEX screenings include:
1)The fit ssDNA libraries of Aeromonas hydrophila to be screened are built and synthesized, and designs the corresponding primer of synthesis;
2)The appropriate ssDNA libraries are taken to be combined with Aeromonas hydrophila;
3)The ssDNA for obtaining and being combined with Aeromonas hydrophila is separated, PCT amplifications are carried out by template of the ssDNA, amplification is produced
Thing carries out SELEX screenings until obtaining corresponding fit again.
In step 1)In, the ssDNA libraries can be::5′-GGG AGC TCA GAA TAA ACG CTC AA-N35-
TT CGA CAT GAG GCC CGG ATC-3′。
The primer can be:
Primer I:5′-GGG AGC TCA GAA TAA ACG CTC AA-3′;
Primer II:5′-GAT CCG GGC CTC ATG TCG AA-3′;
Primer III:5 '-digoxin-GGG AGC TCA GAA TAA ACG CTC AA-3 ';
Primer IV:5 '-biotin-GAT CCG GGC CTC ATG TCG AA-3 '.
In step 3)In, the SELEX screenings carry out 12 wheels altogether.
The present invention goes out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, institute using SELEX technology screenings
State the fit exploitation of Fast Detection Technique and the application in terms of aquatic products Disease management for Aeromonas hydrophila and reference be provided,
Can be widely applied to the detection and analysis of Aeromonas hydrophila.
Brief description of the drawings
Fig. 1 is the agarose gel electrophoresis figure of PCR primer 3%.In Fig. 1, M is 50bp DNA marker, 1,3,5,7,9,
11st, 12 the PCR primer of the 1st, 3,5,7,9,11,12 wheels is represented respectively.
Fig. 2 is the fit absorbance combined with Aeromonas hydrophila.In fig. 2, abscissa is number of screening round, and ordinate is
Absorbance during A450nm.
Fig. 3-Fig. 5 is the aptamer secondary structure figure that the present invention is screened.Structure minimum free energy in Fig. 3 for-
7.60 kilocalories/rub, structure minimum free energy in Fig. 4 for 1.83 kilocalories/rub, the structure minimum free energy in Fig. 5 is -3.11 thousand
Block/rub.
Specific embodiment
First, the synthesis of ssDNA libraries and primer
Reference literature(7th, Liu Fengwei, research and Preliminary Applications [D] that blue small roc in-vitro screening pseudomonas aeruginosas are fit
Foochow Medical University Of Fujian, 2007.)Disclosed in method, for SELEX screening ssDNA pool and primer by Shanghai
Sheng Gong biotechnologies Services Co., Ltd synthesizes.
Library used is:5′-GGG AGC TCA GAA TAA ACG CTC AA-N35-TT CGA CAT GAG GCC
CGG ATC-3′。
The primer is respectively:
Primer I:5′-GGG AGC TCA GAA TAA ACG CTC AA-3′;
Primer II:5′-GAT CCG GGC CTC ATG TCG AA-3′;
Primer III:5 '-digoxin-GGG AGC TCA GAA TAA ACG CTC AA-3 ';
Primer IV:5 '-biotin-GAT CCG GGC CTC ATG TCG AA-3 '.
Above-mentioned primer is in post synthesis with the TE buffer solutions commonly used in molecular biology(pH8.0)Concentration is diluted to for 10 μ
Mol, -20 DEG C save backup.
2nd, prepared by experiment reagent and buffer solution
Dynabeads streptavidin magnetic bead M-280 kits, 2 × Taq PCR MasterMix, 50bp DNA
Ladder Marker, bovine serum albumin(BSA)(BSA)It is purchased from Xiamen Lu Long Bioisystech Co., Ltd, the purifying examination of PCR glue reclaims
Agent box is purchased from omega companies, and anti-digoxin alkaline phosphatase is purchased from Roche companies, and 4-NPP is Amresco public
Department's product.Buffer solution is with reference to bibliography (Liu Fengwei, research that blue small roc in-vitro screening pseudomonas aeruginosas are fit and preliminary
Using [D] Foochow Medical University Of Fujian, 2007.) prepare.
