CN102191250A - DNA (Desoxyribonucleic Acid) ligand for specific binding with EPO (erythropoietin), preparation method thereof and application thereof - Google Patents
DNA (Desoxyribonucleic Acid) ligand for specific binding with EPO (erythropoietin), preparation method thereof and application thereof Download PDFInfo
- Publication number
- CN102191250A CN102191250A CN2010101315123A CN201010131512A CN102191250A CN 102191250 A CN102191250 A CN 102191250A CN 2010101315123 A CN2010101315123 A CN 2010101315123A CN 201010131512 A CN201010131512 A CN 201010131512A CN 102191250 A CN102191250 A CN 102191250A
- Authority
- CN
- China
- Prior art keywords
- epo
- rhuepo
- dna
- aptamers
- library
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
Abstract
The invention relates to a DNA (Desoxyribonucleic Acid) ligand for specific binding with EPO (erythropoietin), a preparation method thereof and application thereof, specifically provides a DNA ligand capable of specifically binding with the EPO and a method for screening the ligand by an improved SELEX (Systematic Evolution of Ligands by Exponential Enrichment) technology, and provides EPO detecting elements with better detecting stability, higher sensitivity, convenience and quickness.
Description
Technical field
The present invention relates to proteinology, molecular biology and combinatorial chemistry field.Particularly, the present invention relates to the novel recognition component of albumen-DNA aptamers (Aptamer), Its Preparation Method And Use.
Background technology
(Erythropoietin EPO) is a kind of functional sugar albumen that promotes that human erythrocyte generates to erythropoietin.When human body is in low blood oxygen concentration, the erythropoietin that renal secretion produces is by activating the erythropoietin receptor on the red progenitor cell film, make it proliferation and differentiation and become sophisticated red corpuscle, thereby regulate the erythrocytic quantity of periphery, therefore EPO is a kind of strong stimulators of erythropoiesis (Jelkmann W.Erythropoietin:structure, control of production, and function.Physiol Rev, 1992,72 (2): 449-489).
1985, people utilized the synthetic recombinant human erythropoietin (rHuEPO) that generated of gene recombination technology.Present commercial rhuEPO mainly contains four kinds, rHuEPO-α, rHuEPO-β, the erythropoietin receptor agonists of novel erythropoiesis stimulating protein Darbepoetin (trade(brand)name Aranesp) and persistence (Continuous ErythropoietinReceptor Activator, CERA).RHuEPO is mainly used in the anaemias that various chronic disease occurred together such as treatment renal anemia and tumour clinically.Simultaneously, can promote red corpuscle to produce, thereby increase the oxygen carrying capacity of body, improve the characteristic of tolerance, therefore in human sport's sports and Equestrian competition, often be made stimulant to improve games results by abuse because EPO has.According to estimates in endurance competition, there is the sportsmen of 3-7% to use recombinant epo (Wilber RL approximately, Detection of DNA-recombinant human epoetin-alpha as apharmacological ergogenic aid.Sports Med, 2002,32:125-142.).In forbidden drugs inventory in 2009, under the S2 item first generates stimulant with promoting erythrocyte and replaces erythropoietin, so as to indicate more clearly all kinds of new EPO analogue that occurs in recent years (The World Anti-Doping Code-THE 2009 PROHIBITED LISTINTERNATIONAL STANDARD.http: //www.wada-ama.org).Therefore how EPO effectively being detected is the focus that current people pay close attention to.
In clinical detection, the immunoassay that developed recently gets up is present most widely used EPO detection method.Immunoassay is based on the specificity and the affinity of antigen, antibody response, comprises that mainly radioimmunology, enzyme exempt from analytical method, fluoroimmunoassay, chemiluminescence immunoassay etc.
At EPO as anti-depressant context of detection, since 2000, the International Olympic Committee uses the two blottings of isoelectrofocusing-immunity to detect the sportsmen and whether injected the recombinant epo product, and with the standard detecting method of this method as abuse EPO in human sport's match, the sensitivity that detects of its every trace bands of a spectrum is 1.7pg.In addition, all kinds of mass-spectrometric techniques such as MALDI-TOF-MS and ESI-MS also provide sensitive method (Guan F et al, Differentiation andIdentification of Recombinant Human Erythropoietin andDarbepoetin Alfa in Equine for detecting of rHuEPO
In sum, no matter be in the clinical detection of EPO or in as anti-depressant detection, all be based on the technology that immune antibody is caught enrichment.But the low further raising that waits these limitation all to influence the stable of immunoassay and hinder its sensitivity of repeatability between the susceptibility that antibody self changes for envrionment temperature and pH is criticized with intolerance and product.And have and report that the center tetrapeptide that the antigen aminoacid sequence that is used for preparing EPO monoclonal antibody AE 7A5 contains extensively exists in 500 various human body proteins and 185 kinds of e. coli proteins, therefore cause antibody A E7A5 can with eukaryote, mycoprotein and mammalian tissues, for example the urothelium tissue produces tangible cross reaction (Franke W W etc., errors and risks of false-positiveresults in urinary EPO drug tests.Clinica Chimica Acta.2006,373:189-190.).Therefore, need high stability, highly sensitive, low cross reaction and the exploitation of EPO measuring element and detection method easily and efficiently badly.
The notion of aptamers was proposed by Tuerk etc. first in nineteen ninety, (systematic evolution of ligands by exponentialenrichment SELEX) filters out from specific oligonucleotide library target is had the interactional oligonucleotide of specificity (DNA or RNA) to be meant the part evolution technology of utilization index enrichment.Molecular recognition function is very similar to antibody between aptamers and the target molecule, but compares with traditional antibody, and aptamers has following characteristics and advantage: (1) has the affinity suitable even higher with antibody to the target molecule; (2) can be in a large number, fast external synthetic, the preparation method is simple and fast more; (3) can screen at different types of target, comprise the molecule of bio-toxicity and the molecule that only has haptens, widen its range of application; (4) stability is better than antibody, is beneficial to storage; (5) easy functional modification and mark.Based on the above-mentioned good characteristic of aptamers, it all has good prospects for application in a plurality of fields such as disease detection, medicament research and development, clinical treatment, analytical chemistry, proteomics and the researchs of gene expression regulation mechanism.Do not adopt SELEX technology research work at rHuEPO-α screening specific oligonucleotide aptamers but still have at present both at home and abroad.
Summary of the invention
For this reason, the contriver has designed the affine resin screening strategy of improvement in view of the constructional feature of EPO molecule, and by the combinatorial chemistry technique based on the SELEX technology, screening obtains the DNA aptamers of energy specificity in conjunction with EPO.This aptamers is the new EPO wedding agent except that antibody, can specificity catch with enrichment blood plasma and urine in the EPO molecule, and have stable, advantage easily and efficiently with respect to antibody.Wherein, the epo protein of being mentioned in the content of the present invention all refers in natural EPO albumen, rHuEPO-α albumen and the rHuEPO-β albumen one or more also comprise deglycosylated above-mentioned epo protein, except the special instruction.
Simultaneously, the contriver utilizes the electrostatic interaction between few anionic aptamers and special metal positively charged ion, by changing specific ionic concn, can screen effectively and obtain the good DNA aptamers of associativity, and the screening method of new DNA aptamers is provided thus.Particularly, the invention provides:
1. specificity is in conjunction with the aptamers and the fragment thereof of epo protein, and it is selected from the sequence shown in SEQ ID NO:1～120 one or more,
Wherein, SEQ ID NO:61-120 structurally all meets the constitutional features shown in the following general formula I, 5 '-CTTCTGCCCGCCTCCTTCC-N
39-GGAGACGAGATAGGCGGACACT-3 ' (general formula I).N represents any among base A, G, C, the T, N in the general formula I
39Representing random fragment length is 39 bases.That is to say that sequence shown in the SEQ ID NO:61-120 is 5 '-CTTCTGCCCGCCTCCTTCC-3 ' in 5 ' terminal sequence, is 5 '-GGAGACGAGATAGGCGGACACT-3 ' in 3 ' terminal sequence; SEQ ID NO:1-60 is the N in the above-mentioned sequence
39Random fragment, it keeps the binding ability of the preceding complete sequence of brachymemma to EPO.Above-mentioned sequence all exists with single stranded form.
Wherein, epo protein is selected from one or more in natural EPO albumen, rHuEPO-α albumen and the rHuEPO-β albumen, also comprises deglycosylated above-mentioned epo protein.
In the sequence shown in SEQ ID NO:1～120, the sequence shown in the preferred SEQ ID NO:53,56,60,113,116 and 120.
Sequence shown in SEQ ID NO:1～120, its modification mode is selected from one or more in the following mode: full sulfuration, end-block and PEG modify.
2. be used for composition, test kit and chip that EPO detects, wherein contain the aptamers of each sequence shown in SEQ ID NO:1～120 and the aptamers of modifying thereof through aforesaid way.
3. contain the aptamers of each sequence shown in SEQ ID NO:1～120 and the aptamers of modifying thereof, be used for the purposes that EPO detects through aforesaid way.
4. the screening specificity comprises step (a)-(l) in conjunction with the method for the aptamers of epo protein:
(a) provide following (i)-(iv):
(i) screening library: it is selected from the nucleic acid library that comprises double-stranded DNA library, single stranded DNA (ssDNA) library and RNA library, preferred ssDNA library, more preferably pass through the ssDNA library of mark, described mark can be fluorescein or vitamin H, and going back preferred length is the library of ssDNA at random shown in following general formula I of 80 bases: 5 '-CTTCTGCCCGCCTCCTTCC-N
39-GGAGACGAGATAGGCGGACACT-3 ';
(ii) target protein: epo protein, epo protein wherein are selected from one or more in natural EPO albumen, rHuEPO-α albumen and the rHuEPO-β albumen, also comprise deglycosylated above-mentioned epo protein, preferred rHuEPO-α albumen;
(iii) affine resin: coupling has couple EPO that the resin of the material of specificity avidity is arranged, and preferred coupling has the agarose resin of wheat germ agglutinin; With
(iv) coupling have EPO affine resin (iii);
(b) the screening library in the step (a) is (iii) contacted under suitable condition with affine resin,
Described contact can comprise incubation, washing,
Described " suitable condition " be meant the member that is enough to make in the screening library can with affine resin specificity bonded bonded condition, this condition can relate to composition, the pH value of temperature, action time, binding buffer liquid;
For example heated culture temperature is 37 ℃, and be 1h action time, and 1 * liquid storage prescription of screening liquid is: 20mM Tris-HCl, 140mM NaCl, 5mM MgCl
2, 5mM KCl, wherein Mg
2+Working concentration remain on 0.1-50mM, preferred Mg
2+Working concentration be 0.1,5,10,20,50mM, most preferably 5mM.
