CN103468698B - Aeromonas hydrophila is fit and its screening technique and application - Google Patents

Aeromonas hydrophila is fit and its screening technique and application Download PDF

Info

Publication number
CN103468698B
CN103468698B CN201310365123.0A CN201310365123A CN103468698B CN 103468698 B CN103468698 B CN 103468698B CN 201310365123 A CN201310365123 A CN 201310365123A CN 103468698 B CN103468698 B CN 103468698B
Authority
CN
China
Prior art keywords
fit
aeromonas hydrophila
ssdna
hydrophila
selex
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310365123.0A
Other languages
Chinese (zh)
Other versions
CN103468698A (en
Inventor
李元跃
王雷
段博文
陈融斌
黎中宝
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Jimei University
Original Assignee
Jimei University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Jimei University filed Critical Jimei University
Priority to CN201310365123.0A priority Critical patent/CN103468698B/en
Priority claimed from CN2012100017770A external-priority patent/CN102643821B/en
Publication of CN103468698A publication Critical patent/CN103468698A/en
Application granted granted Critical
Publication of CN103468698B publication Critical patent/CN103468698B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to Aeromonas hydrophila is fit and its screening technique and application.Offer Aeromonas hydrophila is fit and the fit screening technique of the Aeromonas hydrophila and application.The specific steps of the screening technique that the Aeromonas hydrophila is fit include:The fit ssDNA libraries of Aeromonas hydrophila to be screened are built and synthesized, and designs the corresponding primer of synthesis;The appropriate ssDNA libraries are taken to be combined with Aeromonas hydrophila;The ssDNA for obtaining and being combined with Aeromonas hydrophila is separated, PCT amplifications are carried out by template of the ssDNA, amplified production carries out SELEX screenings until obtaining corresponding fit again.The present invention goes out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, the fit detection that can be widely applied to Aeromonas hydrophila and analysis using SELEX technology screenings.