3rd, strain:Aeromonas hydrophila AS1.1801 is purchased from Chinese industrial Microbiological Culture Collection administrative center.
4th, SELEX screenings
Take a certain amount of ssDNA pool(First run screening consumption is 600pmol, and then often wheel reduces consumption), add 600
μ L selection buffer solution dilution ssDNA, 5min is denatured in 95 DEG C, cools down 10min.Add the Aeromonas hydrophila bacteria suspension of 30 μ L
(The quantity of bacterium is about 1.5 × 108It is individual), mixing puts and 10min is centrifuged at 30min, 15000r/min, 4 DEG C of shaking table room temperature combination.It
After abandon supernatant, add that 600 μ L selection buffer solutions are resuspended, such repeated washing 3 times washes away what is do not combined with Aeromonas hydrophila
SsDNA, combines the 100 μ L ddH of Aeromonas hydrophila precipitation of ssDNA2O is resuspended, 96 DEG C of heating 5min, is taken after centrifugation
Clearly it is template, entering performing PCR with primer I, IV expands, and obtains the double-stranded DNA of mark biotin(dsDNA), it is logical using M-280 magnetic beads
The interaction crossed between biotin-streptavidin separates ssDNA, used as the secondary storehouse that next round is screened.According to above-mentioned side
Method, SELEX screenings are carried out to secondary storehouse again, successively carry out 12 wheel SELEX screenings.
5th, fit measure and fit sequence and analysis with Aeromonas hydrophila Percentage bound is respectively taken turns
By the product of the 1st, 3,5,7,9,11,12 wheel SELEX screenings(That is the wash-out supernatant of the wheel), with primer III and primer
IV enters performing PCR amplification, and each wheel expands 320 μ L.PCR amplification system is:2 × Taq PCR MasterMix 10ul, upstream is drawn
Thing (10um), anti-sense primer (10um) each 0.4ul, template 1ul, 20ul is supplied with deionized water.PCR reaction conditions are:95
DEG C predegeneration 3min;94 DEG C of denaturation 30s, 58 DEG C of -70 DEG C of annealing 30s, 72 DEG C of extension 20s, 24 circulations;72 DEG C of extension 3min.
Pcr amplification product is purified with glue reclaim purification kit, purified product is examined using 3% agarose electrophoresis
Survey, it can be seen that electrophoretic band is more and more finer and close, while diffusing phenomenon is fewer and feweri, band is more next with the increase of screening number of times
More neat and brightness increased.Illustrate that, with the increase of screening number of times, SPECIFIC APTAMER is enriched with, its homology may
Compare high
The dsDNA of purifying is unwind into ssDNA by PCR primer Streptavidin MagneSphere after purification, and this ssDNA is to carry
Digoxigenin labeled, determines its content.SsDNA: Aeromonas hydrophila=300pmol: 1.5 × 10 are pressed again8Ratio, will both
30min is combined in 500 μ L selection buffer solutions, the alkali that the anti digoxin antibody for adding 100 μ L 1: 15000 to dilute after centrifugation is marked
Acid phosphatase react 10min, centrifugation abandon supernatant and with 500 μ L selection buffer solution suspension Aeromonas hydrophila, repeated washing 3 times,
The alkaline phosphatase of the anti digoxin antibody mark not combined with ssDNA- digoxin on Aeromonas hydrophila is washed away, is subsequently adding
100 μ L para-nitro-pheneye phosphates solution are developed the color, and 100 μ L 2mol/L NaOH terminating reactions are added after colour developing is good, with ELIASA in
405 nm mensuration absorbance values, experimental result is referring to Fig. 1.The affinity measurement result shows, with the increase of number of screening round, fits
Body gradually increases with the affinity of bacterium solution, the 9th take turns when reach maximum, afterwards affinity change less, tend towards stability, explanation
It is fit to have reached saturation.
