CN103468699A - Aeromonas hydrophila aptamer, and screening method and application thereof - Google Patents

Abstract

The invention relates to an aeromonas hydrophila aptamer, and a screening method and application thereof, and provides an aeromonas hydrophila aptamer, and a screening method and application of the aeromonas hydrophila aptamer. The screening method of the aeromonas hydrophila aptamer specifically comprises the following steps: constructing and synthesizing ssDNA libraries of a to-be-screened aeromonas hydrophila aptamer and designing and synthesizing a corresponding primer; taking a proper amount of ssDNA libraries to be combined with aeromonas hydrophila, separating obtained ssDNA which is combined with the aeromonas hydrophila, performing PCT amplification by taking the ssDNA as a template, and performing SELEX screening on an amplification product again until obtaining a corresponding aptamer. According to the invention, the SELEX technology is adopted to screen out a high-appetency oligonucleotide aptamer of pathogenetic aeromonas hydrophila, and the aptamer can be widely applied to detection and analysis of aeromonas hydrophila.

Description

Aeromonas hydrophila is fit and screening method and application

Technical field

The present invention relates to infective pathogen bacterium---Aeromonas hydrophila common in aquaculture, particularly fit and screening method and application of Aeromonas hydrophila.

Background technology

Aeromonas hydrophila ( aeromonas hydrophila)extensive in distributed in nature, be the primary pathogenic bacterium of multiple hydrocoles, can produce multiple virulence factor, to aquatic animal, livestock and poultry and the mankind all have pathogenic, can cause septicemia and mankind's diarrhoea of many animals, to human health, have brought threat, also to aquaculture, cause larger financial loss (1. a kingfisher is beautiful simultaneously, Yu Zhouliang, Zhao Baohua ，He Hong pavilion. Advancement in Study on Aeromonas hydrophila [J]. Chinese animal doctor's magazine, 2008,42(7): 46-50.).Therefore, for the Aeromonas hydrophila as the pollution of waterhead indicator, pollute, its inspecting force still needs further reinforcement.The detection of Aeromonas hydrophila at present is a stubborn problem always, and traditional chemical pathology detection process is loaded down with trivial details, expends time in; Enzyme linked immunological, multiple PCR technique high cost (2. Wang Li. several detection methods [J] of Fish Aeromonas Hydrophila. inland aquatic products, 2006, (2): 22-23.).Therefore, develop a kind of easy and simple to handlely, with low cost, the Aeromonas hydrophila detection method, become those skilled in the art's technical barrier in the urgent need to address quickly and easily.

SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is index concentration Fas lignand system evolution technology, the chemical association technology that a kind of external synthetic screening oligonucleotide that to be nineteen ninety created by Tuerk and the Gold of the U.S. is fit (the 3. Meng Qing tinkling of pieces of jade, old wound husband .SELEX technology and application prospect [J] thereof. Tarim University's journal, 2008,20 (3): 44-48. 4. Liao's generation are strange, Liu Wei, Wang Li .SELEX technology applied research progress [J]. Gansu medicine, 2009, (02): 96-97.).To have specificity high due to fit, storage capacity is large, generated time is short, and (5. Wang Cong is gorgeous, Sun Wei, Li Jianguo, Deng .SELEX technology applied research progress [J]. the biotechnology circular, 2006, (S1): the advantage such as 232-236.), the SELEX technology is widely used in control and prevention of disease now, drug screening, the technical field that clinical diagnosis etc. are different, constantly bringing forth new ideas and developing along with technology, some new SELEX screening methods have been produced gradually, as the SELEX technology that leads, composition target molecule SELEX technology, the research means of genomic SELEX innovation (the 6. Meng Qing tinkling of pieces of jade, old wound husband .SELEX technology and application prospect [J] thereof. Tarim University's journal, 2008, 20 (3): 44-48.).

Summary of the invention

The first purpose of the present invention is to provide Aeromonas hydrophila fit.

The screening method that provides described Aeromonas hydrophila fit is provided the second purpose of the present invention.