Description

Aeromonas hydrophila is fit and its screening technique and application
Technical field
The present invention relates to infective pathogen bacterium --- Aeromonas hydrophila common in aquaculture, more particularly to thermophilic aqueous vapor list Born of the same parents bacterium is fit and its screening technique and application.
Background technology
Aeromonas hydrophila(Aeromonas hydrophila)In distributed in nature extensively, it is the original of various aquatic animals Hair property pathogenic bacteria, can produce various virulence factors, and to aquatic livestock, livestock and poultry and the mankind have pathogenic, can cause many animals Septicemia and the mankind diarrhoea, to mankind's health care belt come threat, while also causing larger economic loss to aquaculture(1. Beautiful, the Yu Zhouliang of kingfisher, Zhao Baohua, He Hong pavilion Advancement in Study on Aeromonas hydrophila [J] China Veterinary Journal, 2008,42(7):46- 50.).Therefore, polluted for the Aeromonas hydrophila as pollution of waterhead indicator bacteria, its inspecting force still needs to further reinforcement. The detection of current Aeromonas hydrophila is always a stubborn problem, and traditional chemical pathological examination process is cumbersome, expends the time; Enzyme linked immunological, multiple PCR technique then high cost(2. several detection methods [J] inlands of Wang Li Fish Aeromonas Hydrophilas Aquatic products, 2006,(2):22-23.).Therefore, develop a kind of easy to operate, with low cost, quickly and easily Aeromonas hydrophila inspection Survey method, as those skilled in the art's technical barrier in the urgent need to address.
SELEX (Systematic Evolution of Ligands by Exponential Enrichment) is to refer to Number enrichment Fas lignand system evolution technology, is nineteen ninety to synthesize the few core of screening in vitro by one kind that the Tuerk and Gold in the U.S. are created The chemical combination technology that thuja acid is fit(3. the Meng Qing tinkling of pieces of jade, old wound husband .SELEX technologies and its application prospect [J] Tarim University are learned Report, 2008,20 (3):Liao's generation of 44-48. 4. is strange, Liu Wei, Wang Li .SELEX technologies application study progress [J] Gansu medicine, 2009, (02):96-97.).Due to fit with specific high, storage capacity is big, generated time is short(5. Wang Cong is gorgeous, Sun Wei, Li Jian State, waits .SELEX technologies application study progress [J] biotechnologys to circulate a notice of, 2006, (S1):232-236.)The advantages of, SELEX Technology is widely used in the different technical field such as control and prevention of disease, drug screening, clinical diagnosis now, with the continuous wound of technology Newly with development, gradually generate some new SELEX screening techniques, be such as oriented to SELEX technologies, compound target molecule SELEX technologies, The research meanses of genomic SELEX innovation(6. the Meng Qing tinkling of pieces of jade, old wound husband .SELEX technologies and its application prospect [J] Tarim Basins College journal, 2008,20 (3):44-48.).
The content of the invention
The first object of the present invention is that offer Aeromonas hydrophila is fit.
The second object of the present invention is to provide the Aeromonas hydrophila fit screening technique.
The third object of the present invention is the offer Aeromonas hydrophila fit in Aeromonas hydrophila is stated in detection Using.
The nucleotide sequence that the Aeromonas hydrophila is fit is as shown in the sequence in sequence table No. 1-22.
The screening technique that the Aeromonas hydrophila is fit is by index concentration Fas lignand system evolution technology(That is SELEX is sieved Choosing)The fit screening of Aeromonas hydrophila is applied to, the specific steps of the SELEX screenings include:
1)The fit ssDNA libraries of Aeromonas hydrophila to be screened are built and synthesized, and designs the corresponding primer of synthesis;
2)The appropriate ssDNA libraries are taken to be combined with Aeromonas hydrophila;
3)The ssDNA for obtaining and being combined with Aeromonas hydrophila is separated, PCT amplifications are carried out by template of the ssDNA, amplification is produced Thing carries out SELEX screenings until obtaining corresponding fit again.
In step 1)In, the ssDNA libraries can be::5′-GGG AGC TCA GAA TAA ACG CTC AA-N35- TT CGA CAT GAG GCC CGG ATC-3′。
The primer can be:
Primer I:5′-GGG AGC TCA GAA TAA ACG CTC AA-3′;
Primer II:5′-GAT CCG GGC CTC ATG TCG AA-3′;
Primer III:5 '-digoxin-GGG AGC TCA GAA TAA ACG CTC AA-3 ';
Primer IV:5 '-biotin-GAT CCG GGC CTC ATG TCG AA-3 '.
In step 3)In, the SELEX screenings carry out 12 wheels altogether.
The present invention goes out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, institute using SELEX technology screenings State the fit exploitation of Fast Detection Technique and the application in terms of aquatic products Disease management for Aeromonas hydrophila and reference be provided, Can be widely applied to the detection and analysis of Aeromonas hydrophila.
Brief description of the drawings
Fig. 1 is the agarose gel electrophoresis figure of PCR primer 3%.In Fig. 1, M is 50bp DNA marker, 1,3,5,7,9, 11st, 12 the PCR primer of the 1st, 3,5,7,9,11,12 wheels is represented respectively.
Fig. 2 is the fit absorbance combined with Aeromonas hydrophila.In fig. 2, abscissa is number of screening round, and ordinate is Absorbance during A450nm.
Fig. 3-Fig. 5 is the aptamer secondary structure figure that the present invention is screened.Structure minimum free energy in Fig. 3 for- 7.60 kilocalories/rub, structure minimum free energy in Fig. 4 for 1.83 kilocalories/rub, the structure minimum free energy in Fig. 5 is -3.11 thousand Block/rub.
Specific embodiment
First, the synthesis of ssDNA libraries and primer
Reference literature(7th, Liu Fengwei, research and Preliminary Applications [D] that blue small roc in-vitro screening pseudomonas aeruginosas are fit Foochow Medical University Of Fujian, 2007.)Disclosed in method, for SELEX screening ssDNA pool and primer by Shanghai Sheng Gong biotechnologies Services Co., Ltd synthesizes.
Library used is:5′-GGG AGC TCA GAA TAA ACG CTC AA-N35-TT CGA CAT GAG GCC CGG ATC-3′。
The primer is respectively:
Primer I:5′-GGG AGC TCA GAA TAA ACG CTC AA-3′;
Primer II:5′-GAT CCG GGC CTC ATG TCG AA-3′;
Primer III:5 '-digoxin-GGG AGC TCA GAA TAA ACG CTC AA-3 ';
Primer IV:5 '-biotin-GAT CCG GGC CTC ATG TCG AA-3 '.
Above-mentioned primer is in post synthesis with the TE buffer solutions commonly used in molecular biology(pH8.0)Concentration is diluted to for 10 μ Mol, -20 DEG C save backup.
2nd, prepared by experiment reagent and buffer solution
Dynabeads streptavidin magnetic bead M-280 kits, 2 × Taq PCR MasterMix, 50bp DNA Ladder Marker, bovine serum albumin(BSA)(BSA)It is purchased from Xiamen Lu Long Bioisystech Co., Ltd, the purifying examination of PCR glue reclaims Agent box is purchased from omega companies, and anti-digoxin alkaline phosphatase is purchased from Roche companies, and 4-NPP is Amresco public Department's product.Buffer solution is with reference to bibliography (Liu Fengwei, research that blue small roc in-vitro screening pseudomonas aeruginosas are fit and preliminary Using [D] Foochow Medical University Of Fujian, 2007.) prepare.
3rd, strain:Aeromonas hydrophila AS1.1801 is purchased from Chinese industrial Microbiological Culture Collection administrative center.
4th, SELEX screenings
Take a certain amount of ssDNA pool(First run screening consumption is 600pmol, and then often wheel reduces consumption), add 600 μ L selection buffer solution dilution ssDNA, 5min is denatured in 95 DEG C, cools down 10min.Add the Aeromonas hydrophila bacteria suspension of 30 μ L (The quantity of bacterium is about 1.5 × 108It is individual), mixing puts and 10min is centrifuged at 30min, 15000r/min, 4 DEG C of shaking table room temperature combination.It After abandon supernatant, add that 600 μ L selection buffer solutions are resuspended, such repeated washing 3 times washes away what is do not combined with Aeromonas hydrophila SsDNA, combines the 100 μ L ddH of Aeromonas hydrophila precipitation of ssDNA2O is resuspended, 96 DEG C of heating 5min, is taken after centrifugation Clearly it is template, entering performing PCR with primer I, IV expands, and obtains the double-stranded DNA of mark biotin(dsDNA), it is logical using M-280 magnetic beads The interaction crossed between biotin-streptavidin separates ssDNA, used as the secondary storehouse that next round is screened.According to above-mentioned side Method, SELEX screenings are carried out to secondary storehouse again, successively carry out 12 wheel SELEX screenings.
5th, fit measure and fit sequence and analysis with Aeromonas hydrophila Percentage bound is respectively taken turns
By the product of the 1st, 3,5,7,9,11,12 wheel SELEX screenings(That is the wash-out supernatant of the wheel), with primer III and primer IV enters performing PCR amplification, and each wheel expands 320 μ L.PCR amplification system is:2 × Taq PCR MasterMix 10ul, upstream is drawn Thing (10um), anti-sense primer (10um) each 0.4ul, template 1ul, 20ul is supplied with deionized water.PCR reaction conditions are:95 DEG C predegeneration 3min;94 DEG C of denaturation 30s, 58 DEG C of -70 DEG C of annealing 30s, 72 DEG C of extension 20s, 24 circulations;72 DEG C of extension 3min.
Pcr amplification product is purified with glue reclaim purification kit, purified product is examined using 3% agarose electrophoresis Survey, it can be seen that electrophoretic band is more and more finer and close, while diffusing phenomenon is fewer and feweri, band is more next with the increase of screening number of times More neat and brightness increased.Illustrate that, with the increase of screening number of times, SPECIFIC APTAMER is enriched with, its homology may Compare high
The dsDNA of purifying is unwind into ssDNA by PCR primer Streptavidin MagneSphere after purification, and this ssDNA is to carry Digoxigenin labeled, determines its content.SsDNA: Aeromonas hydrophila=300pmol: 1.5 × 10 are pressed again8Ratio, will both 30min is combined in 500 μ L selection buffer solutions, the alkali that the anti digoxin antibody for adding 100 μ L 1: 15000 to dilute after centrifugation is marked Acid phosphatase react 10min, centrifugation abandon supernatant and with 500 μ L selection buffer solution suspension Aeromonas hydrophila, repeated washing 3 times, The alkaline phosphatase of the anti digoxin antibody mark not combined with ssDNA- digoxin on Aeromonas hydrophila is washed away, is subsequently adding 100 μ L para-nitro-pheneye phosphates solution are developed the color, and 100 μ L 2mol/L NaOH terminating reactions are added after colour developing is good, with ELIASA in 405 nm mensuration absorbance values, experimental result is referring to Fig. 1.The affinity measurement result shows, with the increase of number of screening round, fits Body gradually increases with the affinity of bacterium solution, the 9th take turns when reach maximum, afterwards affinity change less, tend towards stability, explanation It is fit to have reached saturation.
The PCR primer of the 12nd wheel is largely expanded with primer I and primer II again, is sent after purification limited in English fine horse biotechnology It is random after company clone, clone to take 24 clone sequencings, obtain 22 satisfactory fit sequences.According to random sequence The number of base is divided into A crowds, B crowds of two groups.A groups(It is shown in Table 1)It is consistent with expected length including 13 fit sequences, B groups(See Table 2)Comprising 9 sequences, expected length is shorter than.Sequencing result is shown in Table 1.With the software kits of Macaw 2.05 analyze 22 it is fit Homologous sequence, obtains 4 conserved sequences:GTTTTX(See A1-1, A1-8, A1-13, A1-17, A1-20, A1-21, A1-26, No. A1-30 fit);GTGGGT(See A1-1, A1-7, A1-12, A1-15, A1-22, A1-29);GTTTX(See A1-1, A1- 5、A1-7、A1-10、A1-13、A1-14、A1-15、A1-18、A1-21、A1-22、A1-29);XTTTT(See A1-14, A1- 26、A1-27).Have it is fit in same conserved sequence occur multiple, there is GTTTG three times in such as A1-18;Have it is fit in then There are multiple conserved sequences, but without discovery be present in it is all it is fit in conserved sequence.
It is fit Numbering in sequence table Nucleotide sequence
A1-3 1 TGGTGGTCTGCTAGCGGTTTATGTTTTTGTCTGGT
A1-4 2 AGGATGGATTAGTGGGATTGGTGGTTAGGGGGGG
A1-5 3 GACCTCGTCTTCGGTGTGATCGTTTCTTGTTGTTG
A1-7 4 GGTGTGTTGGTGGGTGTGTGTTTGGGTTCTTGGGT
A1-14 5 TGCGGCTGTGTGGGTGGTTTGGGTTTGTTGCTTTT
A1-15 6 GCGGTGGGTGGTAGGTTTGTGTTTGTTAATGGGTG
A1-17 7 GTTGTCTCTGGTGTTTTGGATTGATGGCCTTGCTG
A1-18 8 GGTGTCTGGTTTGTTGTGGTTGTTTGTGGTTTGTG
A1-20 9 GCGGTTATGTGAAATTATGGCATGGTTTTGTGGTG
A1-26 10 GGTCCATTGGCTGTGTTTTCTAGGTGTTATGTTTT
A1-27 11 GGTCGTTAGACGGGGCTAGTAATATATTTCCTTTT
A1-29 12 CTGTCGTGTGTTTGGGTGTGGGTCGTGTGGTTGGT
A1-31 13 GTATAGATGTACTGCTGTGCATATCCTATGCAACT
The A groups of Aeromonas hydrophilas of table 1 are fit
It is fit Numbering in sequence table Nucleotide sequence
A1-1 14 GGTGGTGGGTGTTTTGTCGGTTTGGTGTTTGGT
A1-8 15 TGGCGGTGTTTTTGGGTGGGGTTATAGG
A1-10 16 CTGGCTGTTCGTTTAGAATGAACCGGTCATG
A1-12 17 GTTGTGGTGGGGTCGGAGGTTGTCTGGT
A1-13 18 TGGTGTTTGGTTGTTTTGTTTGG
A1-21 19 TTTGTGGCGGGGTTTGCTTGGTTTTGTGGTGG
A1-22 20 GGGGTGGGTGGGTGTGTGTTTGGTTGGTTTG
A1-30 21 GGGTTGGTTTGGGGGGGGCTGTTTTG
A1-28 22 GGGTGGGTTGGTTGGTGGTTGTTTTTGTG
The B groups of Aeromonas hydrophilas of table 2 are fit
Secondary structure analysis are carried out to 22 measured sequences with DNAMAN softwares, three can be classified as according to structure Class:
The first kind:The fixed sequence program area base at 5 ' ends rises with the 6th base at 3 ' ends and forms loop-stem structure, middle random area Loop-stem structure is formed, 5 fixed bases at 3 ' ends form a small bag structure(Fig. 3).This structure it is fit have A1-3, A1-5, A1-7, A1-13, A1-14, A1-20, A1-22 totally seven;
Equations of The Second Kind:3rd to 21 bases at 5 ' ends form loop-stem structure, and 3 ' end fixed sequence program area's bases and centre are random Area's base forms stem ring and projection, then forms a pocket by 5 ' ends, 3 ' end fixed sequence program area's bases and middle random area again Structure(Fig. 4), the fit of this structure have A1-1, A1-4, A1-12, A1-15, A1-17, A1-18, A1-21, A1-27, A1- 28th, A1-29, A1-30, A1-31 totally ten two;
3rd class:5 ' ends, 3 ' end fixed sequence program area number of base form loop-stem structure with random area respectively, then by 5 ' End, 3 ' end fixed sequence program area's bases and middle random area re-form a big bag structure(Fig. 5).The fit of this structure has A1-8, A1-10, A1-26 tri-.
The artificial synthesized ssDNA libraries total length 78bp of applicant, middle 35bp is random nucleotide, because each site has Tetra- kinds of possibility of A, G, C, T, 35 sequences just have 4 in the middle of such words35Individual to combine, i.e., its storage capacity has reached 1016It It is many, although may only to 10 in actual experiment14 Left and right, but this also meet screening purpose oligonucleotides the need for(8th, Li Wei Shore, Lan little Peng, Yang Xiangyue wait utilization [J] Foochow hospital general journal of the .SELEX technologies in screening Ciclosporin A is fit, 2007,(03):171-173).During preceding two-wheeled is screened, the library amount of applicant's addition is relatively more, and such purpose is Obtain more fit with what Aeromonas hydrophila specifically bound as far as possible.But it is secondary with the increase of number of screening round The amount in library will be reduced accordingly, because the concentration in library is increasing.In order to increase fit specificity, Applicant accordingly increased washing steps, while after the time that library is combined with bacterium solution is also reduced to from the 30min of former wheels The 20min for coming.The optimization of PCR conditions is also particularly significant to fit screening, and each round screening, applicant will first make a ladder Degree PCR, does PCR amplifications again on the premise of most suitable annealing temperature is obtained, and so effectively avoids non-specific amplification etc. and asks Topic.
Applicant's experiment with to be Streptavidin MagneSphere be enriched with secondary library, it is simple to operate, need not be centrifuged, only The effect of separation is can reach under the influence of a magnetic field, while the secondary library that it is obtained is more stable, purity is higher, is difficult There is the problem of the non-specific amplification in asymmetric PCR.Screened by 12 wheels, during obtain 22 of cloning and sequencing are fit, had 13 fit consistent always with expected length.
Using DNAMAN softwares to its secondary structure analysis, as can be seen from the results, the secondary structure of these sequences is all It is by stem ring and pocket(Spoon shape)Structure composition, this illustrates that stem ring and bag structure are probably fit and Aeromonas hydrophila knot The architecture basics of conjunction, stem may play a part of rock-steady structure, and ring is probably its binding site.Contain spoon in some secondary structures The pocket of shape, these pockets are likely to play the same effect of same ring, it is possible to be the binding site combined with acceptor.At these In stem structure, its base is mainly based on G-C, and because the structure of G-C can be more than A-T, this point also illustrates that stem may be played surely It is set for using.
The preliminary SELEX methods that establish of the invention screen the fit method of Aeromonas hydrophila, while obtaining with special The Aeromonas hydrophila of property it is fit, and secondary structure to fit group tentatively studied, and obtains the one of its secondary structure A little structure compositions, this has laid certain basis to study the molecular structure of Aeromonas hydrophila later, while being also thermophilic aqueous vapor The detection of monad provides a kind of new method.

Claims (2)

1. Aeromonas hydrophila is fit, it is characterised in that its sequence is such as
GGGAGCTCAGAATAAACGCTCAAGTTGTGGTGGGGTCGGAGGTTGTCTGGTTTCGA CATGAGGCCCGGATC institutes Show.
2. the fit application in Aeromonas hydrophila is detected of Aeromonas hydrophila as claimed in claim 1, the application is non- The application of medical diagnosis on disease purpose.
CN201310365123.0A 2012-01-05 2012-01-05 Aeromonas hydrophila is fit and its screening technique and application Expired - Fee Related CN103468698B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310365123.0A CN103468698B (en) 2012-01-05 2012-01-05 Aeromonas hydrophila is fit and its screening technique and application

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN2012100017770A CN102643821B (en) 2012-01-05 2012-01-05 Aeromonas hydrophila aptamer, and screening method and application thereof
CN201310365123.0A CN103468698B (en) 2012-01-05 2012-01-05 Aeromonas hydrophila is fit and its screening technique and application

Related Parent Applications (1)

Application Number Title Priority Date Filing Date
CN2012100017770A Division CN102643821B (en) 2012-01-05 2012-01-05 Aeromonas hydrophila aptamer, and screening method and application thereof

Publications (2)

Publication Number Publication Date
CN103468698A CN103468698A (en) 2013-12-25
CN103468698B true CN103468698B (en) 2017-07-04

Family

ID=49793739

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310365123.0A Expired - Fee Related CN103468698B (en) 2012-01-05 2012-01-05 Aeromonas hydrophila is fit and its screening technique and application

Country Status (1)

Country Link
CN (1) CN103468698B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105779370B (en) * 2016-01-07 2019-06-25 海南大学 It is a kind of for producing the specific peptide aptamer of fish septicaemia cause of disease Aeromonas veronii attenuated live vaccine

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101418335A (en) * 2007-10-24 2009-04-29 福建出入境检验检疫局检验检疫技术中心 Reagent for detection of pathogenic hydrophila gingivalis and detection method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
体外筛选铜绿假单胞菌适体的研究及初步应用;刘丰伟;《中国优秀硕士论文全文数据库 医药卫生科技辑》;20070115(第1期);1.2.1节-1.2.5节 *

Also Published As

Publication number Publication date
CN103468698A (en) 2013-12-25

Similar Documents

Publication Publication Date Title
CN106701737A (en) High-efficiency DNA purified magnetic bead reagent with fragment selective purification capacity
CN103468698B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468700B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468696B (en) Aeromonas hydrophila is fit and its screening technique and application
CN109750092A (en) A kind of method and kit of targeting enrichment high GC content target dna
CN103468701B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468699B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468695B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468692B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468694B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468697B (en) Aeromonas hydrophila is fit and its screening technique and application
CN103468685B (en) Aeromonas hydrophila is fit and screening method and application
CN103468702B (en) Aeromonas hydrophila aptamer as well as screening method and application thereof
CN103981258B (en) A kind of tumor susceptibility gene SNP site detection method and kit
CN103468693B (en) Aeromonas hydrophila is fit and screening technique and application
CN104818533B (en) The preparation method of ssDNA secondary libraries
CN103468703B (en) Aeromonas hydrophila is fit and screening technique and application
CN103468683B (en) Aeromonas hydrophila is fit and screening technique and application
CN103468686B (en) Aeromonas hydrophila is fit and screening technique and application
CN103468689B (en) Aeromonas hydrophila is fit and screening technique and application
CN103468687B (en) Aeromonas hydrophila is fit and screening technique and application
CN103468690B (en) Aeromonas hydrophila is fit and screening technique and application
CN103468691A (en) Aeromonas hydrophila aptamer, and screening method and application thereof
CN116814638A (en) Broad-spectrum aptamer for tetracycline antibiotics
CN109609610A (en) A method of self-control probe in detecting BRCA gene

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20170704

Termination date: 20200105

CF01 Termination of patent right due to non-payment of annual fee