Collect then not and (iii) bonded ssDNA library of affine resin;
(c) make in the step (b) and (iii) (iv) under suitable condition, do not contact with affine resin in bonded ssDNA library with affine resin,
Described contact can comprise incubation, washing;
Described " suitable condition " be meant the member that is enough to make in the screening library can with affine resin specificity bonded bonded condition, this condition can relate to composition, the pH value of temperature, action time, binding buffer liquid;
For example heated culture temperature is 37 ℃, and be 1h action time, and 1 * liquid storage prescription of screening liquid is: 20mM Tris-HCl, 140mM NaCl, 5mM MgCl
2, 5mM KCl, wherein Mg
2+Working concentration remain on 0.1-50mM, preferred Mg
2+Working concentration be 0.1,5,10,20,50mM, most preferably 5mM.
(d) with N-acetylglucosamine wash-out, collect through step (c) that handle with library member affine resin-bonded;
(e) randomly to the library member of step (d) processing of increasing, it can be transcribing of pcr amplification, RNA library etc. that described amplification is handled;
(f) (iv) under suitable condition, contacting or in the library member (e) and the step (a) with step (d), described " suitable condition " be meant be enough to make step (d) or (e) in the library member can with EPO specificity bonded condition, this condition can relate to the composition, pH value of temperature, action time, binding buffer liquid etc.;
For example heated culture temperature is 37 ℃, and be 1h action time, and 1 * liquid storage prescription of screening liquid is: 20mM Tris-HCl, 140mM NaCl, 5mM MgCl
2, 5mM KCl, wherein Mg
2+Working concentration remain on 0.1-50mM, preferred Mg
2+Working concentration be 0.1,5,10,20,50mM, most preferably 5mM.
(g) randomly, in step (f), carry out the condition severization, for example reduce the consumption of target protein EPO, after contact procedure, increase washing step, in contact procedure, add noncompetitive inhibitor etc., so long as can remove with EPO specificity associativity a little less than library member's step all can use; Noncompetitive inhibitor wherein can be tRNA;
(h) be collected in step (f) or (g) in (iv) specificity bonded library member, this step can adopt type of elution to carry out;
(j) repeating step (e)-(h), multiplicity is 1,2,3,4,5,6,7,8 time, preferably repeats 6-8 time, most preferably repeats 8 times;
(k) the library member that (h) step is obtained confirms, as sequencing etc.; With
(l) randomly, the library member who obtains is carried out combined function detection etc., for example carry out electrophoretic mobility shift assay (EMSA) etc.
The present invention is effectively fixing by target molecule, by metallic cation (as Mg
2+) increase aptamers and target molecule interphase interaction power, adopt the existing affinity column chromatography screening method of the collaborative improvement in fluorescent mark library and electrophoretic mobility shift assay (EMSA) four aspects, can reach the aptamers of nM level through 8 constants that obtained after taking turns screening dissociating, DNA aptamers, the Its Preparation Method And Use of specificity in conjunction with EPO is provided thus.
Description of drawings
Fig. 1 .SELEX method screening specificity is in conjunction with the oligonucleotide aptamers synoptic diagram of recombinant human erythropoietin rHuEPO-α.Synthetic ssDNA library and recombinant human erythropoietin rHuEPO-α are provided, carry out before screening that affine resin is counter to be sieved, make it then to interact, remove unconjugated oligonucleotide library, add non-specific competitive inhibitor tRNA in the screening every the wheel simultaneously, increase screening specificity, screen 8 altogether and take turns.
Fig. 2. the ssDNA library binding ability that the coupling that is connected with recombinant human erythropoietin rHuEPO-α has the agarose resin of WGA and each to take turns to obtain after the screening is synoptic diagram relatively.After screening is finished, get ssDNA library and 500pmol rHuEPO-α effect that 160pmol obtains after 5` Fluoresceincarboxylic acid mark every takes turns screening, usefulness N-acetylglucosamine wash-out, the fluorescence intensity of mensuration elutriant.Experiment finds the 6th, 7,8, and to take turns the avidity of library and rHuEPO-α stronger, and wherein the 8th to take turns the avidity of library and rHuEPO-α the strongest.
Fig. 3 .EMSA measuring through radio isotope [γ-
32P] ssDNA library after each wheel screening of ATP mark and the situation that combines of rHuEPO-α.
A: original library (25nM)+rHuEPO-α (1 μ M) wherein; B:4th library (25nM)+rHuEPO-α (1 μ M); C:6th library (25nM)+r HuEPO-α (1 μ M); D:7th library (25nM)+rHuEPO-α (1 μ M); E:8th library (25nM)+rHuEPO-α (1 μ M).
After screening is finished, get respectively every take turns the oligonucleotide library that obtains after the screening through [γ-
32P] concentration is 25nM behind the ATP mark, interacts with the rHuEPO-α of 1 μ M, experimental result is found to increase gradually along with the avidity of carrying out oligonucleotide library and rHuEPO-α of screening, until the 8th take turns screening after avidity reach the strongest.
Fig. 4 .EMSA measuring through radio isotope [γ-
32P] matched curve of the oligonucleotide aptamers of ATP mark and the dissociation constant of rHuEPO-α, Fig. 4 a wherein, 4b, 4c is corresponding aptamers 813,828,850 respectively.
Fig. 5 .EMSA measuring through radio isotope [γ-
32P] the oligonucleotide aptamers 828 and the rHuEPO-α of ATP mark, human serum albumin HSA, human hemoglobin (hemoglobin), bovine serum albumin (BSA), N,O-Diacetylmuramidase (lysozyme), human IgG bonded specificity electrophorogram.
Wherein, A:a (25nM); B:a (25nM)+rHuEPO-α (1 μ M); C:a (25nM)+HSA (1 μ M); D:a (25nM)+hemoglobin (1 μ M); E:a (25nM)+BSA (1 μ M); F:a (25nM)+lysozyme (1 μ M); F:828 (25nM)+IgG (1 μ M); M is nucleic acid molecular weight Marker, and unit is bp.
Oligonucleotide sequence 828 warps [γ-
32P] behind the ATP mark, adjustment concentration is 25nM, rHuEPO-α with (1000nM), human serum albumin HSA, human hemoglobin, bovine serum albumin, N,O-Diacetylmuramidase, human IgG interacts, and experimental result finds that oligonucleotide sequence 828 does not interact with above-mentioned nonspecific proteins except that rHuEPO-α, illustrates that its specificity is better.
Fig. 6. FRET (fluorescence resonance energy transfer) (FRET) measuring Mg
2+Specificity bonded influence between ion pair aptamers and rHuEPO.
The electrophorogram that combines of Fig. 7 .EMSA measuring oligonucleotide aptamers 828 and commercialization rHuEPO injection liquid.Wherein, A:aptamer 828 (1 μ M); B:aptamer 828 (1 μ M)+Epiao injection liquid (rHuEPO-α) (1 μ M); C:aptamer 828 (1 μ M)+Recormon injection liquid (rHuEPO-β) (1 μ M); M is nucleic acid molecular weight Marker, and unit is bp.
Fig. 8 .EMSA measuring through radio isotope [γ-
32P] matched curve of completely random fragment (828r, SEQ ID NO:56 annotate: 828r mentioned in this article all refers to SEQ ID NO:56) and the dissociation constant of rHuEPO-of oligonucleotide aptamers 828 of ATP mark.
The completely random fragment (828r) of Fig. 9 .EMSA measuring oligonucleotide aptamers 828 and the electrophorogram that combines of commercialization rHuEPO injection liquid.Wherein, A:aptamer 828r (1 μ M); B:aptamer 828r (1 μ M)+Epiao injection liquid (rHuEPO-α) (1 μ M); C:aptamer828r (1 μ M)+Recormon injection liquid (rHuEPO-β) (1 μ M).
The completely random fragment (828r) of Figure 10 .EMSA measuring oligonucleotide aptamers 828 and the electrophorogram that combines of de-glycosylation rHuEPO-α.Wherein, A:aptamer 828r (1 μ M); B:aptamer 828r (1 μ M)+de-glycosylation rHuEPO-(1 μ M); C:aptamer828r (1 μ M)+rHuEPO-α (1 μ M).
Figure 11. the completely random fragment (828r) of oligonucleotide aptamers 828 and cell bonded fluorescence co-focusing image.Wherein Cell T24 is human bladder cancer's epithelial cell, and Cell HEL is people's lens normal epithelium cell.
Embodiment
In the present invention, all explanations, definition and term are as follows:
The SELEX technology
It is the aglucon phyletic evolution technology (Systematic Evolution ofLigands by Exponential Enrichment) of index enrichment, come across early 1990s (Tuerk C, Gold L.Systematic evolution of ligands byexponential enrichment:RNA ligands to bacteriophage T4 DNApolymerase.Science, 1990,249:505-510.), it is based on the method for the outer pcr amplification of combinatorial chemistry principle while combination, through separating repeatedly and increasing, obtain wall scroll aptamers at target molecule specific combination sequence.Based on this technology, consider according to purposes such as aptamers and target molecule interactively and late detection and medicinal designs simultaneously, the sequence of total length is suitably cut out, remove and the irrelevant base of target molecule combination, with suitable raising avidity and specificity and the synthetic cost of reduction.Usually after the screening of number wheel, can obtain high-affinity, the oligonucleotide aptamers of high specific, its dissociation constant (K
d) can reach nmol/L even pmol/L.Successfully use at present this technology screening to obtain the aptamers of specificity separately of metal ion, organic molecule, amino acid, peptide, protein even cell.
Aptamers
Be meant can specificity in conjunction with the proteic oligonucleotide molecules of EPO, have the mono-clonal oligonucleotide molecules of high-affinity in the preferred self enrichment library, comprise the oligonucleotide molecules after sequence is cut out.The number of its Nucleotide is 10-90, preferred 20,30,31,32,33,34,35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,60,70,76,77,78,79,80,81,82,83,84,85,86,87,88,89,90, more preferably 37-48, a 78-89 Nucleotide, preferred especially 38,39,40,79,80,81 Nucleotide.The modification mode of oligonucleotide can be modified or the like for full sulfo-, end-block and PEG.Aptamers is compared than antibody to be had and can externally synthesize, and good stability is easy to advantages such as chemically modified and non-immunogenicity, becomes the proteinic new function molecule of research outside the antibody field gradually.