The PCR primer of the 12nd wheel is largely expanded with primer I and primer II again, is sent after purification limited in English fine horse biotechnology
It is random after company clone, clone to take 24 clone sequencings, obtain 22 satisfactory fit sequences.According to random sequence
The number of base is divided into A crowds, B crowds of two groups.A groups(It is shown in Table 1)It is consistent with expected length including 13 fit sequences, B groups(See
Table 2)Comprising 9 sequences, expected length is shorter than.Sequencing result is shown in Table 1.With the software kits of Macaw 2.05 analyze 22 it is fit
Homologous sequence, obtains 4 conserved sequences:GTTTTX(See A1-1, A1-8, A1-13, A1-17, A1-20, A1-21, A1-26,
No. A1-30 fit);GTGGGT(See A1-1, A1-7, A1-12, A1-15, A1-22, A1-29);GTTTX(See A1-1, A1-
5、A1-7、A1-10、A1-13、A1-14、A1-15、A1-18、A1-21、A1-22、A1-29);XTTTT(See A1-14, A1-
26、A1-27).Have it is fit in same conserved sequence occur multiple, there is GTTTG three times in such as A1-18;Have it is fit in then
There are multiple conserved sequences, but without discovery be present in it is all it is fit in conserved sequence.
It is fit | Numbering in sequence table | Nucleotide sequence |
A1-3 | 1 | TGGTGGTCTGCTAGCGGTTTATGTTTTTGTCTGGT |
A1-4 | 2 | AGGATGGATTAGTGGGATTGGTGGTTAGGGGGGG |
A1-5 | 3 | GACCTCGTCTTCGGTGTGATCGTTTCTTGTTGTTG |
A1-7 | 4 | GGTGTGTTGGTGGGTGTGTGTTTGGGTTCTTGGGT |
A1-14 | 5 | TGCGGCTGTGTGGGTGGTTTGGGTTTGTTGCTTTT |
A1-15 | 6 | GCGGTGGGTGGTAGGTTTGTGTTTGTTAATGGGTG |
A1-17 | 7 | GTTGTCTCTGGTGTTTTGGATTGATGGCCTTGCTG |
A1-18 | 8 | GGTGTCTGGTTTGTTGTGGTTGTTTGTGGTTTGTG |
A1-20 | 9 | GCGGTTATGTGAAATTATGGCATGGTTTTGTGGTG |
A1-26 | 10 | GGTCCATTGGCTGTGTTTTCTAGGTGTTATGTTTT |
A1-27 | 11 | GGTCGTTAGACGGGGCTAGTAATATATTTCCTTTT |
A1-29 | 12 | CTGTCGTGTGTTTGGGTGTGGGTCGTGTGGTTGGT |
A1-31 | 13 | GTATAGATGTACTGCTGTGCATATCCTATGCAACT |
The A groups of Aeromonas hydrophilas of table 1 are fit
It is fit | Numbering in sequence table | Nucleotide sequence |
A1-1 | 14 | GGTGGTGGGTGTTTTGTCGGTTTGGTGTTTGGT |
A1-8 | 15 | TGGCGGTGTTTTTGGGTGGGGTTATAGG |
A1-10 | 16 | CTGGCTGTTCGTTTAGAATGAACCGGTCATG |
A1-12 | 17 | GTTGTGGTGGGGTCGGAGGTTGTCTGGT |
A1-13 | 18 | TGGTGTTTGGTTGTTTTGTTTGG |
A1-21 | 19 | TTTGTGGCGGGGTTTGCTTGGTTTTGTGGTGG |
A1-22 | 20 | GGGGTGGGTGGGTGTGTGTTTGGTTGGTTTG |
A1-30 | 21 | GGGTTGGTTTGGGGGGGGCTGTTTTG |
A1-28 | 22 | GGGTGGGTTGGTTGGTGGTTGTTTTTGTG |
The B groups of Aeromonas hydrophilas of table 2 are fit
Secondary structure analysis are carried out to 22 measured sequences with DNAMAN softwares, three can be classified as according to structure
Class:
The first kind:The fixed sequence program area base at 5 ' ends rises with the 6th base at 3 ' ends and forms loop-stem structure, middle random area
Loop-stem structure is formed, 5 fixed bases at 3 ' ends form a small bag structure(Fig. 3).This structure it is fit have A1-3,
A1-5, A1-7, A1-13, A1-14, A1-20, A1-22 totally seven;
Equations of The Second Kind:3rd to 21 bases at 5 ' ends form loop-stem structure, and 3 ' end fixed sequence program area's bases and centre are random
Area's base forms stem ring and projection, then forms a pocket by 5 ' ends, 3 ' end fixed sequence program area's bases and middle random area again
Structure(Fig. 4), the fit of this structure have A1-1, A1-4, A1-12, A1-15, A1-17, A1-18, A1-21, A1-27, A1-
28th, A1-29, A1-30, A1-31 totally ten two;
3rd class:5 ' ends, 3 ' end fixed sequence program area number of base form loop-stem structure with random area respectively, then by 5 '
End, 3 ' end fixed sequence program area's bases and middle random area re-form a big bag structure(Fig. 5).The fit of this structure has
A1-8, A1-10, A1-26 tri-.