The 3rd purpose of the present invention is to provide that described Aeromonas hydrophila is fit in detection, states the application in Aeromonas hydrophila.

The nucleotide sequence that described Aeromonas hydrophila is fit is as shown in the sequence in sequence table No. 1-22.

The screening method that described Aeromonas hydrophila is fit is that index concentration Fas lignand system evolution technology (being the SELEX screening) is applied to the fit screening of Aeromonas hydrophila, and the concrete steps of described SELEX screening comprise:

1) build and synthesize the fit ssDNA of Aeromonas hydrophila to be screened library, and the synthetic corresponding primer of design;

2) get appropriate described ssDNA library and Aeromonas hydrophila and carry out combination;

3) separate to obtain the ssDNA of being combined with Aeromonas hydrophila, take this ssDNA carries out the PCT amplification as template, and amplified production carries out the SELEX screening again until obtain corresponding fit.

In step 1), described ssDNA library can be:: 5 '-GGG AGC TCA GAA TAA ACG CTC AA-N35-TT CGA CAT GAG GCC CGG ATC-3 '.

Described primer can be:

The primer I: 5 '-GGG AGC TCA GAA TAA ACG CTC AA-3 ';

The primer II: 5 '-GAT CCG GGC CTC ATG TCG AA-3 ';

The primer III: 5 '-digoxin-GGG AGC TCA GAA TAA ACG CTC AA-3 ';

The primer IV: 5 '-vitamin H-GAT CCG GGC CTC ATG TCG AA-3 '.

In step 3), described SELEX screening is carried out altogether 12 and is taken turns.

It is fit that the present invention adopts the SELEX technology screening to go out the high-affinity oligonucleotide of pathogenic hydrophila gingivalis, the exploitation of the described fit Fast Detection Technique for Aeromonas hydrophila and provide reference in the application aspect the control of aquatic products disease, can be widely used in detection and the analysis of Aeromonas hydrophila.

The accompanying drawing explanation

Fig. 1 is PCR product 3% agarose gel electrophoresis figure.In Fig. 1, M is 50bp DNA marker, and 1,3,5,7,9,11,12 mean respectively the 1st, 3,5,7,9,11, the 12 PCR products of taking turns.

Fig. 2 is fit absorbancy of being combined with Aeromonas hydrophila.In Fig. 2, X-coordinate is the screening wheel number, absorbancy when ordinate zou is A450nm.

Fig. 3-Fig. 5 is the aptamer secondary structure figure that the present invention screens.Structure minimum free energy in Fig. 3 be-7.60 kilocalories/rub, the structure minimum free energy in Fig. 4 be 1.83 kilocalories/rub, the structure minimum free energy in Fig. 5 be-3.11 kilocalories/rub.

Embodiment

One, ssDNA library and primer is synthetic

Reference literature (7, Liu Fengwei, Lan little Peng. the research that the in-vitro screening Pseudomonas aeruginosa is fit and Preliminary Applications [D]. Foochow Medical University Of Fujian, 2007.) in disclosed method, synthetic by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd for ssDNA pool and the primer of SELEX screening.

Library used is: 5 '-GGG AGC TCA GAA TAA ACG CTC AA-N35-TT CGA CAT GAG GCC CGG ATC-3 '.

The primer is respectively:

The primer I: 5 '-GGG AGC TCA GAA TAA ACG CTC AA-3 ';

The primer II: 5 '-GAT CCG GGC CTC ATG TCG AA-3 ';

The primer III: 5 '-digoxin-GGG AGC TCA GAA TAA ACG CTC AA-3 ';

The primer IV: 5 '-vitamin H-GAT CCG GGC CTC ATG TCG AA-3 '.

It is 10 μ mol that above-mentioned primer is diluted to concentration with TE damping fluid (pH8.0) commonly used in molecular biology after synthetic, and-20 ℃ save backup.