The fragment length in screening library
Because the N in the general formula I
39Fragment is synthetic fragment at random, so fragment length is slightly irregular, and the SEQ ID NO:1-60 length that the present invention screens is between 37-48 base, and correspondingly, SEQ ID NO:61-120 length is between 78-89 base.
The fixing affine resin choice of EPO
The constructional feature of EPO is to contain about 40% glycosyl, has three N and connects the glycosylation site that is connected with an O, is distributed with triantennary and four days line style oligose and terminal sialylated with α 2 → 3 mode of connection, and the sialic acid average content accounts for 17%.
Wheat germ agglutinin (wheat germ agglutinin, WGA) N-acetylglucosamine that can be connected with β 1-4 or β 1-2 specifically and sialic acid generation affinity interaction, consider that the multiple-limb sugar in the recombinant epo can combine with wheat germ agglutinin by affinity interaction, the contriver select coupling to have or the carrier that is coated with WGA for example resin realize the fixing of recombinant epo.
The improvement of screening conditions
Consider the sialic acid that recombinant epo for example has high level in the rHuEPO-α structure, under the screening buffer condition, the identical charges repulsive interaction can take place, therefore in screening buffered soln, added the Mg of proper concn with oligonucleotide library
2+, shield the negative charge on the nucleic acid backbone thus, help the surface of the electronegative more accessible oligonucleotide molecules of recombinant epo.Reactive force is at no Mg between rHuEPO-α and aptamers
2+Descend 50% when existing.
The selection of EPO
Epo protein among the present invention can be one or more in natural EPO albumen, rHuEPO-α albumen and the rHuEPO-β albumen.The contriver selects rHuEPO-α to screen as representative in an embodiment, after screening is finished, adopt rHuEPO-α, rHuEPO-β to carry out the bonding force checking, result's proof is that the aptamers that the target screening obtains has similar combination activity to rHuEPO-β equally with rHuEPO-α, be that example is tested simultaneously with the natural EPO in the transitional cell bladder carcinoma cell line, find aptamers of the present invention for natural EPO albumen and rHuEPO-α albumen and rHuEPO-β to combine effect similar.
The selection in screening library
The contriver monitors the screening process with the combination rate experiment in real time at the fluorescently-labeled oligonucleotide library of screening whole process using, and adopt [γ-
32P] (electrophoreticmobility shift assay EMSA), carries out the investigation of indexs such as accumulation rate from different technique means angles for the oligonucleotide library of ATP mark and the interactional electrophoretic mobility shift assay experiment of rHuEPO-α.
The electrophoretic mobility shift assay experiment
This test causes its original electrophoretic migration speed to slow down after being based on aptamers and albumen generation interaction formation mixture, shows as the electrophoretic migration speed different with free aptamers, thereby characterizes the interaction force between aptamers and the albumen.
Set forth explanation the present invention below by embodiment, but following embodiment only is used for explaining the present invention, it does not limit protection scope of the present invention, and the variant of the equivalence of any product of the present invention known in the art, method all comprises in the present invention.
Embodiment
The structure of embodiment 1. random single chain DNA (ssDNA) library and primer thereof
(a) making up length is the library of ssDNA at random of 80 bases:
5 '-CTTCTGCCCGCCTCCTTCC-N
39-GGAGACGAGATAGGCGGACACT-3 ' wherein N represents base A, G, C, among the T any (seen Berezovski M, MusheevM, Drabovich A, Krylov SN.Non-SELEX Selection of Aptamers.J.Am.Chem.Soc.2006,128:1410-1411), the capacity in this library is 10
13-10
15
(b) forward primer of synthetic 5 ' end mark fluorescent element (FAM):
5’-FAM-CTTCTGCCCGCCTCCTTCC-3’(SEQ?ID?NO：121)，
(c) reverse primer of synthetic 5 ' end mark vitamin H (biotin):
5 '-vitamin H-AGTGTCCGCCTATCTCGTCTCC-3 ' (SEQ ID NO:122).
SsDNA library and primer are synthetic by the living worker in Shanghai Bioisystech Co., Ltd at random.
The screening of the DNA aptamers of embodiment 2. specific recognition rHuEPO-α
For filtering out the DNA aptamers strong with rHuEPO-α binding specificity, carried out 8 altogether with the SELEX method and taken turns screening (Fig. 1 is seen in 8 SELEX circulations), below to take turns screening with the 1st be that example describes this process in detail.
(1) screening of SELEX method and rHuEPO-alpha specific bonded ssDNA library
(a) the anti-sieve in wheat germ agglutinin coupling resin and ssDNA library is handled
Getting the described ssDNA at random of 2000pmol library is dissolved in 300 μ L, 1 * SELEX screening damping fluid (1 * SELEX screens damping fluid: 20mM Tris-HCl, 140mM NaCl, 5mM MgCl
2, 5mM KCl, PH=7.4) in, and place 95 ℃ of water-baths to place ice bath after 5 minutes immediately 10 minutes.
The agarose resin of wheat germ agglutinin (WGA) (the particle diameter 200-300 μ m that added 220 μ L couplings then, available from Sigma-Aldrich company, the 1mL resin is suspended in 2.2mL suspension), 37 ℃ of slow vibration incubations 1 hour have been collected not then with described coupling the agarose resin bonded ssDNA library of WGA.
(b) rHuEPO-α coupling resin is to library screening after handling through anti-sieve
Getting the pure rHuEPO-α of 2000pmol albumen (Sai Baoer Biology Pharmacy Co., Ltd in Shenzhen provides) is dissolved in 300 μ L, 1 * SELEX screening damping fluid, and to the agarose resin of WGA that wherein added the described coupling of 100 μ L, in 37 ℃ of slow vibration incubations 1 hour, use 1 * SELEX screening buffer solution for cleaning 3 times to have removed not with described coupling behind the agarose resin bonded rHuEPO-α of WGA subsequently, clean 3 times with binding buffer liquid again.
With collect described not with described coupling WGA agarose resin bonded ssDNA library (promptly, the library of handling through anti-sieve) adds among the described rHuEPO-of agarose resin of WGA that has been incorporated into described coupling, simultaneously add tRNA with final concentration 4 μ M, and incubation 1 hour.Discard not with the rHuEPO-α bonded ssDNA library of agarose resin of WGA that has been incorporated into described coupling after, clean 3 times with binding buffer liquid.
In described and the rHuEPO-α bonded ssDNA library of agarose resin of WGA that has been incorporated into described coupling, add 300 μ L SELEX screening elutriant (the N-acetyl glucosamine amine aqueous solution of 0.45M), wash-out 2 times, each 10 minutes.
After merging the elutriant of collecting,, get supernatant with the saturated phenol-chloroform of isopyknic Tris (1: 1) extracting, again with isopyknic chloroform extracting to remove trace phenol, get supernatant, and add dehydrated alcohol-20 a ℃ precipitation and spend the night, thereby obtain being used for the ssDNA library of lower whorl screening.
(2) be used for the preparation in the ssDNA library of lower whorl SELEX method screening
Every take turns screening before, after needing will to go up step gained ssDNA amplified library and be the dsDNA library by PCR, again with gained dsDNA library after Streptavidin magnetic bead (Promega company, the U.S.) extracts, obtain being used for the ssDNA library of lower whorl screening through alkaline hydrolysis.Detailed process is as follows:
Get the described ssDNA library that filters out of 5 μ L, the 30pmol forward primer, the 30pmol reverse primer, the dNTP of 10 μ L, 10 * PCR reaction buffer, 2,2 μ L 10mmol/L, the archaeal dna polymerase of 3U (activity unit) adds sterilized water to 100 μ L.Carry out 10-15 round-robin pcr amplification then, response procedures is set at: 94 ℃, and 5 minutes; 94 ℃, 30 seconds; 56 ℃, 15 seconds; 72 ℃, 15 seconds; 72 ℃, 5 minutes.Can be by changing cycle number to obtain best expanding effect.The PCR product detects with 10% native polyacrylamide gel electrophoresis.
Get 1200 μ L gained dsDNA libraries and join in the 600 cleaned μ L Streptavidin magnetic beads, it was placed on the magnetic force frame in jolting on the shaking table in 6 hours.Supernatant discarded, and,, act on 1.5 minutes to the NaOH solution that wherein adds 300 μ L 0.15mol/L with after the PBS buffer solution for cleaning 3 times.The sucking-off supernatant liquor also with the neutralization of 30 μ L, 10% acetate, mixes.Again to lithium perchlorate solution that wherein adds 33 μ L 22% and 1mL acetone, and place-20 ℃ of precipitations to spend the night.Remove supernatant liquor with 14000rpm after centrifugal 20 minutes next day, and described precipitation is obtained being used for the ssDNA library of lower whorl screening after water dissolution.The extracted amount in ultraviolet determination gained ssDNA library.
The screening of (3) 2-8 wheel SELEX method
Repeat above-mentioned steps (1) and (2) and carry out the screening of 2-8 wheel, wherein:
The described ssDNA at random of 1000pmol library and the pure rHuEPO-α of 300pmol albumen have been used in the screening of 2-3 wheel;
The described ssDNA at random of 500pmol library and the pure rHuEPO-α of 100pmol albumen have been used in the screening of 4-8 wheel.
Take turns in the screening every, increase screening specificity by adding non-specific competitor tRNA.
(4) comparison between the avidity of each wheel screening gained ssDNA library and rHuEPO-α
Relatively each takes turns the avidity between screening gained ssDNA library and rHuEPO-α, the same step of method (1) with the affinity column method.
Get respectively take turns gained ssDNA library (all FAM mark) with the coupling that is combined with rHuEPO-α the agarose resin effect of WGA, remove unconjugated ssDNA library.After binding buffer liquid cleaning 3 times,, measure the fluorescent value of the elution buffer of respectively taking turns gained ssDNA library to wherein adding SELEX elution buffer (the N-acetylglucosamine of 0.45M).Calculation formula is as follows:
(sample resins elution buffer fluorescence intensity-blank resin elution damping fluid fluorescence intensity)/initial fluorescent intensity
By measure finding, the 6th, 7,8 to take turns screening gained ssDNA library stronger with the binding affinity of rHuEPO-α, and the 8th take turns the strongest (see figure 2) of avidity of screening gained ssDNA library and rHuEPO-α.