The artificial synthesized ssDNA libraries total length 78bp of applicant, middle 35bp is random nucleotide, because each site has
Tetra- kinds of possibility of A, G, C, T, 35 sequences just have 4 in the middle of such words35Individual to combine, i.e., its storage capacity has reached 1016It
It is many, although may only to 10 in actual experiment14 Left and right, but this also meet screening purpose oligonucleotides the need for(8th, Li Wei
Shore, Lan little Peng, Yang Xiangyue wait utilization [J] Foochow hospital general journal of the .SELEX technologies in screening Ciclosporin A is fit,
2007,(03):171-173).During preceding two-wheeled is screened, the library amount of applicant's addition is relatively more, and such purpose is
Obtain more fit with what Aeromonas hydrophila specifically bound as far as possible.But it is secondary with the increase of number of screening round
The amount in library will be reduced accordingly, because the concentration in library is increasing.In order to increase fit specificity,
Applicant accordingly increased washing steps, while after the time that library is combined with bacterium solution is also reduced to from the 30min of former wheels
The 20min for coming.The optimization of PCR conditions is also particularly significant to fit screening, and each round screening, applicant will first make a ladder
Degree PCR, does PCR amplifications again on the premise of most suitable annealing temperature is obtained, and so effectively avoids non-specific amplification etc. and asks
Topic.
Applicant's experiment with to be Streptavidin MagneSphere be enriched with secondary library, it is simple to operate, need not be centrifuged, only
The effect of separation is can reach under the influence of a magnetic field, while the secondary library that it is obtained is more stable, purity is higher, is difficult
There is the problem of the non-specific amplification in asymmetric PCR.Screened by 12 wheels, during obtain 22 of cloning and sequencing are fit, had
13 fit consistent always with expected length.
Using DNAMAN softwares to its secondary structure analysis, as can be seen from the results, the secondary structure of these sequences is all
It is by stem ring and pocket(Spoon shape)Structure composition, this illustrates that stem ring and bag structure are probably fit and Aeromonas hydrophila knot
The architecture basics of conjunction, stem may play a part of rock-steady structure, and ring is probably its binding site.Contain spoon in some secondary structures
The pocket of shape, these pockets are likely to play the same effect of same ring, it is possible to be the binding site combined with acceptor.At these
In stem structure, its base is mainly based on G-C, and because the structure of G-C can be more than A-T, this point also illustrates that stem may be played surely
It is set for using.
The preliminary SELEX methods that establish of the invention screen the fit method of Aeromonas hydrophila, while obtaining with special
The Aeromonas hydrophila of property it is fit, and secondary structure to fit group tentatively studied, and obtains the one of its secondary structure
A little structure compositions, this has laid certain basis to study the molecular structure of Aeromonas hydrophila later, while being also thermophilic aqueous vapor
The detection of monad provides a kind of new method.
Claims (2)
1. Aeromonas hydrophila is fit, it is characterised in that its sequence is such as
GGGAGCTCAGAATAAACGCTCAATGGTGTTTGGTTGTTTTGTTTGGTTCGACATGAGGCCCGGATC
It is shown.