Two, experiment reagent and damping fluid preparation

Dynabeads streptavidin magnetic bead M-280 test kit, 2 * Taq PCR MasterMix, 50bp DNA Ladder Marker, bovine serum albumin (BSA) are all purchased from Xiamen Lu Long Bioisystech Co., Ltd, PCR glue reclaims purification kit purchased from omega company, anti-digoxin alkaline phosphatase is purchased from Roche company, and 4-NPP is Amresco company product.Damping fluid with reference to reference (Liu Fengwei, Lan little Peng. the research that the in-vitro screening Pseudomonas aeruginosa is fit and Preliminary Applications [D]. Foochow Medical University Of Fujian, 2007.) preparation.

Three, bacterial classification: Aeromonas hydrophila AS1.1801 is purchased from Chinese industrial microbial strains preservation administrative center.

Four, SELEX screening

Get a certain amount of ssDNA pool (first run screening consumption is 600pmol, and every the wheel reduced consumption subsequently), add 600 μ L to select damping fluid dilution ssDNA, in 95 ℃ of sex change 5min, cooling 10min.(quantity of bacterium is about 1.5 * 10 to add the Aeromonas hydrophila bacteria suspension of 30 μ L ⁸individual), mix and put the shaking table room temperature in conjunction with 30min, 15000r/min, centrifugal 10min under 4 ℃.Abandon afterwards supernatant liquor, add 600 μ L to select damping fluids resuspended, so repeated washing is 3 times, washes away the ssDNA of not being combined with Aeromonas hydrophila, the Aeromonas hydrophila that combines ssDNA 100 μ L ddH for precipitation ₂o is resuspended, 96 ℃ of heating 5min, and getting supernatant after centrifugal is template, carry out pcr amplification by primer I, IV, obtain the double-stranded DNA (dsDNA) of mark vitamin H, utilize the M-280 magnetic bead to separate ssDNA by the interaction between biotin-streptavidin, as the secondary storehouse of next round screening.According to aforesaid method, secondary storehouse is carried out to the SELEX screening again, successively carry out 12 and take turns the SELEX screening.

Five, respectively take turns the mensuration of fit and Aeromonas hydrophila combination rate and fit sequencing and analysis

By the 1st, 3,5,7,9,11,12 products (i.e. this wash-out supernatant of taking turns) of taking turns the SELEX screening, carry out pcr amplification by primer III and primer IV, each takes turns the 320 μ L that all increase.The pcr amplification system is: 2 * Taq PCR MasterMix 10ul, and upstream primer (10um), each 0.4ul of downstream primer (10um), template 1ul, supply 20ul with deionized water.The PCR reaction conditions is: 95 ℃ of denaturation 3min; 94 ℃ of sex change 30s, 58 ℃-70 ℃ annealing 30s, 72 ℃ are extended 20s, 24 circulations; 72 ℃ are extended 3min.

Pcr amplification product is reclaimed to purification kit with glue and carry out purifying, purified product utilizes 3% agarose electrophoresis detection, can find out that electrophoretic band is more and more finer and close, diffusing phenomenon is fewer and feweri simultaneously, and band is along with the increase of screening number of times is more and more neat and brightness increases to some extent.Explanation is along with the increase of screening number of times, and specificity is fit has obtained enrichment, and its homology may be higher

PCR product after purifying unwinds into ssDNA with Streptavidin MagneSphere by the dsDNA of purifying, and this ssDNA, with digoxigenin labeled, measures its content.Press again ssDNA: Aeromonas hydrophila=300pmol: 1.5 * 10 ⁸ratio, both are selected in damping fluid in conjunction with 30min at 500 μ L, the alkaline phosphatase enzyme reaction 10min that adds the anti digoxin antibody mark of 100 μ L dilution in 1: 15000 after centrifugal, the centrifugal supernatant of abandoning is also selected damping fluid suspension Aeromonas hydrophilas with 500 μ L, repeated washing 3 times, wash away the alkaline phosphatase of the anti digoxin antibody mark that the ssDNA-digoxin is not combined on Aeromonas hydrophila, then add 100 μ L para-nitro-pheneye phosphate solution colour developings, add 100 μ L 2mol/L NaOH termination reactions after colour developing is good, measure absorbance by microplate reader in 405 nm, experimental result is referring to Fig. 1.This avidity measurement result shows, along with the increase of screening wheel number, fitly with avidity bacterium liquid, increases gradually, reaches maximum when the 9th takes turns, afterwards avidity change little, tend towards stability, illustrate fitly to have reached saturated.