Therefore, take turns screening gained ssDNA amplification by the method for step (2) with the 6th, 7,8 and be dsDNA, after T carrier (Promega company, the U.S.) connects, be transformed in the bacillus coli DH 5 alpha.Carry out ammonia benzyl resistance screening then, the single growth bacterium colony of picking checks order respectively, obtains 60 full length rna oligonucleotide sequences shown in SEQ ID NO:61-120 in the following table 1.Follow-up random fragment test experience is found, independently form in conjunction with conformation or combining conformation with the complementary fellowship of two ends fixed guiding region forms from the fragment of district at random of 60 full length sequences, distinguish fragment (SEQ ID NO:1-60) at random and list in table 1 for herein that bonding force is higher 60.
Table 1: 60 oligonucleotide sequences stronger with rHuEPO-α binding affinity
Annotate, the italicized item among the SEQ ID NO:61-120 corresponds respectively to the fragment among the SEQ ID NO:1-60.
Sequence in the above-mentioned table all obtains through affine screening, constantly reduce the amount of target protein rHuEPO-α in the screening process, simultaneously carry out stricter control at aspects such as eluting powers, for example increase wash-out number of times etc., and add the tRNA competition in conjunction with itself being exactly the process that a kind of avidity is identified, therefore above-mentioned as can be known SEQ ID NO:1-120 has higher in conjunction with active to EPO.
According to Jalview2.3 and ClustalX (1.8) software, take turns the stochastic sequence division family that library, screening back obtains with the 6th, 7 and 8 respectively simultaneously, draw homologous sequence family (table 2-1-4-5).Wherein through six minimum aptamers sequence 813/813r (SEQ ID NO:113 of EMSA measuring dissociation constant, SEQ ID NO:53), 828/828r (SEQ ID NO:116, SEQ ID NO:56) and 850/850r (SEQ ID NO:120, SEQ ID NO:60) have DEVELOPMENT PROSPECT (Fig. 2) most.
Table 2-1
Table 2-2
Table 2-3
Table 3-1
Table 3-2
Table 3-3
Table 4-1
Table 4-2
Table 4-3
Table 4-4
Table 4-5
The electrophoretic mobility shift assay (EMSA) of 3. pairs of oligonucleotide libraries that filter out of embodiment
(1) to the labelled with radioisotope in ssDNA library
In the EP pipe, add 2 μ L mark damping fluids (10 * T4 polynueleotide kinase damping fluid, TaKaRa company), 30pmol treat the T4 polynueleotide kinase of the ssDNA of labelled with radioisotope (oligonucleotide library that screening obtains is taken turns in original ssDNA library and the 4th, 6,8), 4 μ L water, 20U (activity unit), 20 μ L Ci[γ-
32P] ATP, with water polishing volume to 20 μ L, mix, in 37 ℃ of incubations 1 hour.Immediately in 10 minutes activity of 68 ℃ of effects, and the ultrafiltration pipe of described solution with 30kDa filtered with inactivator, with remove free [γ-
32P] ATP, finally through water dissolution obtain 60 μ L through [γ-
32P] the ssDNA solution of ATP mark.
(2) EMSA measures
Get among the 25nM aforementioned (1) through [γ-
32P] the ssDNA library of ATP mark is respectively with 0,25,50,75,100,200,500,1000, the rHuEPO-α incubation of 1500nM.After native polyacrylamide gel electrophoresis through 12% separated ,-20 ℃ of exposures of spending the night were through the optical density value of each swimming lane spot of radioactive automatic developing post analysis.
Adopt Origin6.0 software that aptamers and rHuEPO-association reaction are combined into model with the medicine single-point and carry out the kinetics nonlinear fitting.
The effect ratio between albumen and nucleic acid set particularly is 1: 1 a relation, when fixed nucleic acid concentration increases proteic concentration, measures binding ratio therebetween.It is in conjunction with presenting nonlinear relationship.0-200nM albumen adds fashionable nucleic acid bonded protein content and increases sharply, and is tending towards saturated but the albumen of 200-1500nM adds the ability of back nucleic acid binding protein, presents platform trend.
Experimental result along with the avidity of carrying out oligonucleotide library and rHuEPO-α of screening increases gradually, is taken turns screening back avidity until the 8th and is reached the strongest as shown in Figure 3.
The mensuration of embodiment 4. aptamers dissociation constants
3 aptamers sequences 813 that mono-clonal obtains (SEQ ID NO:113), 828 (SEQID NO:116) and 850 (SEQ ID NO:120), the secondary structure analog result is single and free energy is lower, its Δ G is respectively-6.11 ,-6.16 and-9.28kcal.mol
-1, and sequence 828 to take turns in the library proportion the 8th the highest, therefore choose this three oligonucleotide sequences and adopt EMSA measuring dissociation constants.
The labelled with radioisotope method is with the step (1) of embodiment 3.
Get 25nM through [γ-
32P] 813,828 and 850,3 oligonucleotide sequences of aptamers sequence of ATP mark are respectively with 0,25,50,75,100,200,500,1000, the rHuEPO-α incubation of 1500nM.After non-denaturing polyacrylamide gel through 12% separates ,-20 ℃ of exposures of spending the night, the optical density value of each swimming lane of calculating behind radioactive automatic developing.
The result as shown in Figure 4, the dissociation constant of calculating oligonucleotide aptamers 813,828 and 850 through nonlinear fitting is respectively 260 ± 117nM, 82 ± 32nM and 590 ± 354nM.
The specificity experiment of embodiment 5. aptamers
Choose the highest oligonucleotide aptamers 828 of avidity as representing aptamers to carry out the specificity experiment.The labelled with radioisotope method is with the step (1) of embodiment 3.
Get 25nM through [γ-
32P] the ATP mark oligonucleotide aptamers 828 respectively with rHuEPO-α, the HSA of 1000nM, human hemoglobin, bovine serum albumin, N,O-Diacetylmuramidase, human IgG incubation altogether.After non-denaturing polyacrylamide gel through 12% separated ,-20 ℃ of exposures of spending the night compared analysis (Fig. 5) to each swimming lane behind radioactive automatic developing.
Experimental result finds that oligonucleotide aptamers sequence 828 does not interact with above-mentioned nonspecific proteins except that rHuEPO-α, illustrates that its specificity is better.
Embodiment 6Mg
2+
Specificity bonded influence between ion pair aptamers and rHuEPO
As representative, carry out the FRET experiment with effective truncated sequence ar (TTGAAAGGTCTGTTTTTGGGGTTGGTTTGGGTCAA (SEQ ID NO:123)) of the highest oligonucleotide aptamers 828 of avidity.
Get two fluorescent mark oligonucleotide aptamers truncated sequence FQ-828r of 10nM, respectively with different concns (0,2.5,5,10,20,50,100, the common incubation of rhEPO-α 200nM), solution system is screening damping fluid (20mM Tris, 140mM NaCl, 5mM KCl, 0 or 5mM Mg
2+, pH 7.4).
Experimental result finds that rhEPO-α is (0-20nM) when lower concentration, and the fluorescence of FRET system slightly raises, and is the ubiquitous phenomenon of this type of fluorescence system, owing to the fluorescence sensitivity effect of target protein self.When 50-100nM rhEPO-α concentration range, there is not Mg
2+When existing, the fluorescence of this system continues to increase; But there is Mg
2+The time, aptamers is with after the target protein specificity combines, and the 4bp of aptamers pairing stem structure begins stable existence, the distance of fluorophor and quenching group further shortens, show special fluorescent quenching effect, during 200nM rhEPO-α, the specific combination power of aptamers and target protein is at 5mM Mg
2+When existing, be no Mg
2+1 times (Fig. 6).Mg is described
2+Ionic exists, and specificity between aptamers and rHuEPO is combined, and particularly the combination during lower concentration has important promoter action.
The experiment that combines of embodiment 7. aptamers and commercialization EPO injection liquid
As representative, carry out commercialization EPO injection liquid with the highest oligonucleotide aptamers 828 of avidity in conjunction with experiment.
The oligonucleotide aptamers 828 of getting 1 μ M respectively with the Epiao injection liquid (rHuEPO-α) of 1 μ M and Recormon injection liquid (rHuEPO-β) incubation altogether.Non-denaturing polyacrylamide gel through 12% behind the ethidium bromide staining, compares analysis (Fig. 7) to each swimming lane after separating.
But experimental result is found oligonucleotide sequence 828 specificitys and is combined with rHuEPO in commercialization injection liquid Epiao and the Recormon.Because rHuEPO-α and rHuEPO-β have different content end branch sugar, illustrate that the aptamers that the present invention's screening obtains all has special binding characteristic to the different EPO of glycosylation.
With embodiment 5,7 similar methods other sequence is verified, obtained the test-results similar to 828.
The experiment that combines of embodiment 8. aptamers random fragments and commercialization EPO injection liquid
As representative, carry out commercialization EPO injection liquid with the random fragment (828r) of the highest oligonucleotide aptamers 828 of avidity in conjunction with experiment.
Get 1 μ M oligonucleotide aptamers 828 random fragment (828r) respectively with the Epiao injection liquid (rHuEPO-α) of 1 μ M and Recormon injection liquid (rHuEPO-β) incubation altogether.Non-denaturing polyacrylamide gel through 12% behind the ethidium bromide staining, compares analysis (Fig. 9) to each swimming lane after separating.
Experimental result find oligonucleotide aptamers sequence 828 random fragment (828r) but specificity combine with rHuEPO in commercialization injection liquid Epiao and the Recormon.Preliminary judgement obtains the random fragment of oligonucleotide aptamers by intended purposes, too effective aminoacid sequence in the specific recognition rHuEPO structure.
Other sequence is verified that each fragment has obtained the test-results similar to 828 random fragments with embodiment 7 similar methods.
RHuEPO-α after embodiment 9. aptamers random fragments and the de-glycosylation combines experiment
With the random fragment (828r) of the highest oligonucleotide aptamers 828 of avidity as representative, carry out after the de-glycosylation rHuEPO-α in conjunction with experiment.
Get 10 μ g rHuEPO-α standard substance, add the PNGase F Glycosylase of 4U and the NH of 20mM
4HCO
3(pH=8.0), the final volume that makes system is 30 μ L, behind 37 ℃ of reaction 24h, and 100 ℃ of heating 5min termination reactions.The rHuEPO-α (1 μ M) that gets the glycosylation front and back again is total to incubation with 1 μ M oligonucleotide aptamers random fragment 828r respectively, again through 12% non-denaturing polyacrylamide gel analysis, behind the ethidium bromide staining, each swimming lane is compared analysis (Figure 10).Preliminary judgement is effective too by the random fragment that intended purposes obtains the oligonucleotide aptamers, but the rHuEPO after the specific recognition de-glycosylation.