2. the fit application in Aeromonas hydrophila is detected of Aeromonas hydrophila as claimed in claim 1, the application is non-
The application of medical diagnosis on disease purpose.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310365220.XA CN103468699B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila is fit and its screening technique and application |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201310365220.XA CN103468699B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila is fit and its screening technique and application |
CN2012100017770A CN102643821B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila aptamer, and screening method and application thereof |
Related Parent Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2012100017770A Division CN102643821B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila aptamer, and screening method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN103468699A CN103468699A (en) | 2013-12-25 |
CN103468699B true CN103468699B (en) | 2017-07-11 |
Family
ID=49793740
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201310365220.XA Expired - Fee Related CN103468699B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila is fit and its screening technique and application |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103468699B (en) |
Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1506468A (en) * | 2002-12-10 | 2004-06-23 | 福建省农业科学院生物技术中心 | PCR test kit for hygrophilous aeromonad and its test method |
JP2010172324A (en) * | 2009-02-02 | 2010-08-12 | Tdk Corp | Method and kit for detecting microorganism using aptamer |
CN102199667A (en) * | 2011-04-12 | 2011-09-28 | 集美大学 | Oligonucleotide sequence for detecting vibrio alginolyticus and application thereof |
CN102329862A (en) * | 2011-09-02 | 2012-01-25 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
-
2012
- 2012-01-05 CN CN201310365220.XA patent/CN103468699B/en not_active Expired - Fee Related
Patent Citations (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1506468A (en) * | 2002-12-10 | 2004-06-23 | 福建省农业科学院生物技术中心 | PCR test kit for hygrophilous aeromonad and its test method |
JP2010172324A (en) * | 2009-02-02 | 2010-08-12 | Tdk Corp | Method and kit for detecting microorganism using aptamer |
CN102199667A (en) * | 2011-04-12 | 2011-09-28 | 集美大学 | Oligonucleotide sequence for detecting vibrio alginolyticus and application thereof |
CN102329862A (en) * | 2011-09-02 | 2012-01-25 | 集美大学 | Three oligonucleotide sequences for identification and detection of vibrio alginolyticus as well as preparation method and application thereof |
Non-Patent Citations (2)
Title |
---|
SELEX技术在致病菌检测中应用进展;余晓峰等;《家禽科学》;20110731(第7期);43 * |
致病性嗜水气单胞菌多重PCR检测方法的建立;饶静静等;《中国水产科学》;20070930;第14卷(第5期);749 * |
Also Published As
Publication number | Publication date |
---|---|
CN103468699A (en) | 2013-12-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106701737A (en) | High-efficiency DNA purified magnetic bead reagent with fragment selective purification capacity | |
CN103571822A (en) | Multipurpose DNA segment enrichment method used for next generation sequencing | |
CN103468700B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468698B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468696B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN109750092A (en) | A kind of method and kit of targeting enrichment high GC content target dna | |
CN103468701B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468699B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468692B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468695B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468697B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468694B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
CN103468684B (en) | Aeromonas hydrophila is fit and screening method and application | |
CN103468702B (en) | Aeromonas hydrophila aptamer as well as screening method and application thereof | |
CN103981258B (en) | A kind of tumor susceptibility gene SNP site detection method and kit | |
CN103468693B (en) | Aeromonas hydrophila is fit and screening technique and application | |
CN103468703B (en) | Aeromonas hydrophila is fit and screening technique and application | |
CN103468686B (en) | Aeromonas hydrophila is fit and screening technique and application | |
CN103468687B (en) | Aeromonas hydrophila is fit and screening technique and application | |
CN103468689B (en) | Aeromonas hydrophila is fit and screening technique and application | |
CN103468683B (en) | Aeromonas hydrophila is fit and screening technique and application | |
CN103468690B (en) | Aeromonas hydrophila is fit and screening technique and application | |
CN104818533A (en) | Preparing method of ssDNA (single-stranded DNA) secondary library | |
CN103468691A (en) | Aeromonas hydrophila aptamer, and screening method and application thereof | |
CN102321622A (en) | Primer-solid-phase carrier composite and methods for preparing primer-solid-phase carrier and sequencing |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant | ||
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20170711 Termination date: 20200105 |