By primer I and primer II, the 12nd PCR product of taking turns is increased in a large number again, send after purifying and get at random the order-checking of 24 clone's after the clone of Ying Jun Bioisystech Co., Ltd, clone, obtain 22 satisfactory fit sequences.Number according to the stochastic sequence base is divided into A group, two groups of B group.A group (in Table 1) comprises 13 fit sequences, and consistent with expection length, B group (in Table 2) comprises 9 sequences, all is shorter than expection length.Sequencing result is in Table 1.Analyze 22 fit homologous sequences with Macaw 2.05 software packages, obtain 4 conserved sequence: GTTTTX(see A1-1, A1-8, A1-13, A1-17, A1-20, A1-21, A1-26, No. A1-30 fit); GTGGGT(sees A1-1, A1-7, A1-12, A1-15, A1-22, A1-29); GTTTX(sees A1-1, A1-5, A1-7, A1-10, A1-13, A1-14, A1-15, A1-18, A1-21, A1-22, A1-29); XTTTT(sees A1-14, A1-26, A1-27).Have fit in same conserved sequence occur repeatedly, as in A1-18, GTTTG occurred three times; Have fit in a plurality of conserved sequences appear, but there is no to find to be present in all conserved sequences in fit.

Fit	Numbering in sequence table	Nucleotide sequence
			A1-3	1	TGGTGGTCTGCTAGCGGTTTATGTTTTTGTCTGGT
A1-4	2	AGGATGGATTAGTGGGATTGGTGGTTAGGGGGGG
			A1-5	3	GACCTCGTCTTCGGTGTGATCGTTTCTTGTTGTTG
A1-7	4	GGTGTGTTGGTGGGTGTGTGTTTGGGTTCTTGGGT
			A1-14	5	TGCGGCTGTGTGGGTGGTTTGGGTTTGTTGCTTTT
A1-15	6	GCGGTGGGTGGTAGGTTTGTGTTTGTTAATGGGTG
			A1-17	7	GTTGTCTCTGGTGTTTTGGATTGATGGCCTTGCTG
A1-18	8	GGTGTCTGGTTTGTTGTGGTTGTTTGTGGTTTGTG
			A1-20	9	GCGGTTATGTGAAATTATGGCATGGTTTTGTGGTG
A1-26	10	GGTCCATTGGCTGTGTTTTCTAGGTGTTATGTTTT
			A1-27	11	GGTCGTTAGACGGGGCTAGTAATATATTTCCTTTT
A1-29	12	CTGTCGTGTGTTTGGGTGTGGGTCGTGTGGTTGGT
			A1-31	13	GTATAGATGTACTGCTGTGCATATCCTATGCAACT

Table 1 A group Aeromonas hydrophila is fit

Fit	Numbering in sequence table	Nucleotide sequence
			A1-1	14	GGTGGTGGGTGTTTTGTCGGTTTGGTGTTTGGT
A1-8	15	TGGCGGTGTTTTTGGGTGGGGTTATAGG
			A1-10	16	CTGGCTGTTCGTTTAGAATGAACCGGTCATG
A1-12	17	GTTGTGGTGGGGTCGGAGGTTGTCTGGT
			A1-13	18	TGGTGTTTGGTTGTTTTGTTTGG
A1-21	19	TTTGTGGCGGGGTTTGCTTGGTTTTGTGGTGG
			A1-22	20	GGGGTGGGTGGGTGTGTGTTTGGTTGGTTTG
A1-30	21	GGGTTGGTTTGGGGGGGGCTGTTTTG
			A1-28	22	GGGTGGGTTGGTTGGTGGTTGTTTTTGTG

Table 2 B group Aeromonas hydrophila is fit

With DNAMAN software, 22 measured sequences are carried out to secondary structure analysis, it can be divided three classes according to structure:

The first kind: the 6th base of the fixed sequence program district base and 3 ' end of 5 ' end plays the formation loop-stem structure, and middle random district forms loop-stem structure, 3 ' hold 5 fixing base formation little bag structures (Fig. 3).This structure fit has totally seven of A1-3, A1-5, A1-7, A1-13, A1-14, A1-20, A1-22;

Equations of The Second Kind: the 3rd to 21 bases of 5 ' end form loop-stem structure, 3 ' end fixed sequence program district base forms stem ring projection with middle random district base, and then by 5 ' end, 3 ' end fixed sequence program district base and middle random district form a bag structure (Fig. 4), and this structure fit has totally ten two of A1-1, A1-4, A1-12, A1-15, A1-17, A1-18, A1-21, A1-27, A1-28, A1-29, A1-30, A1-31;

The 3rd class: 5 ' end, 3 ' end fixed sequence program district part base forms loop-stem structure with random district respectively, then by 5 ' end, 3 ' end fixed sequence program district base and middle random district, forms a large bag structure (Fig. 5) again.This structure fit has tri-of A1-8, A1-10, A1-26.

The ssDNA library total length 78bp of applicant's synthetic, middle 35bp is random nucleotide, because there are A, G, C, tetra-kinds of possibilities of T in each site, like this middle 35 sequences just have 4 ³⁵individual may the combination, its storage capacity has reached 10 ¹⁶more than, although may be only to 10 in actual experiment ¹⁴left and right, but this also met screening purpose oligonucleotide needs (8, Li Weibin, Lan little Peng, Yang Xiangyue, wait the utilization [J] of .SELEX technology in the screening Ciclosporin A is fit. hospital general, Foochow journal, 2007, (03): 171-173).In the process of front two-wheeled screening, the library amount that the applicant adds is many, and such purpose is obtain as much as possible many and Aeromonas hydrophila specific binding fit.But, along with the increase of screening wheel number, the amount in secondary library will reduce accordingly, this is because the increasing cause of concentration in library.In order to increase fit specificity, the corresponding wash-out number of times that increased of applicant, library also reduces to 20min afterwards from former 30min that take turns with the time that bacterium liquid is combined simultaneously.The optimization of PCR condition is also very important to fit screening, and each takes turns screening, and the applicant will first do a grads PCR, is obtaining doing pcr amplification, the effective like this problems such as non-specific amplification of having avoided under the prerequisite of the suitableeest annealing temperature again.

What the applicant tested use is that Streptavidin MagneSphere comes the secondary library of enrichment, it is simple to operate, it is centrifugal not need, as long as can reach the effect of separation under the effect in magnetic field, the secondary library that it obtains simultaneously is more stable, purity is higher, is not prone to the problem of the non-specific amplification in asymmetric PCR.In fit by 12 22 of taking turns that screening, cloning and sequencing obtain, have 13 fit always consistent with expection length.

Utilize DNAMAN software to its secondary structure analysis, from result, can find out, the secondary structure of these sequences all is comprised of stem ring and pocket (spoon shape) structure, this has illustrated that stem ring and bag structure may be fit architecture basics of being combined with Aeromonas hydrophila, stem may play a part rock steady structure, and ring may be its combining site.The pocket that contains spoonful shape in some secondary structure, these pockets also may play a part with ring, may be the combining sites with receptors bind.In these stem structures, its base is mainly that G-C is main, and because the structure of G-C can be greater than A-T, this point also illustrates that stem may play stabilization.

The present invention has tentatively set up the fit method of SELEX method screening Aeromonas hydrophila, obtained simultaneously and there is the fit of specific Aeromonas hydrophila, and fit group's secondary structure tentatively is studied, some structures that obtain its secondary structure form, this has laid certain basis for the molecular structure of studying Aeromonas hydrophila later, and the while also provides a kind of new method for the detection of Aeromonas hydrophila.

Claims (2)

1. Aeromonas hydrophila is fit, it is characterized in that, its sequence is as shown in sequence table No. 18.

2. the fit application in detecting Aeromonas hydrophila of Aeromonas hydrophila as claimed in claim 1, the described application that is applied as non-medical diagnosis on disease purpose.

Images