With the random fragment (828r) of the highest oligonucleotide aptamers 828 of avidity as representative, carry out human bladder cancer's epithelial cell (T24) people's lens normal epithelium cell (HEL) in conjunction with experiment.
With human bladder cancer's epithelial cell (T24) and people's lens normal epithelium cell (HEL) respectively after methyl alcohol-acetone (3: 7) is fixing, with 828r aptamers (2 μ g) and the common incubation of cell section; Clean 3 times through PBS, drip 0.25% Evans Blue solution room temperature dyeing 10min; PBS cleans 5 times; It is water stain to dry the section periphery, uses anti-fluorescence decay mountant mounting, places and observes (Figure 11) under the laser confocal microscope.
Obtain the random fragment of oligonucleotide aptamers as can be known according to the microscopy result, but endogenous uEPO (the Yasuda Y that secretion produces in the specific recognition cancer cells, Fujita Y, MatsuoT.Erythropoietin regulates tumour growth of human malignancies.Carcinogenesis.2003,24:1021-1029) and specificity better, do not interact with normal cell.Based on embodiment 7,8 and 9, endogenous uEPO has identical aminoacid sequence with rHuEPO-α and rHuEPO-β, and the oligonucleotide aptamers that can further know by inference among the application can effectively be discerned the inside and outside source EPO with same acid sequence.
For a person skilled in the art, in case learn can with EPO specificity bonded aptamers, can expect fully using it in the prior art, for example chip detection, test kit detect, even any embodiment is not provided, this purposes and product also can be expected fully in advance.
The invention effect
DNA aptamers of the present invention has the advantage of the protein antibodies that is different from traditional sense, and its molecular weight is little, and no immunizing antigen is easy to external synthesizing, and makes things convenient for mark.The oligonucleotide of labelled with radioisotope experiment simultaneously shows that DNA aptamers specificity of the present invention is better, and detectability reaches the nM level, has a good application prospect.Aptamers screening method of the present invention in addition makes up damping fluid improvement, anti-pre-treatment, affine technology, the marker detection etc. of sieving, and has obtained the aptamers of high specific, and empirical tests is a kind of screening method efficiently.
Sequence table
＜110〉Inst of Toxic Medicinal Materials, P.L.A. Academy of Military Medical Sciences
＜120〉specificity is in conjunction with DNA aptamers, the Its Preparation Method And Use of EPO
<130>IDC090114
<160>123
<170>PatentIn?version?3.2
<210>1
<211>38
<212>DNA
＜213〉artificial sequence
<400>1
tctttttatt?atatatctcg?ggtttggact?cctttatt 38
<210>2
<211>39
<212>DNA
＜213〉artificial sequence
<400>2
ttcttcttgg?tttggactgt?gtttgttttt?tcacagaaa 39
<210>3
<211>38
<212>DNA
＜213〉artificial sequence
<400>3
tttttttttt?cgttttcgtt?gttctccgtt?tatttata 38
<210>4
<211>39
<212>DNA
＜213〉artificial sequence
<400>4
ttattattgt?cttatatcgt?cggtttggac?ctctcttga 39
<210>5
<211>39
<212>DNA
＜213〉artificial sequence
<400>5
tgactcttct?ttggtttgga?gttcttttta?tgaacaaaa 39
<210>6
<211>39
<212>DNA
＜213〉artificial sequence
<400>6
ttctttggtt?ttttgtctcg?ggtttggact?ccttttttg 39
<210>7
<211>37
<212>DNA
＜213〉artificial sequence
<400>7
tttatttctc?gggtttggac?tctactttta?aatttgt 37
<210>8
<211>39
<212>DNA
＜213〉artificial sequence
<400>8
ttttttagta?ctgtctttct?cgggtttgga?ctccttttt 39
<210>9
<211>39
<212>DNA
＜213〉artificial sequence
<400>9
tgtttttctc?attttttctc?gggtttggac?tcctttttg 39
<210>10
<211>39
<212>DNA
＜213〉artificial sequence
<400>10
tcgttggttt?ggacctctat?atttttttat?tctagttga 39
<210>11
<211>39
<212>DNA
＜213〉artificial sequence
<400>11
tttttcgctt?aacgtttatt?tatagttaga?aaagtcttt 39
<210>12
<211>39
<212>DNA
＜213〉artificial sequence
<400>12
tttctgtttt?tcttctcgtc?ggtttggacc?tcctttgga 39
<210>13
<211>39
<212>DNA
＜213〉artificial sequence
<400>13
tttttctcgg?gtttggactc?ctttttcttt?ttcttctag 39
<210>14
<211>40
<212>DNA
＜213〉artificial sequence
<400>14
ttgtttattt?ctgttttcat?gtcgtctccg?tttatttata?40
<210>15
<211>37
<212>DNA
＜213〉artificial sequence
<400>15
attatttttg?gtttcttctc?gggtttggac?tcctttt 37
<210>16
<211>39
<212>DNA
＜213〉artificial sequence
<400>16
tttatttact?ttcttctttt?ctcgggtttg?gactccttt 39
<210>17
<211>38
<212>DNA
＜213〉artificial sequence
<400>17
tttcttggct?tgtgtttttg?ccgtttattt?ataggctt 38
<210>18
<211>38
<212>DNA
＜213〉artificial sequence
<400>18
tctttttatt?atatatctcg?ggtttgtact?cctttatt 38
<210>19
<211>39
<212>DNA
＜213〉artificial sequence
<400>19
ttttttcata?gggctctcgg?gtttggactc?ctttttttt 39
<210>20
<211>39
<212>DNA
＜213〉artificial sequence
<400>20
tttctctggt?tttgcatctc?gggtttggac?tccttactt 39
<210>21
<211>39
<212>DNA
＜213〉artificial sequence
<400>21
ctcttttgta?tttatctcgc?ttctctccgc?ttattcata 39
<210>22
<211>39
<212>DNA
＜213〉artificial sequence
<400>22
tttggtggga?ttctcgggtt?tggactcctt?ttatttttt 39
<210>23
<211>38
<212>DNA
＜213〉artificial sequence
<400>23
ttgttttatc?tagtcggttt?ggacctgttt?tcttaata 38
<210>24
<211>39
<212>DNA
＜213〉artificial sequence
<400>24
tctgtacatt?tttctcctgg?tttggagctt?tttaagcaa 39
<210>25
<211>38
<212>DNA
＜213〉artificial sequence
<400>25
ttattttttt?ttttttgttc?tcgggtttgg?actccttt 38
<210>26
<211>37
<212>DNA
＜213〉artificial sequence
<400>26
gattgtttcc?ggtttggagt?cttcatattt?gtagaca 37
<210>27
<211>38
<212>DNA
＜213〉artificial sequence
<400>27
tttctatctc?gggtttggac?tcctttattt?attctaat 38
<210>28
<211>37
<212>DNA
＜213〉artificial sequence
<400>28
gattgtttcc?ggtttggggt?cttcatattt?gtagaca 37
<210>29
<211>38
<212>DNA
＜213〉artificial sequence
<400>29
ttttgtctcg?ggtttggact?ccattttttt?ttctcttt 38
<210>30
<211>38
<212>DNA
＜213〉artificial sequence
<400>30
tatctcgggt?ttggactcct?gtttgtgatg?attgtatt 38
<210>31
<211>38
<212>DNA
＜213〉artificial sequence
<400>31
tttctcgggt?ttggactccg?gttttttttt?gtttttat 38
<210>32
<211>39
<212>DNA
＜213〉artificial sequence
<400>32
ttgtttttgt?tctcgggttt?ggactcctgt?tttcagtta 39
<210>33
<211>39
<212>DNA
＜213〉artificial sequence
<400>33
attgttttga?tctcgggttt?ggactcctca?tttttttta 39
<210>34
<211>39
<212>DNA
＜213〉artificial sequence
<400>34
ttttctctcc?tattatttat?ctcgggtttg?gactccttt 39
<210>35
<211>37
<212>DNA
＜213〉artificial sequence
<400>35
tctttttatt?atatatctcg?ggtttggact?cctttat 37
<210>36
<211>39
<212>DNA
＜213〉artificial sequence
<400>36
tcgttgacgg?tttggagttc?gttttattat?ttacggaca 39
<210>37
<211>40
<212>DNA
＜213〉artificial sequence
<400>37
tttgtttcat?agatcaactt?tatgtggttt?ggagttctgt 40
<210>38
<211>40
<212>DNA
＜213〉artificial sequence
<400>38
tttttttttt?tgttgatctt?ctcgggtttg?gactcctttt 40
<210>39
<211>39
<212>DNA
＜213〉artificial sequence
<400>39
gaattttggg?gtttggcagt?tttggttcgg?gtctaattc 39
<210>40
<211>40
<212>DNA
＜213〉artificial sequence
<400>40
gcctttgttt?tctatatctc?gggtttggac?tccttatttt 40
<210>41
<211>39
<212>DNA
＜213〉artificial sequence
<400>41
ttctcgggtt?tggactcctt?tttttctgta?ttttttctt 39
<210>42
<211>39
<212>DNA
＜213〉artificial sequence
<400>42
tctagaggtt?tctcgggttt?ggacttcgtt?aagtttaac 39
<210>43
<211>39
<212>DNA
＜213〉artificial sequence
<400>43
ttatttagtc?tcgggtttgg?acttcatctt?tggttagat 39
<210>44
<211>37
<212>DNA
＜213〉artificial sequence
<400>44
tcatctagtc?ggtttggacc?tttgttattt?ttgcaaa 37
<210>45
<211>39
<212>DNA
＜213〉artificial sequence
<400>45
tttagttgga?gtttgttatt?tcgagggttt?ggactcctt 39
<210>46
<211>40
<212>DNA
＜213〉artificial sequence
<400>46
ttttttattc?ttatctcggg?tttggactcc?gctatttttt 40
<210>47
<211>37
<212>DNA
＜213〉artificial sequence
<400>47
tctcagcaaa?tctttgattg?gtttggagct?gggatag 37
<210>48
<211>39
<212>DNA
＜213〉artificial sequence
<400>48
ttttatcgtc?aaaaagacat?catttttttc?ttttggttt 39
<210>49
<211>39
<212>DNA
＜213〉artificial sequence
<400>49
ttattagttt?ttaatctcgt?tttactccgc?ttatttata 39
<210>50
<211>39
<212>DNA
＜213〉artificial sequence
<400>50
gattgaaagg?tctgtttctg?gggttggttt?gggtcaata 39
<210>51
<211>48
<212>DNA
＜213〉artificial sequence
<400>51
gcttatttat?aggaagtttg?ttttttcggt?ctgcgtttat?ttatagca 48
<210>52
<211>40
<212>DNA
＜213〉artificial sequence
<400>52
ttttatttcc?gtcgctaggt?ttgtttttgg?ggttggtttg 40
<210>53
<211>40
<212>DNA
＜213〉artificial sequence
<400>53
tttttgctga?tctcgggttt?ggactcctgt?ttatttataa 40
<210>54
<211>41
<212>DNA
＜213〉artificial sequence
<400>54
ttttttattc?ttatctcggg?tttggactcc?gcttatttat?a 41
<210>55
<211>44
<212>DNA
＜213〉artificial sequence
<400>55
tttttttttt?attgtttctc?gggtttggac?tccgtttatt?tata 44
<210>56
<211>39
<212>DNA
＜213〉artificial sequence
<400>56
gattgaaagg?tctgtttttg?gggttggttt?gggtcaata 39
<210>57
<211>38
<212>DNA
＜213〉artificial sequence
<400>57
gtttatttat?aggttttggt?ggtatccgtt?tattcata 38
<210>58
<211>39
<212>DNA
＜213〉artificial sequence
<400>58
tttttttgtt?cgtgttcggg?tttggcttgg?ttatttatc 39
<210>59
<211>36
<212>DNA
＜213〉artificial sequence
<400>59
tctcgggttt?ggactccttg?tcgcttattt?atagac 36
<210>60
<211>38
<212>DNA
＜213〉artificial sequence
<400>60
gaaagaagtt?tggtttgatc?aagctggttt?ggactttc 38
<210>61
<211>79
<212>DNA
＜213〉artificial sequence
<400>61
cttctgcccg?cctccttcct?ctttttatta?tatatctcgg?gtttggactc?ctttattgga 60
gacgagatag?gcggacact 79
<210>62
<211>80
<212>DNA
＜213〉artificial sequence
<400>62
cttctgcccg?cctccttcct?tcttcttggt?ttggactgtg?tttgtttttt?cacagaaagg 60
agacgagata?ggcggacact 80
<210>63
<211>79
<212>DNA
＜213〉artificial sequence
<400>63
cttctgcccg?cctccttcct?tttttttttc?gttttcgttg?ttctccgttt?atttatagga 60
gacgagatag?gcggacact 79
<210>64
<211>80
<212>DNA
＜213〉artificial sequence
<400>64
cttctgcccg?cctccttcct?tattattgtc?ttatatcgtc?ggtttggacc?tctcttgagg 60
agacgagata?ggcggacact 80
<210>65
<211>80
<212>DNA
＜213〉artificial sequence
<400>65
cttctgcccg?cctccttcct?gactcttctt?tggtttggag?ttctttttat?gaacaaaagg 60
agacgagata?ggcggacact 80
<210>66
<211>80
<212>DNA
＜213〉artificial sequence
<400>66
cttctgcccg?cctccttcct?tctttggttt?tttgtctcgg?gtttggactc?cttttttggg 60
agacgagata?ggcggacact 80
<210>67
<211>78
<212>DNA
＜213〉artificial sequence
<400>67
cttctgcccg?cctccttcct?ttatttctcg?ggtttggact?ctacttttaa?atttgtggag 60
acgagatagg?cggacact 78
<210>68
<211>80
<212>DNA
＜213〉artificial sequence
<400>68
cttctgcccg?cctccttcct?tttttagtac?tgtctttctc?gggtttggac?tcctttttgg 60
agacgagata?ggcggacact 80
<210>69
<211>80
<212>DNA
＜213〉artificial sequence
<400>69
cttctgcccg?cctccttcct?gtttttctca?ttttttctcg?ggtttggact?cctttttggg 60
agacgagata?ggcggacact 80
<210>70
<211>80
<212>DNA
＜213〉artificial sequence
<400>70
cttctgcccg?cctccttcct?cgttggtttg?gacctctata?tttttttatt?ctagttgagg 60
agacgagata?ggcggacact 80
<210>71
<211>80
<212>DNA
＜213〉artificial sequence
<400>71
cttctgcccg?cctccttcct?ttttcgctta?acgtttattt?atagttagaa?aagtctttgg 60
agacgagata?ggcggacact 80
<210>72
<211>80
<212>DNA
＜213〉artificial sequence
<400>72
cttctgcccg?cctccttcct?ttctgttttt?cttctcgtcg?gtttggacct?cctttggagg 60
agacgagata?ggcggacact 80
<210>73
<211>80
<212>DNA
＜213〉artificial sequence
<400>73
cttctgcccg?cctccttcct?ttttctcggg?tttggactcc?tttttctttt?tcttctaggg 60
agacgagata?ggcggacact 80
<210>74
<211>81
<212>DNA
＜213〉artificial sequence
<400>74
cttctgcccg?cctccttcct?tgtttatttc?tgttttcatg?tcgtctccgt?ttatttatag 60
gagacgagat?aggcggacac?t 81
<210>75
<211>78
<212>DNA
＜213〉artificial sequence
<400>75
cttctgcccg?cctccttcca?ttatttttgg?tttcttctcg?ggtttggact?ccttttggag 60
acgagatagg?cggacact 78
<210>76
<211>80
<212>DNA
＜213〉artificial sequence
<400>76
cttctgcccg?cctccttcct?ttatttactt?tcttcttttc?tcgggtttgg?actcctttgg 60
agacgagata?ggcggacact 80
<210>77
<211>79
<212>DNA
＜213〉artificial sequence
<400>77
cttctgcccg?cctccttcct?ttcttggctt?gtgtttttgc?cgtttattta?taggcttgga 60
gacgagatag?gcggacact 79
<210>78
<211>79
<212>DNA
＜213〉artificial sequence
<400>78
cttctgcccg?cctccttcct?ctttttatta?tatatctcgg?gtttgtactc?ctttattgga 60
gacgagatag?gcggacact 79
<210>79
<211>80
<212>DNA
＜213〉artificial sequence
<400>79
cttctgcccg?cctccttcct?tttttcatag?ggctctcggg?tttggactcc?ttttttttgg 60
agacgagata?ggcggacact 80
<210>80
<211>80
<212>DNA
＜213〉artificial sequence
<400>80
cttctgcccg?cctccttcct?ttctctggtt?ttgcatctcg?ggtttggact?ccttacttgg 60
agacgagata?ggcggacact 80
<210>81
<211>80
<212>DNA
＜213〉artificial sequence
<400>81
cttctgcccg?cctccttccc?tcttttgtat?ttatctcgct?tctctccgct?tattcatagg 60
agacgagata?ggcggacact 80
<210>82
<211>80
<212>DNA
＜213〉artificial sequence
<400>82
cttctgcccg?cctccttcct?ttggtgggat?tctcgggttt?ggactccttt?tattttttgg 60
agacgagata?ggcggacact 80
<210>83
<211>79
<212>DNA
＜213〉artificial sequence
<400>83
cttctgcccg?cctccttcct?tgttttatct?agtcggtttg?gacctgtttt?cttaatagga 60
gacgagatag?gcggacact 79
<210>84
<211>80
<212>DNA
＜213〉artificial sequence
<400>84
cttctgcccg?cctccttcct?ctgtacattt?ttctcctggt?ttggagcttt?ttaagcaagg 60
agacgagata?ggcggacact 80
<210>85
<211>79
<212>DNA
＜213〉artificial sequence
<400>85
cttctgcccg?cctccttcct?tatttttttt?tttttgttct?cgggtttgga?ctcctttgga 60
gacgagatag?gcggacact 79
<210>86
<211>78
<212>DNA
＜213〉artificial sequence
<400>86
cttctgcccg?cctccttccg?attgtttccg?gtttggagtc?ttcatatttg?tagacaggag 60
acgagatagg?cggacact 78
<210>87
<211>79
<212>DNA
＜213〉artificial sequence
<400>87
cttctgcccg?cctccttcct?ttctatctcg?ggtttggact?cctttattta?ttctaatgga 60
gacgagatag?gcggacact 79
<210>88
<211>78
<212>DNA
＜213〉artificial sequence
<400>88
cttctgcccg?cctccttccg?attgtttccg?gtttggggtc?ttcatatttg?tagacaggag 60
acgagatagg?cggacact 78
<210>89
<211>79
<212>DNA
＜213〉artificial sequence
<400>89
cttctgcccg?cctccttcct?tttgtctcgg?gtttggactc?catttttttt tctctttgga 60
gacgagatag?gcggacact 79
<210>90
<211>79
<212>DNA
＜213〉artificial sequence
<400>90
cttctgcccg?cctccttcct?atctcgggtt?tggactcctg?tttgtgatga?ttgtattgga 60
gacgagatag?gcggacact 79
<210>91
<211>79
<212>DNA
＜213〉artificial sequence
<400>91
cttctgcccg?cctccttcct?ttctcgggtt?tggactccgg?tttttttttg?tttttatgga 60
gacgagatag?gcggacact 79
<210>92
<211>80
<212>DNA
＜213〉artificial sequence
<400>92
cttctgcccg?cctccttcct?tgtttttgtt?ctcgggtttg?gactcctgtt?ttcagttagg 60
agacgagata?ggcggacact 80
<210>93
<211>80
<212>DNA
＜213〉artificial sequence
<400>93
cttctgcccg?cctccttcca?ttgttttgat?ctcgggtttg?gactcctcat?tttttttagg 60
agacgagata?ggcggacact 80
<210>94
<211>80
<212>DNA
＜213〉artificial sequence
<400>94
cttctgcccg?cctccttcct?tttctctcct?attatttatc?tcgggtttgg?actcctttgg 60
agacgagata?ggcggacact 80
<210>95
<211>78
<212>DNA
＜213〉artificial sequence
<400>95
cttctgcccg?cctccttcct?ctttttatta?tatatctcgg?gtttggactc?ctttatggag 60
acgagatagg?cggacact 78
<210>96
<211>80
<212>DNA
＜213〉artificial sequence
<400>96
cttctgcccg?cctccttcct?cgttgacggt?ttggagttcg?ttttattatt?tacggacagg 60
agacgagata?ggcggacact 80
<210>97
<211>81
<212>DNA
＜213〉artificial sequence
<400>97
cttctgcccg?cctccttcct?ttgtttcata?gatcaacttt?atgtggtttg?gagttctgtg 60
gagacgagat?aggcggacac?t 81
<210>98
<211>81
<212>DNA
＜213〉artificial sequence
<400>98
cttctgcccg?cctccttcct?tttttttttt?gttgatcttc?tcgggtttgg?actccttttg 60
gagacgagat?aggcggacac?t 81
<210>99
<211>80
<212>DNA
＜213〉artificial sequence
<400>99
cttctgcccg?cctccttccg?aattttgggg?tttggcagtt?ttggttcggg?tctaattcgg 60
agacgagata?ggcggacact 80
<210>100
<211>81
<212>DNA
＜213〉artificial sequence
<400>100
cttctgcccg?cctccttccg?cctttgtttt?ctatatctcg?ggtttggact?ccttattttg 60
gagacgagat?aggcggacac?t 81
<210>101
<211>80
<212>DNA
＜213〉artificial sequence
<400>101
cttctgcccg?cctccttcct?tctcgggttt?ggactccttt?ttttctgtat?tttttcttgg 60
agacgagata?ggcggacact 80
<210>102
<211>80
<212>DNA
＜213〉artificial sequence
<400>102
cttctgcccg?cctccttcct?ctagaggttt?ctcgggtttg?gacttcgtta?agtttaacgg 60
agacgagata?ggcggacact 80
<210>103
<211>80
<212>DNA
＜213〉artificial sequence
<400>103
cttctgcccg?cctccttcct?tatttagtct?cgggtttgga?cttcatcttt?ggttagatgg 60
agacgagata?ggcggacact 80
<210>104
<211>78
<212>DNA
＜213〉artificial sequence
<400>104
cttctgcccg?cctccttcct?catctagtcg?gtttggacct?ttgttatttt?tgcaaaggag 60
acgagatagg?cggacact 78
<210>105
<211>80
<212>DNA
＜213〉artificial sequence
<400>105
cttctgcccg?cctccttcct?ttagttggag?tttgttattt?cgagggtttg?gactccttgg 60
agacgagata?ggcggacact 80
<210>106
<211>81
<212>DNA
＜213〉artificial sequence
<400>106
cttctgcccg?cctccttcct?tttttattct?tatctcgggt?ttggactccg?ctattttttg 60
gagacgagat?aggcggacac?t 81
<210>107
<211>78
<212>DNA
＜213〉artificial sequence
<400>107
cttctgcccg?cctccttcct?ctcagcaaat?ctttgattgg?tttggagctg?ggatagggag 60
acgagatagg?cggacact 78
<210>108
<211>80
<212>DNA
＜213〉artificial sequence
<400>108
cttctgcccg?cctccttcct?tttatcgtca?aaaagacatc?atttttttct?tttggtttgg 60
agacgagata?ggcggacact 80
<210>109
<211>80
<212>DNA
＜213〉artificial sequence
<400>109
cttctgcccg?cctccttcct?tattagtttt?taatctcgtt?ttactccgct?tatttatagg 60
agacgagata?ggcggacact 80
<210>110
<211>80
<212>DNA
＜213〉artificial sequence
<400>110
cttctgcccg?cctccttccg?attgaaaggt?ctgtttctgg?ggttggtttg?ggtcaatagg 60
agacgagata?ggcggacact 80
<210>111
<211>89
<212>DNA
＜213〉artificial sequence
<400>111
cttctgcccg?cctccttccg?cttatttata?ggaagtttgt?tttttcggtc?tgcgtttatt 60
tatagcagga?gacgagatag?gcggacact 89
<210>112
<211>81
<212>DNA
＜213〉artificial sequence
<400>112
cttctgcccg?cctccttcct?tttatttccg?tcgctaggtt?tgtttttggg?gttggtttgg 60
gagacgagat?aggcggacac?t 81
<210>113
<211>81
<212>DNA
＜213〉artificial sequence
<400>113
cttctgcccg?cctccttcct?ttttgctgat?ctcgggtttg?gactcctgtt?tatttataag 60
gagacgagat?aggcggacac?t 81
<210>114
<211>82
<212>DNA
＜213〉artificial sequence
<400>114
cttctgcccg?cctccttcct?tttttattct?tatctcgggt?ttggactccg?cttatttata 60
ggagacgaga?taggcggaca?ct 82
<210>115
<211>85
<212>DNA
＜213〉artificial sequence
<400>115
cttctgcccg?cctccttcct?ttttttttta?ttgtttctcg?ggtttggact?ccgtttattt 60
ataggagacg?agataggcgg?acact 85
<210>116
<211>80
<212>DNA
＜213〉artificial sequence
<400>116
cttctgcccg?cctccttccg?attgaaaggt?ctgtttttgg?ggttggtttg?ggtcaatagg 60
agacgagata?ggcggacact 80
<210>117
<211>79
<212>DNA
＜213〉artificial sequence
<400>117
cttctgcccg?cctccttccg?tttatttata?ggttttggtg?gtatccgttt?attcatagga 60
gacgagatag?gcggacact 79
<210>118
<211>80
<212>DNA
＜213〉artificial sequence
<400>118
cttctgcccg?cctccttcct?ttttttgttc?gtgttcgggt?ttggcttggt?tatttatcgg 60
agacgagata?ggcggacact 80
<210>119
<211>77
<212>DNA
＜213〉artificial sequence
<400>119
cttctgcccg?cctccttcct?ctcgggtttg?gactccttgt?cgcttattta?tagacggaga 60
cgagataggc?ggacact 77
<210>120
<211>79
<212>DNA
＜213〉artificial sequence
<400>120
cttctgcccg?cctccttccg?aaagaagttt?ggtttgatca?agctggtttg?gactttcgga 60
gacgagatag?gcggacact 79
<210>121
<211>19
<212>DNA
＜213〉artificial sequence
<400>121
cttctgcccg?cctccttcc 19
<210>122
<211>22
<212>DNA
＜213〉artificial sequence
<400>122
agtgtccgcc?tatctcgtct?cc 22
<210>123
<211>35
<212>DNA
＜213〉artificial sequence
<400>123
ttgaaaggtc?tcgtttttgg?ggttggtttg?ggtcaa 35
Claims (10)
1. specificity is in conjunction with the aptamers of epo protein, and it is selected from the sequence shown in SEQ ID NO:1～120 one or more.
2. aptamers according to claim 1, it is selected from the sequence shown in the SEQ ID NO:53,56,60,113,116 and 120.
3. according to described each aptamers of claim 1-2, it can be strengthened its transformation period, improve its stability, prevent that the compound of endonuclease or excision enzyme cutting from modifying.
4. be used for composition, test kit and chip that epo protein detects, wherein contain among the claim 1-3 each aptamers.
5. aptamers according to claim 4, epo protein wherein are selected from one or more in natural EPO albumen, rHuEPO-α albumen, rHuEPO-β albumen and the deglycosylated above-mentioned epo protein.
6. each aptamers is used for the purposes that epo protein detects among the claim 1-3.
7. aptamers according to claim 6, epo protein wherein are selected from one or more in natural EPO albumen, rHuEPO-α albumen, rHuEPO-β albumen and the deglycosylated above-mentioned epo protein.
8. the screening specificity comprises step (a)-(1) in conjunction with the method for the aptamers of epo protein:
(a) provide following (i)-(iv):
(i) screening library: ssDNA library;
(ii) target protein: epo protein, epo protein wherein are selected from one or more in natural EPO albumen, rHUEPO-α albumen, rHUEPO-β albumen and the deglycosylated above-mentioned epo protein, preferred rHUEPO-α albumen;
(iii) affine resin: coupling has couple EPO that the resin of the material of specificity avidity is arranged, and preferred coupling has the agarose resin of wheat germ agglutinin; With
(iv) coupling EPO arranged affine resin (iii);
(b) the screening library in the step (a) is (iii) contacted under suitable condition with affine resin,
Described contact can comprise incubation, washing,
Described " suitable condition " be meant the member that is enough to make in the screening library can with affine resin specificity bonded bonded condition, this condition can relate to composition, the pH value of temperature, action time, binding buffer liquid;
Collect then not and (iii) bonded ssDNA library of affine resin;
(c) make in the step (b) and (iii) (iv) under suitable condition, do not contact with affine resin in bonded ssDNA library with affine resin,
Described contact can comprise incubation, washing,
Described " suitable condition " be meant the member that is enough to make in the screening library can with affine resin specificity bonded bonded condition, this condition can relate to composition, the pH value of temperature, action time, binding buffer liquid;
(d) collect handle through step (c) with (iv) bonded library member of affine resin;
(e) randomly to the library member of step (d) processing of increasing;
(f) (iv) under suitable condition, contacting or in the library member (e) and the step (a), described " suitable condition " with step (d) be meant be enough to make step (d) or (e) in the library member can with EPO specificity bonded condition;
(g) randomly, carry out the condition severization and handle in step (f), described processing is selected from the consumption of minimizing target protein EPO, increases washing step and one or more among the adding noncompetitive inhibitor tRNA in contact procedure after contact procedure;
(h) be collected in step (f) or (g) in (iv) specificity bonded library member;
(j) repeating step (e)-(h), multiplicity is 1,2,3,4,5,6,7,8 time, preferably repeats 6-8 time, more preferably repeats 8 times;
(k) the library member that (g) step is obtained confirms, preferred sequence is measured; With
(l) randomly, the library member who obtains is carried out Function detection, preferred electrophoretic mobility shift assay (EMSA).
9. screening method according to claim 7, wherein Shi Yi condition is meant that heated culture temperature is 37 ℃, and be 1h action time, and 1 * liquid storage prescription of screening liquid is: 20mM Tris-HCl, 140mM NaCl, 5mM MgCl
2, 5mM KCl, wherein Mg
2+Working concentration remain on 0.1-50mM, preferred Mg
2+Working concentration be 0.1,5,10,20,50mM, most preferably 5mM.
10. according to claim 1 and 8 described aptamers, epo protein wherein is selected from one or more in natural EPO albumen, rHuEPO-α albumen, rHuEPO-β albumen and the deglycosylated above-mentioned epo protein.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010131512 CN102191250B (en) | 2010-03-19 | 2010-03-19 | DNA (Desoxyribonucleic Acid) ligand for specific binding with EPO (erythropoietin), preparation method thereof and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201010131512 CN102191250B (en) | 2010-03-19 | 2010-03-19 | DNA (Desoxyribonucleic Acid) ligand for specific binding with EPO (erythropoietin), preparation method thereof and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN102191250A true CN102191250A (en) | 2011-09-21 |
| CN102191250B CN102191250B (en) | 2013-09-18 |
Family
ID=44600120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201010131512 Active CN102191250B (en) | 2010-03-19 | 2010-03-19 | DNA (Desoxyribonucleic Acid) ligand for specific binding with EPO (erythropoietin), preparation method thereof and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN102191250B (en) |
Cited By (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643821A (en) * | 2012-01-05 | 2012-08-22 | 集美大学 | Aeromonas hydrophila aptamer, and screening method and application thereof |
| CN103468702A (en) * | 2012-01-05 | 2013-12-25 | 集美大学 | Aeromonas hydrophila aptamer as well as screening method and application thereof |
| CN103571845A (en) * | 2013-11-22 | 2014-02-12 | 中国人民解放军第三军医大学第三附属医院 | Aptamer for inhibiting mast cell calcium channel and preparation method thereof |
| CN106434675A (en) * | 2016-10-17 | 2017-02-22 | 柳州立洁科技有限公司 | Aptamer EPO1 (erythropoietin 1) capable of quickly detecting polypeptide-type dopes and preparation method thereof |
| CN106480041A (en) * | 2016-10-17 | 2017-03-08 | 柳州立洁科技有限公司 | Erythropoietin aptamer and preparation method thereof |
| CN106480039A (en) * | 2016-10-13 | 2017-03-08 | 南京大学 | A kind of method that utilization micro-fluidic chip screens aptamers |
| CN106480040A (en) * | 2016-10-17 | 2017-03-08 | 柳州立洁科技有限公司 | High sensitivity excitant aptamer EPO3 and preparation method thereof |
| CN106480044A (en) * | 2016-10-17 | 2017-03-08 | 柳州立洁科技有限公司 | Analeptic aptamer EPO5 and preparation method thereof |
| CN106501534A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Using the anti-depressant test kit of nucleic acid aptamer fluorescence probe quick detection polypeptide type and its detection method |
| CN106501527A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Erythropoietin analeptic test kit and its detection method based on the fit fluorescent probe EPO3 of highly sensitive nucleic acid |
| CN106501533A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Based on high-affinity analeptic aptamer EPO4 erythropoietin analeptic test kits and its detection method |
| CN106501226A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Analeptic test kit and its detection method using analeptic aptamer EPO5 |
| CN106645051A (en) * | 2016-10-17 | 2017-05-10 | 柳州立洁科技有限公司 | Erythropoietin stimulant kit and detection method thereof |
| CN106636102A (en) * | 2016-10-17 | 2017-05-10 | 柳州立洁科技有限公司 | High affinity stimulant aptamer EPO4 and preparation method thereof |
| CN106757377A (en) * | 2016-12-08 | 2017-05-31 | 中国人民解放军军事医学科学院毒物药物研究所 | A kind of aptamers combinatorial libraries, its construction method and purposes |
| CN114621958A (en) * | 2022-02-16 | 2022-06-14 | 江南大学 | Single-stranded DNA aptamer sequence for specifically recognizing ATP and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999054506A1 (en) * | 1998-04-20 | 1999-10-28 | Bioage Pharmaceuticals, Inc. | Method of isolating target specific oligonucleotide ligands |
-
2010
- 2010-03-19 CN CN 201010131512 patent/CN102191250B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1999054506A1 (en) * | 1998-04-20 | 1999-10-28 | Bioage Pharmaceuticals, Inc. | Method of isolating target specific oligonucleotide ligands |
Non-Patent Citations (3)
| Title |
|---|
| 《Talanta》 20090828 Zhaoyang Zhang et al. An aptameric molecular beacon-based "Signal-on"approach for rapid determination of rHuEPO-alpha 第986页左栏第2段，表1 1-10 第80卷, * |
| 《天津医药》 20091231 李君等 两种方法检测促红细胞生成素的方法学比较 698-699 1-10 第37卷, 第8期 * |
| ZHAOYANG ZHANG ET AL.: "An aptameric molecular beacon-based "Signal-on"approach for rapid determination of rHuEPO-α", 《TALANTA》 * |
Cited By (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102643821A (en) * | 2012-01-05 | 2012-08-22 | 集美大学 | Aeromonas hydrophila aptamer, and screening method and application thereof |
| CN103468702A (en) * | 2012-01-05 | 2013-12-25 | 集美大学 | Aeromonas hydrophila aptamer as well as screening method and application thereof |
| CN103468685A (en) * | 2012-01-05 | 2013-12-25 | 集美大学 | Aeromonas hydrophila aptamer, and screening method and application thereof |
| CN103468685B (en) * | 2012-01-05 | 2016-04-27 | 集美大学 | Aeromonas hydrophila is fit and screening method and application |
| CN103468702B (en) * | 2012-01-05 | 2017-04-12 | 集美大学 | Aeromonas hydrophila aptamer as well as screening method and application thereof |
| CN103571845A (en) * | 2013-11-22 | 2014-02-12 | 中国人民解放军第三军医大学第三附属医院 | Aptamer for inhibiting mast cell calcium channel and preparation method thereof |
| CN106480039B (en) * | 2016-10-13 | 2019-11-12 | 南京大学 | A method of aptamers are screened using micro-fluidic chip |
| CN106480039A (en) * | 2016-10-13 | 2017-03-08 | 南京大学 | A kind of method that utilization micro-fluidic chip screens aptamers |
| CN106501534A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Using the anti-depressant test kit of nucleic acid aptamer fluorescence probe quick detection polypeptide type and its detection method |
| CN106480044A (en) * | 2016-10-17 | 2017-03-08 | 柳州立洁科技有限公司 | Analeptic aptamer EPO5 and preparation method thereof |
| CN106480040A (en) * | 2016-10-17 | 2017-03-08 | 柳州立洁科技有限公司 | High sensitivity excitant aptamer EPO3 and preparation method thereof |
| CN106501527A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Erythropoietin analeptic test kit and its detection method based on the fit fluorescent probe EPO3 of highly sensitive nucleic acid |
| CN106501533A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Based on high-affinity analeptic aptamer EPO4 erythropoietin analeptic test kits and its detection method |
| CN106501226A (en) * | 2016-10-17 | 2017-03-15 | 柳州立洁科技有限公司 | Analeptic test kit and its detection method using analeptic aptamer EPO5 |
| CN106480041A (en) * | 2016-10-17 | 2017-03-08 | 柳州立洁科技有限公司 | Erythropoietin aptamer and preparation method thereof |
| CN106645051A (en) * | 2016-10-17 | 2017-05-10 | 柳州立洁科技有限公司 | Erythropoietin stimulant kit and detection method thereof |
| CN106636102A (en) * | 2016-10-17 | 2017-05-10 | 柳州立洁科技有限公司 | High affinity stimulant aptamer EPO4 and preparation method thereof |
| CN106434675A (en) * | 2016-10-17 | 2017-02-22 | 柳州立洁科技有限公司 | Aptamer EPO1 (erythropoietin 1) capable of quickly detecting polypeptide-type dopes and preparation method thereof |
| CN106757377A (en) * | 2016-12-08 | 2017-05-31 | 中国人民解放军军事医学科学院毒物药物研究所 | A kind of aptamers combinatorial libraries, its construction method and purposes |
| CN114621958A (en) * | 2022-02-16 | 2022-06-14 | 江南大学 | Single-stranded DNA aptamer sequence for specifically recognizing ATP and application thereof |
| CN114621958B (en) * | 2022-02-16 | 2023-09-22 | 江南大学 | Single-stranded DNA aptamer sequence for specifically recognizing ATP and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN102191250B (en) | 2013-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102191250B (en) | DNA (Desoxyribonucleic Acid) ligand for specific binding with EPO (erythropoietin), preparation method thereof and application thereof | |
| EP3018212B1 (en) | Oligonucleotide aptamer specifically recognizing t-2 toxin | |
| CN108484779B (en) | Fusion protein of nano antibody and human placenta alkaline phosphatase and application | |
| CN108918885B (en) | Aptamer specifically binding to fish parvalbumin, kit and detection method | |
| CN108048407B (en) | Hybridoma cell strain, monoclonal antibody resisting human CTRP3 and application thereof | |
| CN113045666B (en) | Pepsinogen II monoclonal antibody and application thereof | |
| CN114133452A (en) | Heparin binding protein antibody, kit and application thereof | |
| CN101280001B (en) | Preparation of human SDF-1 alpha, human SDF-1 alpha obtained therefrom and use thereof | |
| CN116536269B (en) | CHO cell strain, fibrinogen degradation product FDP antibody and application thereof | |
| CN113717285B (en) | Anti-human D-dimer antibodies and uses thereof | |
| CN113683684B (en) | Anti-hepatitis B virus surface antigen antibody, antibody pair, detection reagent containing same and kit | |
| CN106248971A (en) | For detecting the ELISA kit of HER2 content, using method and purposes in human serum | |
| CN103389380A (en) | A double antibody sandwich ELISA method for the detection of goose FSH | |
| CN105968205A (en) | Nano antibody for anti-prostate specific membrane antigen | |
| CN114621344B (en) | Purification method of anti-LAG-3 monoclonal antibody | |
| CN113929776A (en) | Antifungal (1, 3) -beta-D glucan monoclonal antibody, encoding gene thereof, expression and application thereof | |
| CN103088033A (en) | Antibody gene for resisting pyrethriods pesticide scFv (Single Chain Fragment Variable) and application of antibody gene | |
| CN104650245A (en) | Fused folate-binding protein, gene sequence and kit | |
| CN105085652A (en) | Platelet-derived growth factor-B mutant and preparation method and application thereof | |
| CN116284415B (en) | Plasmin-alpha 2 anti-plasmin complex monoclonal antibody, preparation and application thereof | |
| CN116284417B (en) | Thrombin-antithrombin complex antibody, its preparation method and application | |
| CN106480042A (en) | A kind of quick identification insulin aptamer INS2 and preparation method thereof | |
| JP5560608B2 (en) | Purification method of autotaxin | |
| CN113009139B (en) | Enzyme linked immunosorbent assay kit for detecting porcine pseudorabies virus antigen and application thereof | |
| CN116731170A (en) | Fully human anti-human Ang2 antibody and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |