CN103468685B

CN103468685B - Aeromonas hydrophila is fit and screening method and application

Info

Publication number: CN103468685B
Application number: CN201310363869.8A
Authority: CN
Inventors: 李元跃; 王雷; 段博文; 陈融斌; 黎中宝
Original assignee: Jimei University
Current assignee: Jimei University
Priority date: 2012-01-05
Filing date: 2012-01-05
Publication date: 2016-04-27
Anticipated expiration: 2032-01-05
Also published as: CN103468688B; CN103468684B; CN103468685A; CN103468688A; CN102643821B; CN102643821A; CN103468684A

Abstract

The present invention relates to the fit and screening method of Aeromonas hydrophila and application.The screening method providing the fit and described Aeromonas hydrophila of Aeromonas hydrophila fit and application.The concrete steps of the screening method that described Aeromonas hydrophila is fit comprise: build and synthesize the fit ssDNA library of Aeromonas hydrophila to be screened, and the corresponding primer of design and synthesis; Get appropriate described ssDNA library and Aeromonas hydrophila combines; Be separated the ssDNA obtaining and be combined with Aeromonas hydrophila, with this ssDNA for template carries out PCT amplification, amplified production carries out SELEX screening again until obtain corresponding fit.The present invention adopts SELEX technology screening to go out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, the described fit examination and analysb being widely used in Aeromonas hydrophila.

Description

Aeromonas hydrophila is fit and screening method and application

Technical field

The present invention relates to infective pathogen bacterium---Aeromonas hydrophila common in aquaculture, particularly fit the and screening method of Aeromonas hydrophila and application.

Background technology

Aeromonas hydrophila (Aeromonashydrophila) is extensive in distributed in nature, the primary pathogenic bacterium of multiple hydrocoles, multiple virulence factor can be produced, to aquatic animal, livestock and poultry and the mankind all have pathogenic, septicemia and mankind's diarrhoea of many animals can be caused, threat is brought to human health, also cause larger financial loss to aquaculture (1. a kingfisher is beautiful simultaneously, Yu Zhouliang, Zhao Baohua, He Hongxuan. Advancement in Study on Aeromonas hydrophila [J]. Chinese Veterinary Journal, 2008,42(7): 46-50.).Therefore, pollute for the Aeromonas hydrophila as pollution of waterhead indicator, its inspecting force still needs further reinforcement.The detection of current Aeromonas hydrophila is a stubborn problem always, and traditional chemical pathology detection process is loaded down with trivial details, expends time in; Enzyme linked immunological, multiple PCR technique then high cost (2. Wang Li. several detection methods [J] of Fish Aeromonas Hydrophila. inland aquatic products, 2006, (2): 22-23.).Therefore, exploitation is a kind of easy and simple to handle, with low cost, and Aeromonas hydrophila detection method quickly and easily, becomes the technical barrier that those skilled in the art are in the urgent need to address.

SELEX (SystematicEvolutionofLigandsbyExponentialEnrichment) i.e. index concentration Fas lignand system evolution technology, it is chemical association technology (the 3. Meng Qing tinkling of pieces of jade of a kind of external synthesis screening oligonucleotide aptamers that nineteen ninety is created by Tuerk and Gold of the U.S., old wound husband .SELEX technology and application prospect [J] thereof. Tarim University's journal, 2008,20 (3): 44-48.4. Liao's generation are strange, Liu Wei, Wang Li .SELEX technology applied research progress [J]. Gansu medicine, 2009, (02): 96-97.).To have specificity high due to fit, storage capacity is large, generated time is short, and (5. Wang Cong is gorgeous, Sun Wei, Li Jianguo, Deng .SELEX technology applied research progress [J]. biotechnology is circulated a notice of, 2006, : 232-236.) (S1) advantage such as, SELEX technology is widely used in control and prevention of disease now, drug screening, the technical field that clinical diagnosis etc. are different, along with constantly bringing forth new ideas and development of technology, create the SELEX screening method that some are new gradually, as the SELEX technology that leads, composition target molecule SELEX technology, research means (the 6. Meng Qing tinkling of pieces of jade of genomic SELEX innovation, old wound husband .SELEX technology and application prospect [J] thereof. Tarim University's journal, 2008, 20 (3): 44-48.).

Summary of the invention

It is fit that the first object of the present invention is to provide Aeromonas hydrophila.

The second object of the present invention is the screening method providing described Aeromonas hydrophila fit.

The third object of the present invention is to provide described Aeromonas hydrophila the fit application stated in Aeromonas hydrophila in detection.

The nucleotide sequence that described Aeromonas hydrophila is fit is as shown in the sequence in sequence table No. 1-22.

The screening method that described Aeromonas hydrophila is fit is that index concentration Fas lignand system evolution technology (i.e. SELEX screening) is applied to the fit screening of Aeromonas hydrophila, and the concrete steps of described SELEX screening comprise:

1) build and synthesize the fit ssDNA library of Aeromonas hydrophila to be screened, and the corresponding primer of design and synthesis;

2) appropriate described ssDNA library is got and Aeromonas hydrophila combines;

3) be separated the ssDNA obtaining and be combined with Aeromonas hydrophila, with this ssDNA for template carries out PCT amplification, amplified production carries out SELEX screening again until obtain corresponding fit.

In step 1), described ssDNA library can be:: 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 '.

Described primer can be:

Primer I: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ';

Primer II: 5 '-GATCCGGGCCTCATGTCGAA-3 ';

Primer III: 5 '-digoxin-GGGAGCTCAGAATAAACGCTCAA-3 ';

Primer IV: 5 '-vitamin H-GATCCGGGCCTCATGTCGAA-3 '.

In step 3), described SELEX screening is carried out 12 altogether and is taken turns.

The present invention adopts SELEX technology screening to go out the high-affinity oligonucleotide aptamers of pathogenic hydrophila gingivalis, the described exploitation of the fit Fast Detection Technique for Aeromonas hydrophila and the application in aquatic products Disease management provide reference, can be widely used in the examination and analysb of Aeromonas hydrophila.

Accompanying drawing explanation

Fig. 1 is PCR primer 3% agarose gel electrophoresis figure.In FIG, M is 50bpDNAmarker, and 1,3,5,7,9,11,12 represent the 1st, 3,5,7,9,11,12 PCR primer of taking turns respectively.

Fig. 2 is the fit absorbancy be combined with Aeromonas hydrophila.In fig. 2, X-coordinate is screening wheel number, absorbancy when ordinate zou is A450nm.

The aptamer secondary structure figure that Fig. 3-Fig. 5 screens for the present invention.Structure minimum free energy in Fig. 3 is-7.60 kilocalories/rubs, and the structure minimum free energy in Fig. 4 is 1.83 kilocalories/rub, the structure minimum free energy in Fig. 5 is-3.11 kilocalories/rubs.

Embodiment

One, the synthesis of ssDNA library and primer

Reference literature (7, Liu Fengwei, Lan little Peng. the research that in-vitro screening Pseudomonas aeruginosa is fit and Preliminary Applications [D]. Foochow Medical University Of Fujian, 2007.) method disclosed in, the ssDNA pool screened for SELEX and primer are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.

Library used is: 5 '-GGGAGCTCAGAATAAACGCTCAA-N35-TTCGACATGAGGCCCGGATC-3 '.

The primer is respectively:

Primer I: 5 '-GGGAGCTCAGAATAAACGCTCAA-3 ';

Primer II: 5 '-GATCCGGGCCTCATGTCGAA-3 ';

Primer III: 5 '-digoxin-GGGAGCTCAGAATAAACGCTCAA-3 ';

Primer IV: 5 '-vitamin H-GATCCGGGCCTCATGTCGAA-3 '.

It is 10 μm of ol that above-mentioned primer is diluted to concentration with TE damping fluid (pH8.0) conventional in molecular biology in post synthesis, and-20 DEG C save backup.

Two, experiment reagent and damping fluid preparation

Dynabeads streptavidin magnetic bead M-280 test kit, 2 × TaqPCRMasterMix, 50bpDNALadderMarker, bovine serum albumin (BSA) are all purchased from Xiamen Lu Long Bioisystech Co., Ltd, PCR glue reclaims purification kit purchased from omega company, anti-digoxin alkaline phosphatase is purchased from Roche company, and 4-NPP is Amresco Products.Damping fluid reference reference (Liu Fengwei, Lan little Peng. the research that in-vitro screening Pseudomonas aeruginosa is fit and Preliminary Applications [D]. Foochow Medical University Of Fujian, 2007.) preparation.

Three, bacterial classification: Aeromonas hydrophila AS1.1801 is purchased from Chinese industrial Microbiological Culture Collection administrative center.

Four, SELEX screening

Get a certain amount of ssDNA pool (first run screening consumption is 600pmol, and often wheel reduces consumption subsequently), add 600 μ L and select damping fluid dilution ssDNA, in 95 DEG C of sex change 5min, cooling 10min.(quantity of bacterium is about 1.5 × 10 to add the Aeromonas hydrophila bacteria suspension of 30 μ L ⁸individual), mixing puts shaking table room temperature in conjunction with 30min, 15000r/min, centrifugal 10min at 4 DEG C.Abandon supernatant liquor afterwards, add 600 μ L and select damping fluid resuspended, repeated washing like this 3 times, washes away the ssDNA be not combined with Aeromonas hydrophila, combines the Aeromonas hydrophila precipitation 100 μ LddH of ssDNA ₂o is resuspended, 96 DEG C of heating 5min, and getting supernatant after centrifugal is template, pcr amplification is carried out with primer I, IV, obtain the double-stranded DNA (dsDNA) of mark vitamin H, utilize M-280 magnetic bead to be separated ssDNA by the interaction between biotin-streptavidin, as the secondary storehouse of next round screening.According to aforesaid method, again SELEX screening is carried out to secondary storehouse, successively carry out 12 and take turns SELEX screening.

Five, the fit mensuration with Aeromonas hydrophila combination rate of each wheel and fit sequence and analysis

Take turns the product (i.e. this wash-out supernatant of taking turns) of SELEX screening by the 1st, 3,5,7,9,11,12, carry out pcr amplification with primer III and primer IV, each wheel all increases 320 μ L.PCR amplification system is: 2 × TaqPCRMasterMix10ul, and upstream primer (10um), downstream primer (10um) each 0.4ul, template 1ul, supplies 20ul with deionized water.PCR reaction conditions is: 95 DEG C of denaturation 3min; 94 DEG C of sex change 30s, 58 DEG C-70 DEG C annealing 30s, 72 DEG C extend 20s, 24 circulations; 72 DEG C extend 3min.

Pcr amplification product glue is reclaimed purification kit and carries out purifying, purified product utilizes the agarose electrophoresis of 3% to detect, can find out that electrophoretic band is more and more finer and close, simultaneously diffusing phenomenon is fewer and feweri, and band increases to some extent along with the more and more neat and brightness of the increase of screening number of times.Increase along with screening number of times is described, SPECIFIC APTAMER obtains enrichment, and its homology may be higher

The dsDNA of purifying is unwind into ssDNA by the PCR primer Streptavidin MagneSphere after purifying, and this ssDNA, namely with digoxigenin labeled, measures its content.Press ssDNA again: Aeromonas hydrophila=300pmol: 1.5 × 10 ⁸ratio, both are selected in damping fluid in conjunction with 30min at 500 μ L, the alkaline phosphatase enzyme reaction 10min of the anti digoxin antibody mark that 100 μ L1: 15000 dilute is added after centrifugal, centrifugal supernatant of abandoning also selects damping fluid suspension Aeromonas hydrophilas with 500 μ L, repeated washing 3 times, wash away the alkaline phosphatase of the anti digoxin antibody mark that ssDNA-digoxin is not combined on Aeromonas hydrophila, then 100 μ L para-nitro-pheneye phosphate solution colour developings are added, 100 μ L2mol/LNaOH termination reactions are added after colour developing is good, absorbance is measured in 405nm by microplate reader, experimental result is see Fig. 1.This avidity measurement result shows, along with the increase of screening wheel number, fitly to increase gradually with the avidity of bacterium liquid, reaches maximum when the 9th takes turns, and avidity change is afterwards little, tend towards stability, illustrate fit reach saturated.

With primer I and primer II, the PCR primer that the 12nd takes turns is increased in a large number again, send after purifying and get 24 clone order-checkings at random after Ying Jun Bioisystech Co., Ltd clone, clone, obtain 22 satisfactory fit sequences.A group, B group two groups are divided into according to the number of stochastic sequence base.A group's (see table 1) comprises 13 fit sequences, and consistent with expection length, B group's (see table 2) comprises 9 sequences, is all shorter than expection length.Sequencing result is in table 1.Analyze 22 fit homologous sequences with Macaw2.05 software package, obtain 4 conserved sequence: GTTTTX(see A1-1, A1-8, A1-13, A1-17, A1-20, A1-21, A1-26, No. A1-30 fit); GTGGGT(sees A1-1, A1-7, A1-12, A1-15, A1-22, A1-29); GTTTX(sees A1-1, A1-5, A1-7, A1-10, A1-13, A1-14, A1-15, A1-18, A1-21, A1-22, A1-29); XTTTT(sees A1-14, A1-26, A1-27).Have fit in same conserved sequence occur repeatedly, as in A1-18, three times occur GTTTG; Have fit in then there is multiple conserved sequence, but do not have find be present in all fit in conserved sequence.

Fit	Numbering in sequence table	Nucleotide sequence
			A1-3	1	TGGTGGTCTGCTAGCGGTTTATGTTTTTGTCTGGT
A1-4	2	AGGATGGATTAGTGGGATTGGTGGTTAGGGGGGG
			A1-5	3	GACCTCGTCTTCGGTGTGATCGTTTCTTGTTGTTG
A1-7	4	GGTGTGTTGGTGGGTGTGTGTTTGGGTTCTTGGGT
			A1-14	5	TGCGGCTGTGTGGGTGGTTTGGGTTTGTTGCTTTT
A1-15	6	GCGGTGGGTGGTAGGTTTGTGTTTGTTAATGGGTG
			A1-17	7	GTTGTCTCTGGTGTTTTGGATTGATGGCCTTGCTG
A1-18	8	GGTGTCTGGTTTGTTGTGGTTGTTTGTGGTTTGTG
			A1-20	9	GCGGTTATGTGAAATTATGGCATGGTTTTGTGGTG
A1-26	10	GGTCCATTGGCTGTGTTTTCTAGGTGTTATGTTTT
			A1-27	11	GGTCGTTAGACGGGGCTAGTAATATATTTCCTTTT
A1-29	12	CTGTCGTGTGTTTGGGTGTGGGTCGTGTGGTTGGT
			A1-31	13	GTATAGATGTACTGCTGTGCATATCCTATGCAACT

Table 1A group Aeromonas hydrophila is fit

Fit	Numbering in sequence table	Nucleotide sequence
			A1-1	14	GGTGGTGGGTGTTTTGTCGGTTTGGTGTTTGGT
A1-8	15	TGGCGGTGTTTTTGGGTGGGGTTATAGG
			A1-10	16	CTGGCTGTTCGTTTAGAATGAACCGGTCATG
A1-12	17	GTTGTGGTGGGGTCGGAGGTTGTCTGGT
			A1-13	18	TGGTGTTTGGTTGTTTTGTTTGG
A1-21	19	TTTGTGGCGGGGTTTGCTTGGTTTTGTGGTGG
			A1-22	20	GGGGTGGGTGGGTGTGTGTTTGGTTGGTTTG
A1-30	21	GGGTTGGTTTGGGGGGGGCTGTTTTG
			A1-28	22	GGGTGGGTTGGTTGGTGGTTGTTTTTGTG

Table 2B group Aeromonas hydrophila is fit

With DNAMAN software, secondary structure analysis is carried out to measured 22 sequences, can be divided three classes according to structure:

The first kind: the 6th base that the fixed sequence program district base and 3 ' of 5 ' end is held plays formation loop-stem structure, middle random district forms loop-stem structure, and 3 ' 5 fixing bases of holding form a little bag structure (Fig. 3).The fit of this structure has A1-3, A1-5, A1-7, A1-13, A1-14, A1-20, A1-22 totally seven;

Equations of The Second Kind: the 3rd to 21 bases of 5 ' end form loop-stem structure, 3 ' end fixed sequence program district base and random district, centre base form stem ring and projection, and then forming a bag structure (Fig. 4) by 5 ' end, 3 ' end fixed sequence program district base and random district, centre, the fit of this structure has A1-1, A1-4, A1-12, A1-15, A1-17, A1-18, A1-21, A1-27, A1-28, A1-29, A1-30, A1-31 totally ten two;

3rd class: 5 ' end, 3 ' end fixed sequence program district number of base form loop-stem structure with random district respectively, then holds fixed sequence program district base and random district, centre to form a large bag structure (Fig. 5) again by 5 ' end, 3 '.The fit of this structure has A1-8, A1-10, A1-26 tri-.

The ssDNA library total length 78bp of applicant's synthetic, middle 35bp is random nucleotide, and because there is A, G, C, T tetra-kinds possibility in each site, like this, 35 sequences just have 4 ³⁵individually may combine, namely its storage capacity reaches 10 ¹⁶more than, although may only to 10 in actual experiment ¹⁴left and right, but this also meet screening object oligonucleotide needs (8, Li Weibin, Lan little Peng, Yang Xiangyue, Deng the utilization [J] of .SELEX technology in screening Ciclosporin A is fit. Foochow hospital general journal, 2007, (03): 171-173).In the process that front two-wheeled screens, the library amount that applicant adds is many, and such object obtains many fit with Aeromonas hydrophila specific binding as much as possible.But along with the increase of screening wheel number, the amount in secondary library will reduce accordingly, this is because the concentration in library is increasing.In order to increase fit specificity, applicant is corresponding adds washing steps, and simultaneously library and the time that bacterium liquid is combined also reduce to 20min afterwards from former 30min taken turns.The optimization of PCR condition is also very important to fit screening, and each takes turns screening, and applicant first will do a grads PCR, under the prerequisite obtaining the suitableeest annealing temperature, do pcr amplification again, effectively like this avoids the problems such as non-specific amplification.

What applicant tested is that Streptavidin MagneSphere comes the secondary library of enrichment, it is simple to operate, it is centrifugal not need, as long as the effect of separation can be reached under the influence of a magnetic field, simultaneously its secondary library of obtaining is more stable, purity is higher, not easily occurs the problem of the non-specific amplification in asymmetric PCR.By 12 taking turns screening, cloning and sequencing obtains 22 fit in, have 13 fit always consistent with expection length.

Utilize DNAMAN software to its secondary structure analysis, as can be seen from result, the secondary structure of these sequences is all made up of stem ring and pocket (spoon shape) structure, which illustrate stem ring and bag structure may be the fit architecture basics be combined with Aeromonas hydrophila, stem may play a part rock steady structure, and ring may be its combining site.Pocket containing spoon shape in some secondary structure, it is the same that these pockets also may play a part same ring, namely may be the combining site with receptors bind.In these stem structures, its base mainly G-C is main, and because the structure of G-C can be greater than A-T, this point also illustrates that stem may play stabilization.

The present invention tentatively establishes the fit method of SELEX method screening Aeromonas hydrophila, obtain simultaneously and there is the fit of specific Aeromonas hydrophila, and the secondary structure of fit group is tentatively studied, obtain some structures composition of its secondary structure, this molecular structure for later research Aeromonas hydrophila has laid certain basis, simultaneously also for the detection of Aeromonas hydrophila provides a kind of new method.

Claims

1. Aeromonas hydrophila is fit, it is characterized in that, its sequence is: GGGAGCTCAGAATAAACGCTCAAGGTGTGTTGGTGGGTGTGTGTTTGGGTTCTTGG GTTTCGACATGAGGCCCGGATC.

2. Aeromonas hydrophila is fit is as claimed in claim 1 detecting the application in Aeromonas hydrophila, described in be applied as the application of non-diseases diagnostic purpose.