CN103468686B - Aeromonas hydrophila is fit and screening technique and application - Google Patents
Aeromonas hydrophila is fit and screening technique and application Download PDFInfo
- Publication number
- CN103468686B CN103468686B CN201310363871.5A CN201310363871A CN103468686B CN 103468686 B CN103468686 B CN 103468686B CN 201310363871 A CN201310363871 A CN 201310363871A CN 103468686 B CN103468686 B CN 103468686B
- Authority
- CN
- China
- Prior art keywords
- fit
- aeromonas hydrophila
- screening
- ssdna
- hydrophila
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to that Aeromonas hydrophila is fit and screening technique and application.The fit screening technique of the fit and described Aeromonas hydrophila of Aeromonas hydrophila and application are provided.The concrete steps of the screening technique that described Aeromonas hydrophila is fit include: build and synthesize the fit ssDNA library of Aeromonas hydrophila to be screened, and design the corresponding primer of synthesis；Take appropriate described ssDNA library to combine with Aeromonas hydrophila；Separating and obtain the ssDNA being combined with Aeromonas hydrophila, carry out PCT amplification with this ssDNA for template, amplified production carries out SELEX screening again until obtaining fit accordingly.The present invention adopts SELEX technology screening to go out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, the described fit detection that can be widely applied to Aeromonas hydrophila and analysis.
Description
Technical field
The present invention relates to infective pathogen bacterium Aeromonas hydrophila common in aquaculture, fit and screening technique and application particularly to Aeromonas hydrophila.
Background technology
Aeromonas hydrophila (Aeromonashydrophila) is extensive in distributed in nature, it is the constitutional pathogenic bacterium of multiple aquatic animal, multiple virulence factor can be produced, to aquatic animal, poultry and the mankind all have pathogenic, septicemia and mankind's diarrhoea of many animals can be caused, threat is brought to human health, also cause bigger economic loss to aquaculture (1. a kingfisher is beautiful simultaneously, Yu Zhouliang, Zhao Baohua, He Hongxuan. Advancement in Study on Aeromonas hydrophila [J]. China's Veterinary Journal, 2008,42(7): 46-50.).Therefore, polluting for the Aeromonas hydrophila as pollution of waterhead indicator bacteria, its inspecting force still needs to further reinforcement.The detection of current Aeromonas hydrophila is always up a stubborn problem, and traditional chemical pathology detection process is loaded down with trivial details, expends time in；Enzyme linked immunological, multiple PCR technique then high cost (2. Wang Li. several detection methods [J] of Fish Aeromonas Hydrophila. inland Aquatic product, 2006, (2): 22-23.).Therefore, exploitation is a kind of easy and simple to handle, with low cost, and Aeromonas hydrophila detection method quickly and easily becomes the technical barrier that those skilled in the art are in the urgent need to address.
SELEX (SystematicEvolutionofLigandsbyExponentialEnrichment) i.e. index concentration Fas lignand system evolution technology, it it is chemical combination technology (the 3. Meng Qing tinkling of pieces of jade of a kind of external synthesis screening oligonucleotide aptamers that nineteen ninety is created by Tuerk and the Gold of the U.S., old wound husband's .SELEX technology and application prospect [J] thereof. Tarim University's journal, 2008,20 (3): 44-48.4. Liao's generation are strange, Liu Wei, Wang Li .SELEX technology applied research progress [J]. Gansu medicine, 2009, (02): 96-97.).Due to fit, there is specificity height, storage capacity is big, generated time is short, and (5. Wang Cong is gorgeous, Sun Wei, Li Jianguo, it being in progress [J] Deng .SELEX technology applied research. biotechnology is circulated a notice of, 2006, : 232-236.) (S1) advantage such as, SELEX technology is widely used in control and prevention of disease now, drug screening, the technical field that clinical diagnosis etc. are different, along with constantly bringing forth new ideas and development of technology, create some new SELEX screening techniques gradually, such as the SELEX technology that leads, composition target molecule SELEX technology, research means (the 6. Meng Qing tinkling of pieces of jade of genomic SELEX innovation, old wound husband's .SELEX technology and application prospect [J] thereof. Tarim University's journal, 2008, 20 (3): 44-48.).
Summary of the invention
The first object of the present invention is in that to provide Aeromonas hydrophila fit.
The second object of the present invention is in that the screening technique providing described Aeromonas hydrophila fit.
The third object of the present invention is in that to provide described Aeromonas hydrophila the fit application stating in Aeromonas hydrophila in detection.
In the nucleotide sequence that described Aeromonas hydrophila is fit such as sequence table shown in the sequence in No. 1-22.
The screening technique that described Aeromonas hydrophila is fit is that index concentration Fas lignand system evolution technology (i.e. SELEX screening) is applied to the screening that Aeromonas hydrophila is fit, and the concrete steps of described SELEX screening include:
1) build and synthesize the fit ssDNA library of Aeromonas hydrophila to be screened, and design the corresponding primer of synthesis；
2) take appropriate described ssDNA library to combine with Aeromonas hydrophila；
3) separating the ssDNA that acquisition is combined with Aeromonas hydrophila, carry out PCT amplification with this ssDNA for template, amplified production carries out SELEX screening again until obtaining fit accordingly.
In step 1), described ssDNA library can be:: 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 '.
Described primer can be:
Primer I: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 '；
Primer II: 5 '-GATCCGGGCCTCATGTCGAA-3 '；
Primer III: 5 '-digoxin-GGGAGCTCAGAATAAACGCTCAA-3 '；
Primer IV: 5 '-biotin-GATCCGGGCCTCATGTCGAA-3 '.
In step 3), described SELEX screening carries out 12 altogether and takes turns.
The present invention adopts SELEX technology screening to go out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, the exploitation of the described fit Fast Detection Technique for Aeromonas hydrophila and the application in Aquatic product Disease management provide reference, can be widely applied to the detection of Aeromonas hydrophila and analysis.
Accompanying drawing explanation
Fig. 1 is PCR primer 3% agarose gel electrophoresis figure.In FIG, M is 50bpDNAmarker, and 1,3,5,7,9,11,12 represent the 1st, 3,5,7,9,11,12 PCR primer taken turns respectively.
Fig. 2 is the fit absorbance being combined with Aeromonas hydrophila.In fig. 2, abscissa is screening wheel number, and vertical coordinate is absorbance during A450nm.
Fig. 3-Fig. 5 is the aptamer secondary structure figure that the present invention screens.Structure minimum free energy in Fig. 3 for-7.60 kilocalories/rub, the structure minimum free energy in Fig. 4 is 1.83 kilocalories/rub, the structure minimum free energy in Fig. 5 for-3.11 kilocalories/rub.
Detailed description of the invention
One, the synthesis of ssDNA library and primer
Reference literature (7, Liu Fengwei, Lan little Peng. research that in-vitro screening Pseudomonas aeruginosa is fit and Preliminary Applications [D]. Foochow Medical University Of Fujian, 2007.) disclosed in method, for SELEX screening ssDNA pool and primer synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
Library used is: 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 '.
The primer is respectively as follows:
Primer I: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 '；
Primer II: 5 '-GATCCGGGCCTCATGTCGAA-3 '；
Primer III: 5 '-digoxin-GGGAGCTCAGAATAAACGCTCAA-3 '；
Primer IV: 5 '-biotin-GATCCGGGCCTCATGTCGAA-3 '.
It is 10 μm of ol that above-mentioned primer is diluted to concentration with TE buffer (pH8.0) conventional in molecular biology in post synthesis, and-20 DEG C save backup.
Two, prepared by experiment reagent and buffer
Dynabeads streptavidin magnetic bead M-280 test kit, 2 × TaqPCRMasterMix, 50bpDNALadderMarker, bovine serum albumin (BSA) are all purchased from Xiamen Lu Long Bioisystech Co., Ltd, PCR glue reclaims purification kit purchased from omega company, anti-digoxin alkali phosphatase is purchased from Roche company, and 4-NPP is Amresco Products.Buffer with reference to list of references (Liu Fengwei, Lan little Peng. research that in-vitro screening Pseudomonas aeruginosa is fit and Preliminary Applications [D]. Foochow Medical University Of Fujian, 2007.) preparation.
Three, strain: Aeromonas hydrophila AS1.1801 is purchased from Chinese industrial Microbiological Culture Collection administrative center.
Four, SELEX screening
Take a certain amount of ssDNA pool (first run screening consumption is 600pmol, and often wheel reduces consumption subsequently), add 600 μ L and select buffer dilution ssDNA, in 95 DEG C of degeneration 5min, cool down 10min.(quantity of bacterium is about 1.5 × 10 to add the Aeromonas hydrophila bacteria suspension of 30 μ L8Individual), mixing is put shaking table room temperature and is centrifuged 10min at 30min, 15000r/min, 4 DEG C.Abandon supernatant afterwards, add 600 μ L and select buffer resuspended, such repeated washing 3 times, wash away the ssDNA not being combined with Aeromonas hydrophila, combine the Aeromonas hydrophila precipitation 100 μ LddH of ssDNA2O is resuspended, 96 DEG C of heating 5min, and taking supernatant after centrifugal is template, pcr amplification is carried out with primer I, IV, obtain the double-stranded DNA (dsDNA) of labelling biotin, utilize M-280 magnetic bead to separate ssDNA by the interaction between biotin-streptavidin, as the secondary storehouse of next round screening.According to said method, secondary storehouse is carried out SELEX screening again, successively carry out 12 and take turns SELEX screening.
Five, each wheel is fit with the mensuration of Aeromonas hydrophila combination rate and fit sequence and analysis
Taking turns the product (the eluting supernatant that namely this is taken turns) of SELEX screening by the 1st, 3,5,7,9,11,12, carry out pcr amplification with primer III and primer IV, each wheel all expands 320 μ L.PCR amplification system is: 2 × TaqPCRMasterMix10ul, forward primer (10um), downstream primer (10um) each 0.4ul, template 1ul, supplies 20ul with deionized water.PCR reaction condition is: 95 DEG C of denaturation 3min；94 DEG C of degeneration 30s, 58 DEG C-70 DEG C annealing 30s, 72 DEG C extend 20s, 24 circulations；72 DEG C extend 3min.
Pcr amplification product glue is reclaimed purification kit be purified, purified product utilizes the sepharose electrophoresis of 3% to detect, can be seen that electrophoretic band is more and more finer and close, diffusing phenomenon is fewer and feweri simultaneously, and band is along with the increase of screening number of times is more and more neat and brightness increases to some extent.Illustrate that SPECIFIC APTAMER obtains enrichment, and it is high that its homology is likely to comparison along with the increase of screening number of times
The dsDNA of purification is unwind into ssDNA by the PCR primer Streptavidin MagneSphere after purification, and this ssDNA, namely with digoxigenin labeled, measures its content.Press ssDNA again: Aeromonas hydrophila=300pmol: 1.5 × 108Ratio, both are selected in buffer in conjunction with 30min at 500 μ L, the alkaline phosphatase enzyme reaction 10min of the anti digoxin antibody labelling of 100 μ L1: 15000 dilutions is added after centrifugal, it is centrifuged and abandons supernatant and select buffer suspension Aeromonas hydrophilas with 500 μ L, repeated washing 3 times, wash away the alkali phosphatase of the anti digoxin antibody labelling that ssDNA-digoxin is not combined on Aeromonas hydrophila, it is subsequently adding 100 μ L para-nitro-pheneye phosphate solution colour developings, add 100 μ L2mol/LNaOH after colour developing is good and terminate reaction, absorbance is measured in 405nm by microplate reader, experimental result is referring to Fig. 1.This affinity measurement result shows, along with the increase of screening wheel number, the fit affinity with bacterium solution is gradually increased, and reaches maximum when the 9th takes turns, and affinity change afterwards is little, tend towards stability, illustrate fit reached saturated.
With primer I and primer II, the 12nd PCR primer taken turns is expanded in a large number again, send after purification after Ying Jun Bioisystech Co., Ltd clone, clone, take 24 clones order-checkings at random, it is thus achieved that 22 satisfactory fit sequences.It is divided into A group, two groups of B group according to the number of random sequence base.A group's (see table 1) includes 13 fit sequences, and consistent with expection length, B group's (see table 2) comprises 9 sequences, is all shorter than expection length.Sequencing result is in Table 1.Analyze 22 fit homologous sequences with Macaw2.05 software kit, it is thus achieved that 4 conserved sequence: GTTTTX(see A1-1, A1-8, A1-13, A1-17, A1-20, A1-21, A1-26, No. A1-30 fit)；GTGGGT(sees A1-1, A1-7, A1-12, A1-15, A1-22, A1-29)；GTTTX(sees A1-1, A1-5, A1-7, A1-10, A1-13, A1-14, A1-15, A1-18, A1-21, A1-22, A1-29)；XTTTT(sees A1-14, A1-26, A1-27).Have fit in same conserved sequence occur repeatedly, in A1-18, three times GTTTG occurs；Have fit in multiple conserved sequence then occurs, but do not have to find to be present in all fit in conserved sequence.
| Fit | Numbering in sequence table | Nucleotide sequence |
| A1-3 | 1 | TGGTGGTCTGCTAGCGGTTTATGTTTTTGTCTGGT |
| A1-4 | 2 | AGGATGGATTAGTGGGATTGGTGGTTAGGGGGGG |
| A1-5 | 3 | GACCTCGTCTTCGGTGTGATCGTTTCTTGTTGTTG |
| A1-7 | 4 | GGTGTGTTGGTGGGTGTGTGTTTGGGTTCTTGGGT |
| A1-14 | 5 | TGCGGCTGTGTGGGTGGTTTGGGTTTGTTGCTTTT |
| A1-15 | 6 | GCGGTGGGTGGTAGGTTTGTGTTTGTTAATGGGTG |
| A1-17 | 7 | GTTGTCTCTGGTGTTTTGGATTGATGGCCTTGCTG |
| A1-18 | 8 | GGTGTCTGGTTTGTTGTGGTTGTTTGTGGTTTGTG |
| A1-20 | 9 | GCGGTTATGTGAAATTATGGCATGGTTTTGTGGTG |
| A1-26 | 10 | GGTCCATTGGCTGTGTTTTCTAGGTGTTATGTTTT |
| A1-27 | 11 | GGTCGTTAGACGGGGCTAGTAATATATTTCCTTTT |
| A1-29 | 12 | CTGTCGTGTGTTTGGGTGTGGGTCGTGTGGTTGGT |
| A1-31 | 13 | GTATAGATGTACTGCTGTGCATATCCTATGCAACT |
Table 1A group Aeromonas hydrophila is fit
| Fit | Numbering in sequence table | Nucleotide sequence |
| A1-1 | 14 | GGTGGTGGGTGTTTTGTCGGTTTGGTGTTTGGT |
| A1-8 | 15 | TGGCGGTGTTTTTGGGTGGGGTTATAGG |
| A1-10 | 16 | CTGGCTGTTCGTTTAGAATGAACCGGTCATG |
| A1-12 | 17 | GTTGTGGTGGGGTCGGAGGTTGTCTGGT |
| A1-13 | 18 | TGGTGTTTGGTTGTTTTGTTTGG |
| A1-21 | 19 | TTTGTGGCGGGGTTTGCTTGGTTTTGTGGTGG |
| A1-22 | 20 | GGGGTGGGTGGGTGTGTGTTTGGTTGGTTTG |
| A1-30 | 21 | GGGTTGGTTTGGGGGGGGCTGTTTTG |
| A1-28 | 22 | GGGTGGGTTGGTTGGTGGTTGTTTTTGTG |
Table 2B group Aeromonas hydrophila is fit
With DNAMAN software, 22 measured sequences are carried out secondary structure analysis, three classes can be classified as according to structure:
The first kind: the fixed sequence program district base of 5 ' ends and 3 ' the 6th bases held play formation loop-stem structure, and middle random district forms loop-stem structure, 5 fixing bases one little bag structures (Fig. 3) of formation of 3 ' ends.The fit of this structure has A1-3, A1-5, A1-7, A1-13, A1-14, A1-20, A1-22 totally seven；
Equations of The Second Kind: the 3rd to 21 bases of 5 ' ends form loop-stem structure, 3 ' end fixed sequence program district bases form stem ring and protruding with random district, centre base, then being formed a bag structure (Fig. 4) by 5 ' ends, 3 ' end fixed sequence program district bases and random district, centre again, the fit of this structure has A1-1, A1-4, A1-12, A1-15, A1-17, A1-18, A1-21, A1-27, A1-28, A1-29, A1-30, A1-31 totally ten two；
3rd class: 5 ' ends, 3 ' end fixed sequence program district number of base form loop-stem structure with random district respectively, are then formed a big bag structure (Fig. 5) again by 5 ' ends, 3 ' end fixed sequence program district bases and random district, centre.The fit of this structure has A1-8, A1-10, A1-26 tri-.
The ssDNA library total length 78bp of applicant's synthetic, middle 35bp is random nucleotide, and owing to there are tetra-kinds of possibilities of A, G, C, T in each site, in the middle of like this, 35 sequences just have 435Individual possibility is combined, and namely its storage capacity has reached 1016More than, although actual experiment is likely to only to 1014Left and right, but this also meet screening purpose oligonucleotide needs (8, Li Weibin, Lan little Peng, Yang Xiangyue, wait the utilization [J] in screening Ciclosporin A is fit of the .SELEX technology. Foochow hospital general journal, 2007, (03): 171-173).In the process that front two-wheeled screens, the library amount that applicant adds is relatively more, such purpose be obtain as much as possible much more relatively specific binding with Aeromonas hydrophila fit.But along with the increase of screening wheel number, the amount in secondary library will reduce accordingly, this is because the concentration in library is increasing.In order to increase fit specificity, applicant adds washing steps accordingly, and the time that library is combined with bacterium solution simultaneously also reduces 20min finally from former 30min taken turns.Optimizing of PCR condition is also particularly significant to fit screening, each takes turns screening, and applicant will first do a grads PCR, does pcr amplification under the premise obtaining the suitableeest annealing temperature again, so effectively avoids the problems such as non-specific amplification.
What applicant tested is that Streptavidin MagneSphere is enriched with secondary library, it is simple to operate, need not be centrifuged, as long as the effect separated can be reached under the influence of a magnetic field, the secondary library that it obtains simultaneously is more stable, purity is higher, problem non-specific amplification in asymmetric PCR not easily occur.By 12 taking turns screening, cloning and sequencing obtains 22 fit in, have 13 fit always consistent with expection length.
Utilize DNAMAN software to its secondary structure analysis, can be seen that from result, the secondary structure of these sequences is all made up of stem ring and pocket (spoon shape) structure, this describes stem ring and bag structure is probably the fit architecture basics being combined with Aeromonas hydrophila, stem is likely to play a part rock-steady structure, and ring is probably its binding site.Containing the pocket of spoon shape in some secondary structure, these pockets are likely to and play the effect that same ring is the same, it is possible to be the binding site being combined with receptor.In these stem structures, it is main that its base is mainly G-C, and owing to the structure of G-C can more than A-T, this point also illustrates that stem is likely to play Stabilization.
The present invention tentatively establishes the method that SELEX method screening Aeromonas hydrophila is fit, obtain simultaneously and there is the fit of specific Aeromonas hydrophila, and the secondary structure of fit group has tentatively been studied, obtain some structures composition of its secondary structure, this has laid certain basis for the molecular structure studying Aeromonas hydrophila later, is also that the detection of Aeromonas hydrophila provides a kind of new method simultaneously.
Claims (2)
1. Aeromonas hydrophila is fit, it is characterised in that its sequence as
Shown in GGGAGCTCAGAATAAACGCTCAAAGGATGGATTAGTGGGATTGGTGGTTAGGGGGG GTTCGACATGAGGCCCGGATC.
2. the fit application in detection Aeromonas hydrophila of Aeromonas hydrophila as claimed in claim 1, described application is the application of non-diseases diagnostic purpose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310363871.5A CN103468686B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila is fit and screening technique and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310363871.5A CN103468686B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila is fit and screening technique and application |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012100017770A Division CN102643821B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila aptamer, and screening method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103468686A CN103468686A (en) | 2013-12-25 |
| CN103468686B true CN103468686B (en) | 2016-07-06 |
Family
ID=49793727
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310363871.5A Expired - Fee Related CN103468686B (en) | 2012-01-05 | 2012-01-05 | Aeromonas hydrophila is fit and screening technique and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103468686B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140512A (en) * | 2010-12-29 | 2011-08-03 | 浙江省淡水水产研究所 | LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila |
-
2012
- 2012-01-05 CN CN201310363871.5A patent/CN103468686B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102140512A (en) * | 2010-12-29 | 2011-08-03 | 浙江省淡水水产研究所 | LAMP (Loop-mediated Isothermal Amplification) detection kit and method of pathogenic aeromonas hydrophila |
Non-Patent Citations (3)
| Title |
|---|
| SELEX 筛选嗜水气单胞菌(Aeromonas hydrophila)适体方法的建立;李元跃 等;《海洋与湖沼》;20120331;第43卷(第2期);318-322 * |
| SELEX技术在致病菌检测中应用进展;余晓峰 等;《家禽科学》;20110731;43-45 * |
| 适配体筛选方法研究进展;王巍 贾凌云;《分析化学》;20090331;第37卷(第3期);454-460 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103468686A (en) | 2013-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN104131105B (en) | A kind of screening technique of specific binding alpha-fetoprotein aptamer | |
| CN103571822B (en) | A kind of multipurpose DNA fragmentation enriching method analyzed for new-generation sequencing | |
| CN102703455B (en) | Human cardiac troponin I aptamer, screening method and application | |
| CN103468684B (en) | Aeromonas hydrophila is fit and screening method and application | |
| CN103468687B (en) | Aeromonas hydrophila is fit and screening technique and application | |
| CN103468683B (en) | Aeromonas hydrophila is fit and screening technique and application | |
| CN103468690B (en) | Aeromonas hydrophila is fit and screening technique and application | |
| CN103468686B (en) | Aeromonas hydrophila is fit and screening technique and application | |
| CN103468689B (en) | Aeromonas hydrophila is fit and screening technique and application | |
| CN103468703B (en) | Aeromonas hydrophila is fit and screening technique and application | |
| CN112029771B (en) | Aptamer specifically binding to meperidine and application thereof | |
| CN103468693B (en) | Aeromonas hydrophila is fit and screening technique and application | |
| CN103468700B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468698B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468697B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468694B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468696B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468702B (en) | Aeromonas hydrophila aptamer as well as screening method and application thereof | |
| CN103468695B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468701B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468699B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468692B (en) | Aeromonas hydrophila is fit and its screening technique and application | |
| CN103468691A (en) | Aeromonas hydrophila aptamer, and screening method and application thereof | |
| CN103725671A (en) | Enrichment method of multi-target specific deoxyribonucleic acid aptamers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160706 Termination date: 20200105 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |